Co-activator optimization transcription activation tool in eukaryotic cell and application of co-activator optimization transcription activation tool

Abstract

The invention discloses a CRISPRa tool for activating a target gene and application of the CRISPRa tool. The invention provides a protein. The protein sequentially comprises the following elements from an N terminal to a C terminal: a dCas9 segment and an activation domain segment, n NHRs are arranged in the active domain section; n is a natural number; the NHR is an NHR activating element from a nematode. The NHR has a nonaamino acid trans-activation domain (9aa TAD), consists of only 16 amino acid residues, and shows high transcriptional activity. The invention provides a CRISPRa tool with stronger action effect and more concise action element, can be used for gene transcription regulation (particularly gene transcription activation), can be used in the scientific research field and the clinical medicine field, and has great value.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology and relates to optimizing transcriptional activation tools with coactivators in eukaryotic cells and their applications. Background Art

[0002] The discovery of the CRISPR system has promoted the development of new methods for DNA targeting. The CRISPR / Cas9 system established by its modification consists of the Cas9 protein that cleaves DNA and the sgRNA that guides the Cas9 protein to the target sequence. The Cas9 protein contains HNH and RuvC nuclease domains that cleave one DNA strand respectively. When the Cas9 protein binds to different deaminases, site-specific base editing can be achieved. However, the application of the CRISPR system is not limited to gene editing. Researchers mutated the two nuclease domains to render the Cas9 protein nuclease-inactive but still retain the ability to bind DNA, providing powerful tools for genetic regulatory systems, CRISPRi and CRISPRa. Among them, the CRISPRa technology uses dCas9 to recruit transcriptional activators near the transcription start site of target genes to achieve efficient activation of exogenous and endogenous gene promoters.

[0003] In dCas9-mediated transcriptional activation regulation, transcriptional activation effectors play an indispensable role. The activation regulation of target genes can be achieved by fusing transcriptional activation effectors with dCas9 or modifying the gRNA into a scaffold and using it to recruit transcriptional activation effectors. It is of great significance for gene function research, disease treatment, and biotechnological applications. CRISPR-specific transcriptional regulatory tools can regulate gene expression without causing permanent DNA damage, nor generating harmful mutations and off-target effects. Clinically, it can provide better therapeutic effects by simultaneously regulating the activities of multiple genes, making up for the deficiencies in gene therapy. Currently, the existing CRISPRa tools are limited by their large size and limited activation in AAV-mediated gene therapy. Therefore, there is an urgent need to develop gene transcriptional regulatory tools with stronger effects and more concise functional elements. Summary of the Invention

[0004] The object of the present invention is to provide a CRISPRa tool for activating target genes and its applications.

[0005] The present invention provides a protein that sequentially includes the following elements from the N-terminus to the C-terminus: a dCas9 segment and an activation domain segment;

[0006] There are n NHRs in the activation domain segment; n is a natural number;

[0007] The NHR is an NHR activation element from nematodes.

[0008] When n is a natural number greater than or equal to 2, every two NHRs are connected by GS.

[0009] The NHR has a nine-amino acid transactivation domain (9aa TAD), which consists of only 16 amino acid residues and exhibits high transcriptional activity.

[0010] The GS is the amino acid residue G and the amino acid residue S.

[0011] Specifically, n is 1 or 2 or 3 or 4.

[0012] Specifically, the NHR is as shown at positions 1410-1425 in SEQ ID NO: 10.

[0013] Specifically, the dCas9 segment is as shown at positions 1-1368 in SEQ ID NO: 10.

[0014] The activation domain segment in the protein further has a VP64 segment and / or a p65 segment and / or an Rta segment.

[0015] Specifically, the VP64 segment is as shown at positions 42-91 in SEQ ID NO: 11.

[0016] Specifically, the p65 segment is as shown at positions 109-368 in SEQ ID NO: 11.

[0017] Specifically, the Rta segment is as shown at positions 375-564 in SEQ ID NO: 11.

[0018] Specifically, the activation domain segment has the following elements in sequence from the N-terminus to the C-terminus: NHR, p65 segment, and Rta segment.

[0019] Specifically, the activation domain segment has the following elements in sequence from the N-terminus to the C-terminus: VP64 segment, NHR, and Rta segment.

[0020] Specifically, the activation domain segment has the following elements in sequence from the N-terminus to the C-terminus: VP64 segment, p65 segment, and NHR.

[0021] Specifically, the activation domain segment has the following elements in sequence from the N-terminus to the C-terminus: NHR, VP64 segment, p65 segment, and Rta segment.

[0022] Specifically, the activation domain segment has the following elements in sequence from the N-terminus to the C-terminus: VP64 segment, NHR, p65 segment, and Rta segment.

[0023] Specifically, the activation domain segment sequentially has the following elements from the N-terminus to the C-terminus: VP64 segment, p65 segment, NHR, and Rta segment.

[0024] Specifically, the activation domain segment sequentially has the following elements from the N-terminus to the C-terminus: VP64 segment, p65 segment, Rta segment, and NHR.

[0025] Specifically, the activation domain segment is one of the following (a1), (a2), or (a3):

[0026] (a1) NHR;

[0027] (a2) Composed of the following segments in sequence from the N-terminus to the C-terminus: NHR, GS, and NHR;

[0028] (a3) Composed of the following segments in sequence from the N-terminus to the C-terminus: NHR, GS, NHR, GS, NHR, GS, and NHR.

[0029] Specifically, the activation domain segment is one of the following (b1), (b2), (b3), (b4), (b5), (b6), or (b7):

[0030] (b1) Composed of the following segments in sequence from the N-terminus to the C-terminus: NHR, the linker peptide shown at positions 92 - 108 of SEQ ID NO: 11 (INSRSSGSPKKKRKVGS), p65 segment, the linker peptide shown at positions 369 - 374 of SEQ ID NO: 11 (GSGSGS), Rta segment;

[0031] (b2) Composed of the following segments in sequence from the N-terminus to the C-terminus: VP64 segment, the linker peptide shown at positions 92 - 108 of SEQ ID NO: 11 (INSRSSGSPKKKRKVGS), NHR, the linker peptide shown at positions 369 - 374 of SEQ ID NO: 11 (GSGSGS), Rta segment;

[0032] (b3) Composed of the following segments in sequence from the N-terminus to the C-terminus: VP64 segment, the linker peptide shown at positions 92 - 108 of SEQ ID NO: 11 (INSRSSGSPKKKRKVGS), p65 segment, the linker peptide shown at positions 369 - 374 of SEQ ID NO: 11 (GSGSGS), NHR;

[0033] (b4) From the N-terminus to the C-terminus, it is successively composed of the following segments: NHR, VP64 segment, the linker peptide shown at positions 92 - 108 in SEQ ID NO: 11 (INSRSSGSPKKKRKVGS), p65 segment, the linker peptide shown at positions 369 - 374 in SEQ ID NO: 11 (GSGSGS), Rta segment;

[0034] (b5) From the N-terminus to the C-terminus, it is successively composed of the following segments: VP64 segment, the linker peptide shown at positions 92 - 108 in SEQ ID NO: 11 (INSRSSGSPKKKRKVGS), NHR, p65 segment, the linker peptide shown at positions 369 - 374 in SEQ ID NO: 11 (GSGSGS), Rta segment;

[0035] (b6) From the N-terminus to the C-terminus, it is successively composed of the following segments: VP64 segment, the linker peptide shown at positions 92 - 108 in SEQ ID NO: 11 (INSRSSGSPKKKRKVGS), p65 segment, the linker peptide shown at positions 369 - 374 in SEQ ID NO: 11 (GSGSGS), NHR, Rta segment;

[0036] (b7) From the N-terminus to the C-terminus, it is successively composed of the following segments: VP64 segment, the linker peptide shown at positions 92 - 108 in SEQ ID NO: 11 (INSRSSGSPKKKRKVGS), p65 segment, the linker peptide shown at positions 369 - 374 in SEQ ID NO: 11 (GSGSGS), Rta segment and NHR.

