Application of the StGAD1 gene in regulating potato low-temperature resistance

By regulating the potato glutamate decarboxylase StGAD1 gene using CRISPR/Cas9 gene editing technology, the problem of unresolved regulatory network in the potato's low-temperature stress response was solved, achieving a breeding effect that enhances cold resistance.

CN120366375BActive Publication Date: 2026-04-21SANYA INST OF HENAN UNIV
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202510845947.0
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-06-24
Publication Date
2026-04-21
Estimated Expiration
2045-06-24

AI Technical Summary

Technical Problem

Existing technologies have failed to effectively analyze the GAD1 gene regulatory network in potato low-temperature stress response, resulting in the underutilization of the application value of potato low-temperature resistance breeding.

Method used

By knocking out or overexpressing the potato glutamate decarboxylase StGAD1 gene using CRISPR/Cas9 gene editing technology, plant cold resistance can be regulated. The gene can then be introduced into target plant cells using Agrobacterium-mediated transformation to obtain transgenic plants with enhanced cold resistance or sensitive phenotypes.

Benefits of technology

This study elucidated the function of the StGAD1 gene in the low-temperature stress response of potato at the molecular level, providing a molecular target for cold-resistant breeding and enhancing the resistance of potato to low temperatures.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120366375B_ABST
    Figure CN120366375B_ABST
Patent Text Reader

Abstract

This invention discloses a StGAD1 The application of genes in regulating low-temperature resistance in potatoes belongs to the field of biotechnology. This invention is the first to obtain potato glutamate decarboxylase in potatoes. StGAD1 Genes, and through the use of Agrobacterium-mediated methods StGAD1 Gene knockout in potatoes was used for functional verification, and the results were obtained. StGAD1 Gene deletion makes potato plants more sensitive to cold stress, reflecting StGAD1 Genes play an important role in responding to low temperature stress, opening up new avenues for crop stress resistance breeding.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically involving StGAD1 Application of genes in regulating low-temperature resistance in potatoes. Background Technology

[0002] Low-temperature stress, a key bottleneck restricting the development of greenhouse agriculture, seriously threatens the yield formation and quality maintenance of horticultural crops such as potatoes. Based on novel gene-editing technologies such as CRISPR / Cas9, this study focuses on the precise editing of key genes in potato's low-temperature response. Through systematic analysis of the physiological and biochemical response patterns of gene-edited lines under low-temperature treatment, a differentiated strategy for cold-resistant germplasm innovation was established: overexpression technology was used to compensate for the functional deficiencies of low-temperature-sensitive gene-edited lines, while superior lines with significantly enhanced low-temperature tolerance were directly applied to molecular breeding practices. This innovative technology system combines reverse genetics and forward genetics, providing a theoretical basis and technical support for creating widely adaptable greenhouse-specific vegetable varieties. It is of great significance for overcoming environmental limiting factors in greenhouse vegetable production, ensuring a balanced year-round supply of vegetables, and improving the economic benefits of the industry, meeting the major needs of high-quality development in modern agriculture in my country.

[0003] potato( Solanum tuberosum As the world's fourth largest food crop, potato growth and development are susceptible to environmental stresses, with low-temperature stress being one of the main factors leading to yield loss. In recent years, breakthroughs in gene editing technology have accelerated the identification and functional analysis of key genes involved in potato responses to stresses (such as low temperature, drought, and disease). Glutamate decarboxylase 1 (GAD1) ​​is a key rate-limiting enzyme catalyzing the decarboxylation of glutamate to γ-aminobutyric acid (GABA). This enzyme relies on pyridoxal phosphate (PLP, the active form of vitamin B6) as a coenzyme and plays a central role in plant stress responses, nitrogen metabolism, and signal transduction by regulating GABA biosynthesis. Studies have shown that when plants encounter drought, low temperature, or salt stress, increased cytoplasmic calcium ion (Ca²⁺) concentration can activate GAD1, thereby promoting GABA accumulation. This Ca²⁺-GAD1-GABA signaling pathway is widely recognized as an important mechanism for enhancing plant environmental adaptability. Although the function of GAD1 in model plants has been preliminarily elucidated, its specific regulatory network in potato low-temperature stress response and its breeding application value have not yet been systematically revealed. Summary of the Invention

[0004] The purpose of this invention is to provide a StGAD1 Application of genes in regulating low-temperature resistance in potatoes.