[0037] Specifically, the protein is successively composed of the following elements from the N-terminus to the C-terminus: dCas9 segment, the linker peptide shown at positions 1 - 41 in SEQ ID NO: 11, activation domain segment.

[0038] Specifically, the protein is successively composed of the following elements from the N-terminus to the C-terminus: dCas9 segment, the linker peptide shown at positions 1 - 41 in SEQ ID NO: 11, activation domain segment, the segment shown at positions 1426 - 1440 in SEQ ID NO: 10.

[0039] The DNA molecule encoding the protein also belongs to the protection scope of the present invention.

[0040] Specifically, the DNA molecule encoding the dCas9 segment is as shown at positions 699 - 48;

[0041] Specifically, the DNA molecule encoding the NHR segment is as shown in SEQ ID NO: 9.

[0042] Specifically, the DNA molecule encoding the activation domain segment is as shown in SEQ ID NO: 9 or SEQ ID NO: 6 or SEQ ID NO: 7.

[0043] Specifically, the DNA molecule encoding the protein is as shown at positions 699 - 5021 of SEQ ID NO: 3.

[0044] Specifically, the DNA molecule encoding the protein is a DNA molecule obtained by making the following substitution to the DNA molecule shown at positions 699 - 5021 of SEQ ID NO: 3: substituting the DNA segment shown in SEQ ID NO: 6 for the DNA segment shown at positions 4926 - 4973 of SEQ ID NO: 3.

[0045] Specifically, the DNA molecule encoding the protein is a DNA molecule obtained by making the following substitution to the DNA molecule shown at positions 699 - 5021 of SEQ ID NO: 3: substituting the DNA segment shown in SEQ ID NO: 7 for the DNA segment shown at positions 4926 - 4973 of SEQ ID NO: 3.

[0046] Specifically, the DNA molecule encoding the dCas9 segment is as shown at positions 1 - 4104 of SEQ ID NO: 4.

[0047] Specifically, the DNA molecule encoding the VP64 segment is as shown at positions 4228 - 4377 of SEQ ID NO: 4.

[0048] Specifically, the DNA molecule encoding the p65 segment is as shown at positions 4429 - 5208 of SEQ ID NO: 4.

[0049] Specifically, the DNA molecule encoding the Rta segment is as shown at positions 5227 - 5796 of SEQ ID NO: 4.

[0050] Specifically, the DNA molecule encoding the protein is a DNA molecule obtained by making the following substitution to the DNA molecule shown in SEQ ID NO: 4: substituting the DNA segment shown in SEQ ID NO: 9 for the DNA segment shown at positions 4228 - 4377 of SEQ ID NO: 4.

[0051] Specifically, the DNA molecule encoding the protein is a DNA molecule obtained by making the following substitution to the DNA molecule shown in SEQ ID NO: 4: substituting the DNA segment shown in SEQ ID NO: 9 for the DNA segment shown at positions 4429 - 5208 of SEQ ID NO: 4.

[0052] Specifically, the DNA molecule encoding the protein is a DNA molecule obtained by substituting the DNA molecule shown in SEQ ID NO: 4 as follows: substituting the DNA segment shown in SEQ ID NO: 9 for the DNA segment shown at positions 5227-5796 in SEQ ID NO: 4.

[0053] Specifically, the DNA molecule encoding the protein is a DNA molecule obtained by inserting the DNA molecule shown in SEQ ID NO: 4 as follows: inserting the DNA segment shown in SEQ ID NO: 9 between nucleotides 4227 and 4228 in SEQ ID NO: 4.

[0054] Specifically, the DNA molecule encoding the protein is a DNA molecule obtained by inserting the DNA molecule shown in SEQ ID NO: 4 as follows: inserting the DNA segment shown in SEQ ID NO: 9 between nucleotides 4428 and 4429 in SEQ ID NO: 4.

[0055] Specifically, the DNA molecule encoding the protein is a DNA molecule obtained by inserting the DNA molecule shown in SEQ ID NO: 4 as follows: inserting the DNA segment shown in SEQ ID NO: 9 between nucleotides 5226 and 5227 in SEQ ID NO: 4.

[0056] Specifically, the DNA molecule encoding the protein is a DNA molecule obtained by inserting the DNA molecule shown in SEQ ID NO: 4 as follows: inserting the DNA segment shown in SEQ ID NO: 9 between nucleotides 5796 and 5797 in SEQ ID NO: 4.

[0057] The recombinant plasmid having the DNA molecule (named dCas9 tool plasmid) also belongs to the protection scope of the present invention.

[0058] The recombinant plasmid may specifically be the dCas9-NHR plasmid: a circular plasmid as shown in SEQ ID NO: 3.

[0059] The recombinant plasmid may specifically be the dCas9-2NHR plasmid. Compared with the dCas9-NHR plasmid, the dCas9-2NHR plasmid is only different in that the DNA segment shown in SEQ ID NO: 6 is substituted for the DNA segment shown at positions 4926-4973 in SEQ ID NO: 3.

[0060] The recombinant plasmid may specifically be the dCas9-4NHR plasmid. Compared with the dCas9-NHR plasmid, the difference of the dCas9-4NHR plasmid lies only in that the DNA segment shown in SEQ ID NO: 7 is used to replace the DNA segment shown at positions 4926-4973 in SEQ ID NO: 3.

[0061] The recombinant plasmid may specifically be the dCas9-NPR plasmid. Compared with the dCas9-VPR plasmid, the difference of the dCas9-NPR plasmid lies only in that the DNA segment shown in SEQ ID NO: 9 is used to replace the DNA segment shown at positions 4228-4377 in SEQ ID NO: 4.

[0062] The recombinant plasmid may specifically be the dCas9-VNR plasmid. Compared with the dCas9-VPR plasmid, the difference of the dCas9-VNR plasmid lies only in that the DNA segment shown in SEQ ID NO: 9 is used to replace the DNA segment shown at positions 4429-5208 in SEQ ID NO: 4.

[0063] The recombinant plasmid may specifically be the dCas9-VPN plasmid. Compared with the dCas9-VPR plasmid, the difference of the dCas9-VPN plasmid lies only in that the DNA segment shown in SEQ ID NO: 9 is used to replace the DNA segment shown at positions 5227-5796 in SEQ ID NO: 4.

[0064] The recombinant plasmid may specifically be the dCas9-NVPR plasmid. Compared with the dCas9-VPR plasmid, the difference lies only in that the DNA segment shown in SEQ ID NO: 9 is inserted between nucleotides at positions 4227-4228 in SEQ ID NO: 4.

[0065] The recombinant plasmid may specifically be the dCas9-VNPR plasmid. Compared with the dCas9-VPR plasmid, the difference lies only in that the DNA segment shown in SEQ ID NO: 9 is inserted between nucleotides at positions 4428-4429 in SEQ ID NO: 4.

[0066] The recombinant plasmid may specifically be the dCas9-VPNR plasmid. Compared with the dCas9-VPR plasmid, the difference lies only in that the DNA segment shown in SEQ ID NO: 9 is inserted between nucleotides at positions 5226-5227 in SEQ ID NO: 4.

[0067] The recombinant plasmid may specifically be the dCas9-VPRN plasmid. Compared with the dCas9-VPR plasmid, the difference lies only in that the DNA segment shown in SEQ ID NO: 9 is inserted between nucleotides at positions 5796-5797 in SEQ ID NO: 4.

[0068] dCas9-VPR plasmid: a circular plasmid, sequentially composed of a backbone segment 1 (shown as nucleotides 1-698 in SEQ ID NO: 3), a fusion gene segment (shown as SEQ ID NO: 4), and a backbone segment 2 (shown as nucleotides 5022-9843 in SEQ ID NO: 3).

[0069] The present invention also protects a kit, including any one of the above-mentioned dCas9 tool plasmids.

[0070] The kit also includes a gRNA tool plasmid.

[0071] The gRNA tool plasmid is a plasmid for expressing gRNA.

[0072] The gRNA tool plasmid has a DNA molecule for encoding the gRNA backbone region.

[0073] Specifically, the DNA molecule for encoding the gRNA backbone region is shown as nucleotides 341-416 in SEQ ID NO: 2.

[0074] Specifically, the gRNA tool plasmid has a DNA molecule for encoding gRNA.

[0075] The DNA molecule for encoding gRNA is sequentially composed of a DNA molecule for encoding the gRNA targeting region and a DNA molecule for encoding the gRNA backbone region from upstream to downstream.

[0076] Specifically, the gRNA tool plasmid is shown as SEQ ID NO: 2.

[0077] Specifically, the gRNA tool plasmid is a plasmid obtained by modifying the plasmid shown as SEQ ID NO: 2 as follows: replacing ttgcgctgcttcgcgatgta with a DNA molecule for encoding the gRNA targeting region.

[0078] The present invention also protects the application of any one of the above-mentioned dCas9 tool plasmids in the preparation of a kit for activating the transcription of a target gene. The activation of the transcription of the target gene is achieved by activating the transcription of the target gene through CRISPRa.

[0079] The present invention also protects the application of any one of the above-mentioned dCas9 tool plasmids and any one of the above-mentioned gRNA tool plasmids in the preparation of a kit for activating the transcription of a target gene. The activation of the transcription of the target gene is achieved by activating the transcription of the target gene through CRISPRa.

[0080] The present invention also provides a kit, comprising any one of the above-mentioned dCas9 tool plasmids and gRNA tool plasmids; the gRNA tool plasmid is a plasmid expressing sgRNA targeting the PER2 gene.

[0081] The present invention also provides the use of any one of the above-mentioned dCas9 tool plasmids and gRNA tool plasmids in the preparation of a kit; the gRNA tool plasmid is a plasmid expressing sgRNA targeting the PER2 gene.

[0082] The function of the kit is to treat cancer.

[0083] The cancer is cervical cancer.

[0084] The function of the kit is to inhibit cancer cells

[0085] The function of the kit is to inhibit epithelial-mesenchymal transition of cancer cells.

[0086] Specifically, the cancer cells are cervical cancer cells.

[0087] Specifically, the dCas9 tool plasmid is the dCas9-NVPR plasmid.

[0088] Specifically, the gRNA tool plasmid is the gRNA-PER2 plasmid.

[0089] Compared with the gRNA-1 plasmid, the gRNA-PER2-1 plasmid differs only in that "CGGACAGAGCCGCGAGTCGG" is replaced by "ttgcgctgcttcgcgatgta". Compared with the gRNA-1 plasmid, the gRNA-PER2-2 plasmid differs only in that "GGGATACGTGCAGCTGTGGG" is replaced by "ttgcgctgcttcgcgatgta". Compared with the gRNA-1 plasmid, the gRNA-PER2-3 plasmid differs only in that "TGACAGCGGCGACTCGGCCG" is replaced by "ttgcgctgcttcgcgatgta". The gRNA-PER2 plasmid is obtained by equimolar mixing of the gRNA-PER2-1 plasmid, the gRNA-PER2-2 plasmid and the gRNA-PER2-3 plasmid. The gRNA-PER2 plasmid targets the PER2 gene.

[0090] The gRNA-1 plasmid: a circular plasmid, as shown in SEQ ID NO: 2.

[0091] The protein provided by the present invention is a fusion protein, and has the following advantages as a CRISPRa tool: compact protein size and high transcriptional activity.

[0092] The present invention provides a CRISPRa tool with stronger effects and simpler action elements, which can be used for gene transcription regulation (specifically gene transcription activation), can be used in scientific research and clinical medicine, and has great value. BRIEF DESCRIPTION OF THE DRAWINGS

[0093] Figure 1 Schematic diagram of the activation principle of the fusion protein designed for the present invention.

[0094] Figure 2 Schematic diagram of the working principles of the three plasmids in Example 1.

[0095] Figure 3 This is a photo taken under a fluorescence microscope in Example 1.

[0096] Figure 4 This is the result of the average fluorescence intensity in Example 1.

[0097] Figure 5 This is the result of verifying the endogenous activation effect (HEK293T cells) in Example 2.

[0098] Figure 6 This is the result of verifying the endogenous activation effect (HeLa cells) in Example 2.

[0099] Figure 7 This is the result of verifying the endogenous activation effect (HEK293T cells) in Example 3.

[0100] Figure 8 This is the result of verifying the endogenous activation effect (HeLa cells) in Example 3.

[0101] Figure 9 This is the result of verifying the endogenous activation effect (HEK293T cells) in Example 4.

[0102] Figure 10 This is the result of verifying the endogenous activation effect (HeLa cells) in Example 4.

[0103] Figure 11 This is the result of whole transcriptome RNA sequencing in Example 5.

[0104] Figure 12 This is the result of the relative expression of mRNA in Example 6.

[0105] Figure 13 These are the photographic results of the cloning experiment in Example 6. DETAILED DESCRIPTION

[0106] The present invention will be further described in detail below in conjunction with specific embodiments. The provided embodiments are only for clarifying the present invention, rather than limiting the scope of the present invention. The following embodiments can be used as a guide for those of ordinary skill in the art to make further improvements, and do not limit the present invention in any way.