[0005] To achieve the above objectives, the technical solution of the present invention is as follows:

[0006] This invention has found a potato glutamate decarboxylase. StGAD1 The gene (LOC102578660), with the NCBI reference sequence XM_006352326.2, has a CDS sequence as shown in SEQ ID NO.1, containing 1509 bases and encoding 502 amino acids, the amino acid sequence of which is shown in SEQ ID NO.2.

[0007] This invention also includes the following proteins:

[0008] (1) A protein having the amino acid sequence shown in SEQ ID NO.2;

[0009] (2) A derivative protein formed by substituting, deleting or adding 1 to 30 (preferably 1 to 20, more preferably 1 to 10, for example 5 or 3) amino acid residues based on the amino acid sequence shown in SEQ ID NO.2, and retaining the function of the protein in SEQ ID NO.2;

[0010] (3) A derivative protein that has at least 80% (preferably more than 90%, such as 95%, 98%, 99% or higher) homology with the amino acid sequence shown in SEQ ID NO.2 and retains the function of the protein in SEQ ID NO.2.

[0011] Accordingly, the gene function protected by this invention not only covers the potato glutamate decarboxylase. StGAD1 The gene (SEQ ID NO.1) also includes homologous genes that have a high degree of homology with SEQ ID NO.1 (e.g., higher than 80%; particularly preferred higher than 90%; most preferred higher than 95% or 98%) and encode proteins with the same function.

[0012] The main objective of this invention is to clone and identify potato glutamate decarboxylase at the molecular level. StGAD1 The function of the gene in regulating potato low-temperature resistance provides a theoretical basis for elucidating the molecular mechanism of potato response to cold stress and growth and development regulation.

[0013] Specifically, the regulation of low-temperature resistance in potatoes is manifested in the following ways: compared with the wild-type control... StGAD1 Gene knockout lines are more sensitive to low-temperature treatment. Furthermore... StGAD1 The gene knockout lines have higher ion permeability values.

[0014] Therefore, it is possible to knock out the aforementioned StGAD1Genes were used to identify plants that acquired a cold stress-sensitive phenotype. The identification of this cold stress phenotype included:

[0015] * Sensitivity observation of plants subjected to -4°C treatment;

[0016] * Determine the ion leakage rate of plants after low-temperature treatment.

[0017] As one embodiment of the present invention, the target is said to StGAD1 The multinucleotide sequence of the gene is constructed into a CRISPR vector to form a recombinant vector. This recombinant vector is then introduced into target plant cells using conventional transformation methods (e.g., Agrobacterium-mediated transformation), causing the StGAD1 protein in the plant cells to be absent or lose its function. By regenerating the transformed plant cells into complete plants, a complete plant can be obtained. StGAD1 Mutant plants with gene deletion. Because experiments have shown that inhibiting the aforementioned gene through gene editing technology... StGAD1 After the gene is expressed, the plant becomes more sensitive to low-temperature treatment, meaning its cold tolerance is reduced. This indicates that... StGAD1 The genes themselves have the function of enhancing the plant's cold resistance.

[0018] Therefore, in practical applications, based on this characteristic, cold-resistant plants can be obtained through genetic modification. Specifically, this can be achieved by... StGAD1 Genes are introduced into a target plant to obtain a transgenic plant, which is more cold-resistant than the target plant.

[0019] More specifically, the StGAD1 Genes can be introduced into target plants via recombinant expression vectors. These recombinant expression vectors can be used to transform plant cells or tissues using conventional biological methods, including but not limited to: Ti plasmids; plant virus vectors; direct DNA transformation; microinjection; electroporation; and Agrobacterium-mediated transformation (preferred). The transformed plant tissues are then regenerated into complete plants to obtain genetically modified plants.

[0020] To improve plant traits, this invention protects a breeding method comprising any of the following technical paths:

[0021] (1) Enhance the activity of StGAD1 protein in the target plant to obtain plants with improved low temperature resistance;

[0022] (2) Promote the growth of target plants Gene expression was used to obtain plants with enhanced low-temperature resistance;

[0023] (3) Inhibit the target plant StGAD1 Gene expression was used to obtain plants with a low-temperature sensitive phenotype.