[0107] The experimental methods in the following embodiments are all conventional methods unless otherwise specified, and are carried out according to the techniques or conditions described in the literature in this field or according to the product instructions. The materials, reagents, etc. used in the following embodiments can be obtained from commercial channels unless otherwise specified. Unless otherwise specified, the quantitative tests in the following embodiments are all set with three repeated experiments, and the results are averaged.

[0108] Example 1: Screening and verifying the activation effect of candidate transcription factors in HeLa cells

[0109] I. Construction of recombinant plasmids

[0110] miniCMV-GFP plasmid: a circular plasmid, as shown in SEQ ID NO: 1. In SEQ ID NO: 1, nucleotides 1363-1401 constitute the miniCMV promoter, and nucleotides 1508-2227 constitute the GFP gene.

[0111] gRNA-1 plasmid: a circular plasmid, as shown in SEQ ID NO: 2. In SEQ ID NO: 2, nucleotides 72-312 are the U6 promoter, nucleotides 321-340 (ttgcgctgcttcgcgatgta) encode the targeting region in the gRNA, nucleotides 341-416 encode the backbone region in the gRNA, and nucleotides 1166-1765 encode the puromycin resistance protein. Compared with the gRNA-1 plasmid, the difference in the gRNA-2 plasmid is only that "attgcatgaagaatctgctt" is replaced by "ttgcgctgcttcgcgatgta". Compared with the gRNA-1 plasmid, the difference in the gRNA-3 plasmid is only that "gtcgaggtaggcgtgtacgg" is replaced by "ttgcgctgcttcgcgatgta".

[0112] dCas9-NHR plasmid (dCas9 plasmid fused with one NHR): circular plasmid, as shown in SEQ ID NO: 3. In SEQ ID NO: 3, nucleotides 381 - 584 form the CMV promoter, and nucleotides 699 - 5021 form the fusion gene (encoding the fusion protein shown in SEQ ID NO: 10). In SEQ ID NO: 3, nucleotides 699 - 4802 encode the dCas9 protein segment, and nucleotides 4926 - 4973 encode the NHR segment. In SEQ ID NO: 10, amino acid residues 1 - 1368 form the dCas9 protein segment, and amino acid residues 1410 - 1425 form the NHR segment.

[0113] dCas9-vector plasmid: circular plasmid. Compared with the dCas9-NHR plasmid, the dCas9-vector plasmid only differs in that it lacks nucleotides 4926 - 4973 in SEQ ID NO: 3.

[0114] dCas9-p65 plasmid (dCas9 plasmid fused with p65): circular plasmid. Compared with the dCas9-NHR plasmid, the dCas9-p65 plasmid only differs in that it replaces the DNA segment shown at positions 4926 - 4973 in SEQ ID NO: 3 with the DNA segment shown at positions 4429 - 5208 in SEQ ID NO: 4 (encoding the p65 segment).

[0115] dCas9-SOX2-SAD plasmid (dCas9 plasmid fused with SOX2-SAD): circular plasmid. Compared with the dCas9-NHR plasmid, the dCas9-SOX2-SAD plasmid only differs in that it replaces the DNA segment shown at positions 4926 - 4973 in SEQ ID NO: 3 with the DNA segment shown in SEQ ID NO: 5 (encoding the SOX2-SAD segment).

[0116] dCas9-2NHR plasmid (dCas9 plasmid fused with two NHRs): circular plasmid. Compared with the dCas9-NHR plasmid, the dCas9-2NHR plasmid only differs in that it replaces the DNA segment shown at positions 4926 - 4973 in SEQ ID NO: 3 with the DNA segment shown in SEQ ID NO: 6 (encoding the 2×NHR segment).

[0117] dCas9-4NHR plasmid (dCas9 plasmid fused with 4 NHRs): circular plasmid. Compared with the dCas9-NHR plasmid, the dCas9-4NHR plasmid differs only in that the DNA segment shown in SEQ ID NO: 7 (encoding the 4×NHR segment) replaces the DNA segment shown at positions 4926-4973 in SEQ ID NO: 3.

[0118] dCas9-PC4 plasmid (dCas9 plasmid fused with PC4): circular plasmid. Compared with the dCas9-NHR plasmid, the dCas9-PC4 plasmid differs only in that the DNA segment shown in SEQ ID NO: 8 (encoding the PC4 segment) replaces the DNA segment shown at positions 4926-4973 in SEQ ID NO: 3.

[0119] II. Verification of exogenous activation effect

[0120] The dCas9 plasmids are respectively: dCas9-vector plasmid, dCas9-NHR plasmid, dCas9-p65 plasmid, dCas9-SOX2-SAD plasmid, dCas9-2NHR plasmid, dCas9-4NHR plasmid or dCas9-PC4 plasmid. The gRNA plasmid: obtained by equimolar mixing of gRNA-1 plasmid, gRNA-2 plasmid and gRNA-3 plasmid.

[0121] 1. Culture HeLa cells until the confluence reaches 90%.

[0122] 2. Take a 96-well plate, inoculate the HeLa cells obtained in step 1, and culture them in Opti-MEM medium containing 10% FBS for 12-16 hours.

[0123] 3. Take 150 ng of dCas9 plasmid, 50 ng of gRNA plasmid and 33.3 ng of miniCMV-GFP plasmid, add transfection reagent PEI (3 μl of transfection reagent PEI is formulated per 1 μg of DNA) and Opti-MEM medium (100 μl of Opti-MEM medium is formulated per 1 μg of DNA) to obtain a single-well dose transfection mixture.

[0124] 4. After the transfection mixture obtained in step 3 is fully mixed and allowed to stand for 15 min, add it to the 96-well plate that has completed step 2. After culturing for 4-6 hours, discard the supernatant, and add Opti-MEM medium containing 10% FBS and culture for 24 hours.

[0125] 5. After completing step 4, aspirate and discard the supernatant, add Opti-MEM medium containing 3 μg / ml of puromycin and 10% FBS, and culture.

[0126] 6. After culturing for 3 days in Step 5, observe the expression of green fluorescence under a fluorescence microscope. If the transcription factor can activate the target promoter, the green fluorescent protein will be expressed, and the expression level of fluorescence is proportional to the action intensity of the transcription factor. See the photos under the fluorescence microscope in Figure 3 。

[0127] 7. After culturing for 5 days in Step 5, perform flow cytometry analysis. Using FlowJo software, calculate the mean fluorescence intensity to evaluate the activation ability of the exogenous gene. The results are shown in Figure 4 。

[0128] The results showed that compared with the control treatment (i.e., the treatment using the dCas9-vector plasmid as the dCas9 plasmid), the co-activator fused to dCas9 could enhance GFP expression, and the nematode NHR activation element fused to dCas9 showed high fluorescence intensity.

[0129] Example 2. Binding of NHR Activation Element to dCas9 to Activate Endogenous Gene Expression

[0130] I. Construction of Recombinant Plasmids

[0131] dCas9-vector plasmid: See the corresponding description in Step 1 of Example 1.

[0132] dCas9-NHR plasmid: See the corresponding description in Step 1 of Example 1.

[0133] dCas9-2NHR plasmid: See the corresponding description in Step 1 of Example 1.

[0134] dCas9-VP64 plasmid (dCas9 plasmid fused with VP64): Circular plasmid. Compared with the dCas9-NHR plasmid, the dCas9-VP64 plasmid differs only in that the DNA segment shown at positions 4228 - 4377 in SEQ ID NO: 4 (encoding the VP64 segment) replaces the DNA segment shown at positions 4926 - 4973 in SEQ ID NO: 3.

[0135] Compared with the gRNA-1 plasmid in Step 1 of Example 1, the gRNA-NEURO plasmid differs only in that "AGGTCCGCGGAGTCTCTAAC" is used to replace "ttgcgctgcttcgcgatgta". The gRNA-NEURO plasmid targets the NEURO gene.

[0136] Compared with the gRNA-1 plasmid in Step 1 of Example 1, the only difference in the gRNA-PER2-1 plasmid is that "CGGACAGAGCCGCGAGTCGG" is used to replace "ttgcgctgcttcgcgatgta". Compared with the gRNA-1 plasmid in Step 1 of Example 1, the only difference in the gRNA-PER2-2 plasmid is that "GGGATACGTGCAGCTGTGGG" is used to replace "ttgcgctgcttcgcgatgta". Compared with the gRNA-1 plasmid in Step 1 of Example 1, the only difference in the gRNA-PER2-3 plasmid is that "TGACAGCGGCGACTCGGCCG" is used to replace "ttgcgctgcttcgcgatgta". The gRNA-PER2 plasmid: It is obtained by mixing the gRNA-PER2-1 plasmid, the gRNA-PER2-2 plasmid and the gRNA-PER2-3 plasmid in equimolar amounts. The gRNA-PER2 plasmid targets the PER2 gene.

[0137] Compared with the gRNA-1 plasmid in Step 1 of Example 1, the only difference in the gRNA-OCT4-1 plasmid is that "AGTGATAAGACACCCGCTTT" is used to replace "ttgcgctgcttcgcgatgta". Compared with the gRNA-1 plasmid in Step 1 of Example 1, the only difference in the gRNA-OCT4-2 plasmid is that "CAGACATCTAATACCACGGT" is used to replace "ttgcgctgcttcgcgatgta". Compared with the gRNA-1 plasmid in Step 1 of Example 1, the only difference in the gRNA-OCT4-3 plasmid is that "AGGGAGAACGGGGCCTACCG" is used to replace "ttgcgctgcttcgcgatgta". The gRNA-OCT4 plasmid: It is obtained by mixing the gRNA-OCT4-1 plasmid, the gRNA-OCT4-2 plasmid and the gRNA-OCT4-3 plasmid in equimolar amounts. The gRNA-OCT4 plasmid targets the OCT4 gene.

[0138] Compared with the gRNA-1 plasmid in Step 1 of Example 1, the only difference in the gRNA-CRY1-1 plasmid is that "GAGAGCGCACGCGCGCCTAA" is replaced with "ttgcgctgcttcgcgatgta". Compared with the gRNA-1 plasmid in Step 1 of Example 1, the only difference in the gRNA-CRY1-2 plasmid is that "GTTTGGACTTGAAATGTACG" is replaced with "ttgcgctgcttcgcgatgta". Compared with the gRNA-1 plasmid in Step 1 of Example 1, the only difference in the gRNA-CRY1-3 plasmid is that "GCAGGATTGAAGCACATGGTT" is replaced with "ttgcgctgcttcgcgatgta". The gRNA-CRY1 plasmid is obtained by mixing the gRNA-CRY1-1 plasmid, the gRNA-CRY1-2 plasmid and the gRNA-CRY1-3 plasmid in equimolar amounts. The gRNA-CRY1 plasmid targets the CRY1 gene.

[0139] Compared with the gRNA-1 plasmid in Step 1 of Example 1, the only difference in the gRNA-STC2-1 plasmid is that "GAGCTGCGCCGTGGGGTGAC" is replaced with "ttgcgctgcttcgcgatgta". Compared with the gRNA-1 plasmid in Step 1 of Example 1, the only difference in the gRNA-STC2-2 plasmid is that "GTGCGTGCCCTGGGGCGCTT" is replaced with "ttgcgctgcttcgcgatgta". Compared with the gRNA-1 plasmid in Step 1 of Example 1, the only difference in the gRNA-STC2-3 plasmid is that "CTCACCTGTTCTCCAGGAGG" is replaced with "ttgcgctgcttcgcgatgta". The gRNA-STC2 plasmid is obtained by mixing the gRNA-STC2-1 plasmid, the gRNA-STC2-2 plasmid and the gRNA-STC2-3 plasmid in equimolar amounts. The gRNA-STC2 plasmid targets the STC2 gene.

[0140] Compared with the gRNA-1 plasmid in Step 1 of Example 1, the only difference in the gRNA-HBG1-1 plasmid is that "GGCTAGGGATGAAGAATAAA" is used to replace "ttgcgctgcttcgcgatgta". Compared with the gRNA-1 plasmid in Step 1 of Example 1, the only difference in the gRNA-HBG1-2 plasmid is that "CTTGACCAATAGCCTTGACA" is used to replace "ttgcgctgcttcgcgatgta". Compared with the gRNA-1 plasmid in Step 1 of Example 1, the only difference in the gRNA-HBG1-3 plasmid is that "TGCAAATATCTGTCTGAAAC" is used to replace "ttgcgctgcttcgcgatgta". The gRNA-HBG1 plasmid is obtained by equimolar mixing of the gRNA-HBG1-1 plasmid, the gRNA-HBG1-2 plasmid and the gRNA-HBG1-3 plasmid. The gRNA-HBG1 plasmid targets the HBG1 gene.

[0141] Compared with the gRNA-1 plasmid in Step 1 of Example 1, the only difference in the gRNA-IL1B-1 plasmid is that "GAAAACAATGCATATTTGCA" is used to replace "ttgcgctgcttcgcgatgta". Compared with the gRNA-1 plasmid in Step 1 of Example 1, the only difference in the gRNA-IL1B-2 plasmid is that "GAAAACAGCGAGGGAGAAAC" is used to replace "ttgcgctgcttcgcgatgta". Compared with the gRNA-1 plasmid in Step 1 of Example 1, the only difference in the gRNA-IL1B-3 plasmid is that "GTTAACTTGATTGTGAAATC" is used to replace "ttgcgctgcttcgcgatgta". The gRNA-IL1B plasmid: is obtained by equimolar mixing of the gRNA-IL1B-1 plasmid, the gRNA-IL1B-2 plasmid and the gRNA-IL1B-3 plasmid. The gRNA-IL1B plasmid targets the IL1B gene.

[0142] II. Verification of endogenous activation effect (HEK293T cells)

[0143] The dCas9 plasmids are respectively: dCas9-vector plasmid, dCas9-NHR plasmid, dCas9-2NHR plasmid or dCas9-VP64 plasmid. The gRNA plasmids are respectively: gRNA-NEURO plasmid, gRNA-PER2 plasmid, gRNA-OCT4 plasmid, gRNA-CRY1 plasmid, gRNA-STC2 plasmid or gRNA-HBG1 plasmid.