[0024] The ways to "promote gene expression" can be:

[0025] (i) Introducing into target plants StGAD1 Genes (e.g., constructing overexpression vectors);

[0026] (ii) Introduce a strong promoter or enhancer to regulate the gene;

[0027] (iii) Other conventional expression enhancement techniques in this field.

[0028] How "suppressing gene expression" is achieved:

[0029] Knockout via gene editing technology (such as CRISPR / Cas9) is preferred. StGAD1 Gene.

[0030] The scope of this invention includes, but is not limited to, the following:

[0031] Core species: Potato ( StGAD1 Solanaceae family);

[0032] Extended Scope: Applicable to any [contains / areas] Solanum tuberosum Plants with their functional homologous genes (e.g., tomato (Solanaceae), apple (Rosaceae), cherry (Rosaceae) etc.).

[0033] Plant type: encompasses the whole plant, its parents and offspring, and all parts of the plant, including:

[0034] (1) Organs: roots (including tubers), stems, leaves, flowers, fruits, seeds, buds;

[0035] (2) Tissues and cells: callus, meristem, embryo, gametophyte, sporophyte;

[0036] (3) Reproductive units: pollen, microspores.

[0037] In addition, the following extensions are also protected:

[0038] (1) Transgenic cells, tissues, organs and plants obtained by the method described above;

[0039] (2) Offspring plants with the same genotype / phenotype;

[0040] (3) Harvestable parts of plants (such as seeds, fruits, leaves, tubers) and their processed products (such as oils, starches, protein powders, food additives).

[0041] Advantages of this invention:

[0042] This invention utilizes Agrobacterium-mediated... StGAD1 The gene knockout experiment elucidated for the first time the important function of this gene in the cold stress response of potatoes, providing a molecular target for cold-resistant potato breeding.

[0043] Experiments have confirmed that, StGAD1 Gene deletion leads to increased sensitivity to low temperatures, indicating its crucial role in plant development. Therefore, in practical applications, transgenic overexpression is used. StGAD1 Genes can be used to directly obtain plants with enhanced cold resistance, opening up new avenues for crop stress-resistant breeding. Attached Figure Description

[0044] StGAD1 for Figure 1 A schematic diagram of gene knockout sites and information on mutant editing.

[0045] StGAD1 For WT, Figure 2 - 3 and stgad1 - 4 The cold stress phenotype; in the figure, WT represents wild-type potatoes. stgad1 - 3 and stgad1 - 4 These are mutant plants; the left side, before low-temperature treatment, represents WT under normal conditions. stgad1 - 3 and stgad1 - 4 Plant phenotype; the right side shows the WT after treatment at -4°C for 2 h followed by recovery for 2 days. stgad1 - 3 and stgad1 - 4 Plant phenotype.

[0046] stgad1 To compare the ion leakage rate of potato seedlings after low-temperature treatment (-4°C treatment for 2 h followed by recovery for 2 d). Detailed Implementation

[0047] The present invention will be further described below with reference to specific embodiments, and the advantages and features of the present invention will become clearer with the description. However, unless otherwise specified, the specific experimental methods involved in the following embodiments are conventional methods or implemented according to the conditions recommended in the manufacturer's instructions.

[0048] Unless otherwise specified, the technical means used in the embodiments are conventional means well known to those skilled in the art. Unless otherwise specified, the experimental methods in the following embodiments are all conventional methods. Unless otherwise specified, the reagents and materials used can be purchased commercially.

[0049] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as are familiar to those skilled in the art. Furthermore, any methods and materials similar to or equivalent to those described herein may be used in this invention. The preferred embodiments and materials described herein are for illustrative purposes only.

[0050] Unless otherwise stated, the implementation of this invention will utilize conventional botanical techniques, microbiological techniques, tissue culture techniques, molecular biology techniques, chemical techniques, biochemical techniques, DNA recombination techniques, and bioinformatics techniques that are readily apparent to those skilled in the art. These techniques have been fully explained in published literature. Furthermore, the methods employed in this invention, including DNA extraction, phylogenetic tree construction, gene editing methods, gene editing vector construction, and the acquisition of gene-edited plants, except for those used in the examples below, can all be implemented using methods already disclosed in existing literature.

[0051] As used herein, the terms “nucleic acid,” “nucleic acid sequence,” “nucleotide,” “nucleic acid molecule,” or “polynucleotide” mean, but are not limited to, isolated DNA molecules (e.g., cDNA or genomic DNA), RNA molecules (e.g., messenger RNA), naturally occurring, mutant, synthetic DNA or RNA molecules, DNA or RNA molecules composed of nucleotide analogs, and single-stranded or double-stranded structures. These nucleic acids or polynucleotides include, but are not limited to, gene coding sequences, antisense sequences, and regulatory sequences of non-coding regions. These terms include a gene. “Gene” or “gene sequence” is broadly used to refer to a functional DNA nucleic acid sequence. Therefore, a gene may include introns and exons in a genomic sequence, and / or include coding sequences in cDNA, and / or include cDNA and its regulatory sequences. In particular embodiments, such as concerning isolated nucleic acid sequences, cDNA is preferred by default.

[0052] In addition, to provide a more intuitive understanding of the technical solution of this invention, some technical terms involved in this invention are explained as follows:

[0053] "Gene editing" is an emerging gene function technology that precisely modifies specific target sequences in an organism's genome.

[0054] "Gene knockout" is a technique that uses homologous recombination to integrate a foreign gene into a specific site on the genome of a target cell, thereby modifying a gene on a chromosome at a specific location.

[0055] A "mutant" is an individual that has undergone a mutation and has phenotypic characteristics that differ from the wild type.

[0056] "Expression vector" refers to a vector that adds expression elements (such as promoters, RBS, terminators, etc.) to the basic skeleton of a cloning vector, enabling the target gene to be expressed.

[0057] The inventors obtained potato glutamate decarboxylase based on the potato genome using bioinformatics technology. Figure 3 Gene sequence. This invention involves ligating the gene sequence with a plant editing vector and then introducing it into wild-type potatoes for phenotypic identification.

[0058] Compared to traditional transgenic technology, CRISPR / Cas9 gene editing technology has many advantages. Traditional transgenic technology involves introducing a foreign target gene into the target organism to alter plant traits; the insertion site of the target gene in the recipient genome is random. In contrast, CRISPR / Cas9 gene editing technology does not introduce a foreign gene, but only modifies endogenous genes, making it safer and more efficient. Secondly, CRISPR / Cas9 gene editing technology can simultaneously edit multiple sites and precisely regulate mutations or insertion sites, which is impossible with traditional transgenic technology. Furthermore, traditional transgenic technology can only up- and down-regulate the expression of the target gene at the RNA level, and cannot completely inhibit its transcription, and is genetically unstable. CRISPR / Cas9 gene editing technology, on the other hand, can achieve mutations in the target gene, making it more stable and reliable.

[0059] Example 1 StGAD1 gene segregation

[0060] Total RNA extraction from Bloody Banana potato seedlings: The extraction was performed according to the Trizol extraction reagent (Takara) instructions. First-strand cDNA synthesis was performed according to the PrimerScript™ II 1st Strand cDNA Synthesis Kit (Takara) instructions. Using potato cDNA as a template, amplification was performed using the TOYOBO high-fidelity enzyme KOD-plus-neo, with annealing at 56°C.

[0061] Using the following sequences as primers (StGAD1-F, StGAD1-R), PCR amplification was performed to obtain... StGAD1 The full-length sequence of the gene. StGAD1 The full-length sequence of the gene is shown in SEQ ID NO.1 in the sequence listing, totaling 1509 bp. The amino acid sequence of the protein encoded is shown in SEQ ID NO.2 in the sequence listing, totaling 502 amino acids.

[0062] StGAD1-F: ATGGTTCTGTCCAAGATAGCGTCG;

[0063] StGAD1-R:TTAACAAACTCCCTTAGTCTTTTTC.

[0064] Example 2: Construction of Recombinant Vector

[0065] exist StGAD1 Two knockout target sites were selected in the gene's CDS region: sgRNA1: CCTGAAGCTCAGTGGTGACAGG and sgRNA2: GGCCAATCCAGCAAGCATAATGG. The sgRNA-StGAD1 fragment was amplified and purified by PCR, and the StGAD1-CRISPR recombinant plasmid was obtained through restriction enzyme digestion and ligation. Finally, Agrobacterium-mediated transformation of potatoes was used to obtain the knockout gene. StGAD1 Gene-transformed seedlings.