[0144] 1. Culture HEK293T cells until the confluence reaches 90%.

[0145] 2. Take a 24-well plate, inoculate the HEK293T cells obtained in step 1, and culture them in Opti-MEM medium containing 10% FBS for 12 - 16 hours.

[0146] 3. Take 600 ng of dCas9 plasmid and 200 ng of gRNA plasmid, add transfection reagent PEI (3 μl of transfection reagent PEI is formulated per 1 μg of DNA) and Opti-MEM medium (100 μl of Opti-MEM medium is formulated per 1 μg of DNA) to obtain a single-well dose of transfection mixture.

[0147] 4. After the transfection mixture obtained in step 3 is fully mixed and allowed to stand for 15 min, add it to the 24-well plate that has completed step 2. After culturing for 4 - 6 hours, discard the supernatant, and add Opti-MEM medium containing 10% FBS and culture for 24 hours.

[0148] 5. After completing step 4, aspirate and discard the supernatant, add Opti-MEM medium containing 5 μg / ml puromycin and 10% FBS, and culture for 48 hours. [[ID=X]] [[ID=X]]

[0149] 6. After completing step 5, collect the cells, wash them with PBS, then extract total RNA and reverse transcribe to obtain cDNA.

[0150] 7. Using the cDNA obtained in step 6 as a template and the GAPDH gene as an internal reference gene, perform RT-qPCR, and analyze the relative expression level of the target gene using the 2 -ΔΔCt method.

[0151] The results are shown in Figure 5 . Figure 5 In the abscissa of, Control represents the dCas9-vector plasmid, NHR represents the dCas9-NHR plasmid, 2NHR represents the dCas9-2NHR plasmid, and dCas9-VP64 represents the dCas9-VP64 plasmid.

[0152] III. Verification of endogenous activation effect (HeLa cells)

[0153] The dCas9 plasmids are respectively: dCas9-vector plasmid, dCas9-NHR plasmid, dCas9-2NHR plasmid or dCas9-VP64 plasmid. The gRNA plasmids are respectively: gRNA-IL1B plasmid, gRNA-OCT4 plasmid, gRNA-HBG1 plasmid.

[0154] Replace HEK293T cells with HeLa cells, and the others are the same as in step 2.

[0155] The results are shown in Figure 6 . Figure 6In the abscissa, Control represents the dCas9-vector plasmid, NHR represents the dCas9-NHR plasmid, 2NHR represents the dCas9-2NHR plasmid, and dCas9-VP64 represents the dCas9-VP64 plasmid.

[0156] Conclusion: The dCas9-NHR fusion method has the best effect.

[0157] Example 3. Replacing one activator in dCas9-VPR with NHR to enhance the activation of endogenous genes

[0158] I. Construction of recombinant plasmids

[0159] The dCas9-VPR plasmid: a circular plasmid, which consists of a backbone segment 1 (shown as nucleotides 1-698 in SEQ ID NO: 3), a fusion gene segment (shown as SEQ ID NO: 4), and a backbone segment 2 (shown as nucleotides 5022-9843 in SEQ ID NO: 3) in sequence. In SEQ ID NO: 4, nucleotides 1-4104 encode the dCas9 protein segment (4104 bp), nucleotides 4228-4377 encode the VP64 segment (150 bp), nucleotides 4429-5208 encode the p65 segment (780 bp), and nucleotides 5227-5796 encode the Rta segment (570 bp). The protein encoded by the above fusion gene segment is a fusion protein, which consists of the following segments in sequence from the N-terminus to the C-terminus: the dCas9 protein segment (shown as nucleotides 1-1368 in SEQ ID NO: 10) and the VPR segment shown as SEQ ID NO: 11. In SEQ ID NO: 11, amino acid residues 42-91 form the VP64 segment, amino acid residues 109-368 form the p65 segment, and amino acid residues 375-564 form the Rta segment.

[0160] The dCas9-NPR plasmid: a circular plasmid. Compared with the dCas9-VPR plasmid, the difference of the dCas9-NPR plasmid is only that the DNA segment shown as SEQ ID NO: 9 (encoding the NHR segment) replaces the DNA segment shown as nucleotides 4228-4377 in SEQ ID NO: 4.

[0161] The dCas9-VNR plasmid: a circular plasmid. Compared with the dCas9-VPR plasmid, the difference of the dCas9-VNR plasmid is only that the DNA segment shown as SEQ ID NO: 9 (encoding the NHR segment) replaces the DNA segment shown as nucleotides 4429-5208 in SEQ ID NO: 4.

[0162] dCas9-VPN plasmid: a circular plasmid. Compared with the dCas9-VPR plasmid, the only difference in the dCas9-VPN plasmid is that the DNA segment shown in SEQ ID NO: 9 (encoding the NHR segment) replaces the DNA segment shown at positions 5227-5796 in SEQ ID NO: 4.

[0163] gRNA-NEURO plasmid: See the corresponding description in Step 1 of Example 2.

[0164] gRNA-HBG1 plasmid: See the corresponding description in Step 1 of Example 2.

[0165] gRNA-CRY1 plasmid: See the corresponding description in Step 1 of Example 2.

[0166] gRNA-STC2 plasmid: See the corresponding description in Step 1 of Example 2.

[0167] Compared with the gRNA-1 plasmid in Step 1 of Example 1, the only difference in the gRNA-ACTC1 plasmid is that "TGGCGCCCTGCCCTCTGCTG" replaces "ttgcgctgcttcgcgatgta". The gRNA-ACTC1 plasmid targets the ACTC1 gene.

[0168] Compared with the gRNA-1 plasmid in Step 1 of Example 1, the only difference in the gRNA-GILZ-1 plasmid is that "AATGCCCTCTGCCTCTTGTT" replaces "ttgcgctgcttcgcgatgta". Compared with the gRNA-1 plasmid in Step 1 of Example 1, the only difference in the gRNA-GILZ-2 plasmid is that "GCAAAGCCATGGGGGCATGC" replaces "ttgcgctgcttcgcgatgta". Compared with the gRNA-1 plasmid in Step 1 of Example 1, the only difference in the gRNA-GILZ-3 plasmid is that "CAGTGACTGGGAAGAGGGT" replaces "ttgcgctgcttcgcgatgta". gRNA-GILZ plasmid: Obtained by equimolar mixing of gRNA-GILZ-1 plasmid, gRNA-GILZ-2 plasmid and gRNA-GILZ-3 plasmid. The gRNA-GILZ plasmid targets the GILZ gene.

[0169] Compared with the gRNA-1 plasmid in Step 1 of Example 1, the difference in the gRNA-MBD3-1 plasmid is only that "GGGCTGGCGAGCGCGGGGAG" is used to replace "ttgcgctgcttcgcgatgta". Compared with the gRNA-1 plasmid in Step 1 of Example 1, the difference in the gRNA-MBD3-2 plasmid is only that "CTGATTGGCGGGGCCGTAGA" is used to replace "ttgcgctgcttcgcgatgta". Compared with the gRNA-1 plasmid in Step 1 of Example 1, the difference in the gRNA-MBD3-3 plasmid is only that "GCACAGTAAAAGGAGCCGCG" is used to replace "ttgcgctgcttcgcgatgta". The gRNA-MBD3 plasmid is obtained by equimolar mixing of the gRNA-MBD3-1 plasmid, the gRNA-MBD3-2 plasmid and the gRNA-MBD3-3 plasmid. The gRNA-MBD3 plasmid targets the MBD3 gene.