[0066] Example 3: Screening and Phenotypic Analysis of Transgenic Positive Strains

[0067] 100 mg of leaves from resistant plants were collected, and total genomic DNA was extracted using the CTAB method. Specific primers were designed based on the target gene sequence, and PCR amplification was performed, followed by sequencing.

[0068] The primer sequences for identification are:

[0069] F: GTGACAACATGGATGGAACC;

[0070] R: GGACATTGGCACCAGTAAC.

[0071] Sequencing identified two different types of editing. StGAD1 Knockout systems, such as StGAD1 - 3 (-4 bp) and -4 (-5 bp) ( stgad1 ).

[0072] For WT (wild type), stgad1 - 3 (-4 bp) and Figure 1 -4 (-5 bp) gene knockout strains were cryogenically treated at -4°C for 2 h, from stgad1 The phenotypic observation diagrams show that, under normal conditions (control), WT (wild-type) plants and stgad1 There was no significant difference in growth between the knockout lines and the wild-type lines. However, after treatment at -4°C for 2 hours followed by a 2-day recovery period, the WT (wild-type) showed better growth compared to the wild-type. Figure 2 The leaves of the knocked-out strain showed severe water loss and obvious wilting, with both the leaves and stems exhibiting significant softening and waterlogging. This indicates that... StGAD1 Knockout lines are more sensitive to low-temperature treatment. Additionally, WT (wild type), StGAD1 - 3 (-4bp) and StGAD1Ion permeability of potato seedlings treated with -4°C (-5 bp) for 2 hours and then recovered for 2 days was measured and compared with WT (wild type). stgad1 - 3 (-4 bp) and stgad1 The ion permeability value of -4 (-5 bp) is larger ( stgad1 Similarly, this can also illustrate that stgad1 The knockout line is more sensitive to low-temperature treatment.

[0073] Overall, compared to WT (wild-type) plants, Figure 3 StGAD1 StGAD1 Gene knockout line plants exhibited significant low-temperature sensitivity.

[0074] The embodiments described above are merely preferred embodiments of the present invention and are only used to explain the present invention. They are not intended to limit the scope of the present invention. For those skilled in the art, other implementation methods can be easily made by substitution or modification based on the technical content disclosed in this specification. Therefore, all changes and improvements made on the principle of the present invention should be included within the scope of the patent application of the present invention.

Claims

1. StGAD1 The application of genes in regulating low-temperature resistance in potatoes is characterized by, The StGAD1 The CDS sequence of the gene is shown in SEQ ID NO.1, and its specific regulation of potato low-temperature resistance is as follows: compared with the wild type, StGAD1 Gene knockout lines are more sensitive to low-temperature treatment.

2. The application according to claim 1, characterized in that, Compared with the wild-type control, StGAD1 The gene knockout lines have higher ion permeability values.

3. The application according to claim 1, characterized in that, Gene knockout was performed using CRISPR / Cas9 technology.

4. A plant breeding method, characterized in that, The method involves: knocking out [the plant's] [elements]. StGAD1 Genes were used to obtain plants that exhibited sensitivity to low-temperature treatment symptoms; The StGAD1 The CDS sequence of the gene is shown in SEQ ID NO.1, and the target plant is potato.

5. The breeding method according to claim 4, characterized in that, The specific method for obtaining plants exhibiting symptoms of sensitivity to low-temperature treatment is as follows: (1) Constructing a recombinant carrier: In StGAD1 Two knockout target sites were selected in the gene CDS region: sgRNA1: CCTGAAGCTCAGTGGTGACAGG and sgRNA2: GGCCAATCCAGCAAGCATAATGG. The sgRNA-StGAD1 fragment was amplified by PCR and purified and recovered. The StGAD1-CRISPR recombinant plasmid was obtained by enzyme digestion and ligation. (2) Agrobacterium-mediated transformation: Genetic transformation of potatoes was mediated by Agrobacterium-mediated transformation to obtain knockouts. StGAD1 Gene-transformed seedlings; (3) Screening of positive plants: Design specific primers based on the target gene sequence, and screen positive plants by PCR amplification or quantitative detection.

Citation Information

Patent Citations

  • Application of StMybHv1-like gene in improving cold resistance of potatoes

    CN118910096A