[0170] II. Verification of activation effect (HEK293T cells)

[0171] The dCas9 plasmids are respectively: dCas9-VPR plasmid, dCas9-NPR plasmid, dCas9-VNR plasmid or dCas9-VPN plasmid. The gRNA plasmids are respectively: gRNA-CRY1 plasmid, gRNA-NEURO plasmid, gRNA-STC2 plasmid, gRNA-GILZ plasmid or gRNA-MBD3 plasmid.

[0172] The method is the same as Step 2 of Example 2.

[0173] The results are shown in Figure 7 . Figure 7 In the abscissa of, VPR represents the dCas9-VPR plasmid, NPR represents the dCas9-NPR plasmid, VNR represents the dCas9-VNR plasmid, and VPN represents the dCas9-VPN plasmid.

[0174] III. Verification of endogenous activation effect (HeLa cells)

[0175] The dCas9 plasmids are respectively: dCas9-VPR plasmid, dCas9-NPR plasmid, dCas9-VNR plasmid or dCas9-VPN plasmid. The gRNA plasmids are respectively: gRNA-ACTC1 plasmid, gRNA-GILZ plasmid, gRNA-HBG1 plasmid, gRNA-NEURO plasmid or gRNA-CRY1 plasmid.

[0176] The method is the same as Step 3 of Example 2.

[0177] The results are shown in Figure 8 .Figure 8 In the abscissa, VPR represents the dCas9-VPR plasmid, NPR represents the dCas9-NPR plasmid, VNR represents the dCas9-VNR plasmid, and VPN represents the dCas9-VPN plasmid.

[0178] Conclusion: The dCas9-NPR fusion method has the best effect.

[0179] Example 4. Fusion of NHR with dCas9-VPR Enhances Activation of Endogenous Genes

[0180] I. Construction of Recombinant Plasmids

[0181] dCas9-VPR plasmid: See the corresponding description in Step 1 of Example 3.

[0182] dCas9-NVPR plasmid: A circular plasmid. Compared with the dCas9-VPR plasmid, the only difference is that a DNA segment shown in SEQ ID NO: 9 (encoding the NHR segment) is inserted between nucleotides 4227 and 4228 of SEQ ID NO: 4.

[0183] dCas9-VNPR plasmid: A circular plasmid. Compared with the dCas9-VPR plasmid, the only difference is that a DNA segment shown in SEQ ID NO: 9 (encoding the NHR segment) is inserted between nucleotides 4428 and 4429 of SEQ ID NO: 4.

[0184] dCas9-VPNR plasmid: A circular plasmid. Compared with the dCas9-VPR plasmid, the only difference is that a DNA segment shown in SEQ ID NO: 9 (encoding the NHR segment) is inserted between nucleotides 5226 and 5227 of SEQ ID NO: 4.

[0185] dCas9-VPRN plasmid: A circular plasmid. Compared with the dCas9-VPR plasmid, the only difference is that a DNA segment shown in SEQ ID NO: 9 (encoding the NHR segment) is inserted between nucleotides 5796 and 5797 of SEQ ID NO: 4.

[0186] gRNA-NEURO plasmid: See the corresponding description in Step 1 of Example 2.

[0187] Compared with the gRNA-1 plasmid in Step 1 of Example 1, the only difference in the gRNA-ASCL1 plasmid is that "CGGGAGAAAGGAACGGGAGG" is used to replace "ttgcgctgcttcgcgatgta". The gRNA-ASCL1 plasmid targets the ASCL1 gene.

[0188] gRNA-PER2 plasmid: see the corresponding description in Step 1 of Example 2.

[0189] gRNA-HBG1 plasmid: see the corresponding description in Step 1 of Example 2.

[0190] gRNA-CRY1 plasmid: see the corresponding description in Step 1 of Example 2.

[0191] gRNA-GILZ plasmid: see the corresponding description in Step 1 of Example 3.

[0192] II. Verification of activation effect (HEK293T cells)

[0193] The dCas9 plasmids are respectively: dCas9-VPR plasmid, dCas9-NVPR plasmid, dCas9-VNPR plasmid, dCas9-VPNR plasmid or dCas9-VPRN plasmid. The gRNA plasmids are respectively: gRNA-NEURO plasmid, gRNA-ASCL1 plasmid or gRNA-PER2 plasmid.

[0194] The method is the same as Step 2 of Example 2.

[0195] The results are shown in Figure 9 . Figure 9 In the abscissa of, VPR represents dCas9-VPR plasmid, NVPR represents dCas9-NVPR plasmid, VNPR represents dCas9-VNPR plasmid, VPNR represents dCas9-VPNR plasmid, and VPRN represents dCas9-VPRN plasmid.

[0196] III. Verification of endogenous activation effect (HeLa cells)

[0197] The dCas9 plasmids are respectively: dCas9-VPR plasmid, dCas9-NVPR plasmid, dCas9-VNPR plasmid, dCas9-VPNR plasmid or dCas9-VPRN plasmid. The gRNA plasmids are respectively: gRNA-HBG1 plasmid, gRNA-CRY1 plasmid or gRNA-GILZ plasmid

[0198] The method is the same as Step 3 of Example 2.

[0199] The results are shown in Figure 10 . Figure 10 In the abscissa of, VPR represents dCas9-VPR plasmid, NVPR represents dCas9-NVPR plasmid, VNPR represents dCas9-VNPR plasmid, VPNR represents dCas9-VPNR plasmid, and VPRN represents dCas9-VPRN plasmid.

[0200] Conclusion: The dCas9-NVPR fusion method has the best effect.

[0201] Example 5: High specificity of the action of dCas9-NVPR

[0202] I. Construction of recombinant plasmid

[0203] dCas9-NVPR plasmid: See the corresponding description in Step 1 of Example 4.

[0204] gRNA-HBG1 plasmid: See the corresponding description in Step 1 of Example 2.

[0205] II. Verification of activation effect

[0206] The dCas9 plasmid is: dCas9-NVPR plasmid. The gRNA plasmid is: gRNA-HBG1 plasmid.

[0207] 1. Culture HEK293T cells until the confluence reaches 90%.

[0208] 2. Take a 24-well plate, inoculate the HEK293T cells obtained in Step 1, and culture them in Opti-MEM medium containing 10% FBS for 12 - 16 hours.

[0209] 3. Take 600 ng of dCas9 plasmid and 200 ng of gRNA plasmid, add transfection reagent PEI (3 μl of transfection reagent PEI per 1 μg of DNA) and Opti-MEM medium (100 μl of Opti-MEM medium per 1 μg of DNA) to obtain a single-well dose transfection mixture.

[0210] 4. After the transfection mixture obtained in Step 3 is fully mixed and allowed to stand for 15 min, add it to the 24-well plate that has completed Step 2. After culturing for 4 - 6 hours, discard the supernatant, and add Opti-MEM medium containing 10% FBS and culture for 24 hours.

[0211] 5. After completing Step 4, aspirate and discard the supernatant, add Opti-MEM medium containing 5 μg / ml puromycin and 10% FBS, and culture for 48 hours.

[0212] 6. After completing Step 5, collect the cells, wash them with PBS, and then extract total RNA.

[0213] 7. Take the total RNA obtained in Step 6 and perform whole-transcriptome RNA sequencing (RNA-seq) to evaluate the specificity of dCas9 NVPR across the whole genome. The results are shown in Figure 11 .

[0214] Example 6: Application of the dCas9-NVPR system to inhibit tumor development in cervical cancer cells

[0215] The PER2 gene is a tumor suppressor gene.

[0216] I. Construction of recombinant plasmids

[0217] The dCas9-vector plasmid: See the corresponding description in Step 1 of Example 1.

[0218] The dCas9-NVPR plasmid: See the corresponding description in Step 1 of Example 4.

[0219] The gRNA-PER2 plasmid: See the corresponding description in Step 1 of Example 2.

[0220] II. Verification of activation effect

[0221] The dCas9 plasmid is: the dCas9-NVPR plasmid or the dCas9-vector plasmid. The gRNA plasmid is: the gRNA-PER2 plasmid.

[0222] 1. Culture HeLa cells until the confluence reaches 90%.

[0223] 2. Take a 24-well plate, inoculate the HeLa cells obtained in Step 1, and culture them in Opti-MEM medium containing 10% FBS for 12 - 16 hours.

[0224] 3. Take 600 ng of the dCas9 plasmid and 200 ng of the gRNA plasmid, add the transfection reagent PEI (3 μl of transfection reagent PEI is formulated per 1 μg of DNA) and Opti-MEM medium (100 μl of Opti-MEM medium is formulated per 1 μg of DNA) to obtain a single-well dose transfection mixture.

[0225] 4. After thoroughly mixing and standing the transfection mixture obtained in Step 3 for 15 min, add it to the 24-well plate that has completed Step 2. After culturing for 4 - 6 hours, discard the supernatant, and add Opti-MEM medium containing 10% FBS and culture for 24 hours.

[0226] 5. After completing Step 4, aspirate and discard the supernatant, add Opti-MEM medium containing 5 μg / ml puromycin and 10% FBS, and culture for 48 hours.

[0227] 6. After completing Step 5, collect the cells, wash them with PBS, then extract total RNA and reverse transcribe to obtain cDNA.

[0228] 7. Using the cDNA obtained in step 6 as a template and the GAPDH gene as an internal reference gene, RT-qPCR was performed, and the 2-ΔΔCt method was used to analyze the relative expression levels of the target genes. The target genes were: PER2 gene, N-cad gene (encoding the epithelial-mesenchymal cell transformation marker N-cad), SNAIL gene (encoding the epithelial-mesenchymal cell transformation regulator SNAIL), or SLUG gene (encoding the epithelial-mesenchymal cell transformation regulator SLUG).

[0229] The results are shown in Figure 12 (the leftmost figure corresponds to the PER2 gene). Figure 12 Among them, Control represents the dCas9-vector plasmid, and NVPR represents the dCas9-NVPR plasmid. The results showed that transfection with the dCas9-NVPR plasmid and the gRNA plasmid could efficiently activate PER2 gene transcription, thereby reducing the expression of the N-cad gene, SNAIL gene, and SLUG gene.

[0230] 8. After completing step 5, the cells were collected, washed with PBS, and then a colony formation assay was performed.

[0231] The specific steps of the colony formation assay were as follows: The cells were seeded into 6-well plates at 10,000 cells / well and cultured in Opti-MEM medium containing 10% FBS for 14 days (fresh Opti-MEM medium containing 10% FBS was replaced every 2 - 3 days), then fixed with 4% paraformaldehyde for 30 minutes, and then stained with crystal violet.

[0232] The results are shown in Figure 13 . Figure 13 Among them, Vector represents the dCas9-vector plasmid, and NVPR represents the dCas9-NVPR plasmid. The results showed that the number of colonies in the treatment group transfected with the dCas9-NVPR plasmid and the gRNA plasmid was significantly reduced.

[0233] The primers used to detect each gene in the above examples are shown in Table 1.

[0234] Table 1

[0235] Forward primer (5’→3’) Reverse primer (5’→3’) GAPDH gene CTGGGCTACACTGAGCACC AAGTGGTCGTTGAGGGCAATG NEURO gene GGATGACGATCAAAAGCCCAA GCGTCTTAGAATAGCAAGGCA PER2 gene AATGCCGATATGTTTGCGGT GCATCGCTGAAGGCATCTCT OCT4 gene CCCTCCTACGTTGCGGTCA CGAGAAGCCGCTCCACAT CRY1 gene CTCCTCCAATGTGGGCATCAA CCACGAATCACAAACAGACGG STC2 gene GGGTGTGGCGTGTTTGAATG TTTCCAGCGTTGTGCAGAAAA HBG1 gene AGATGCCACAAAGCACCTG CTGCAGTCACCATCTTCTGC IL1B gene AGCTGATGGCCCTAAACAGA AAGCCCTTGCTGTAGTGGTG ACTC1 gene ATGTGTGACGACGAGGAGAC CGGACAATTTCACGTTCAGCA GILZ gene CAGTCCAAGCTCGATTGCC CTGCCGAAAGTTGCTCACT ASCL1 gene CGCGGCCAACAAGAAGATG CGACGAGTAGGATGAGACCG N-cad gene ACAGTGGCCACCTACAAAGG CCGAGATGGGGTTGATAATG SNAIL gene CCTCCCTGTCAGATGAGGAC CCAGGCTGAGGTATTCCTTG SLUG gene GGGGAGAAGCCTTTTTCTTG TCCTCATGTTTGTGCAGGAG

[0236] The above has described the present invention in detail. For those skilled in the art, without departing from the gist and scope of the present invention and without the need for unnecessary experiments, the present invention can be implemented within a relatively wide range under equivalent parameters, concentrations and conditions. Although specific embodiments of the present invention are given, it should be understood that the present invention can be further improved. In short, according to the principle of the present invention, this application intends to cover any modifications, uses or improvements of the present invention, including those that depart from the scope disclosed in this application and are made by using conventional techniques known in the art. The application of some basic features can be made within the scope of the appended claims below.

Claims

1. A protein comprising the following elements in sequence from the N-terminus to the C-terminus: a dCas9 segment and an activation domain segment; The activation domain segment has n NHRs; n is a natural number; The NHR is an NHR activation element from Caenorhabditis elegans.

2. The protein according to claim 1, wherein: The activation domain segment in the protein has a VP64 segment and / or a p65 segment and / or an Rta segment.

3. A DNA molecule encoding the protein according to claim 1 or 2.

4. A recombinant plasmid having the DNA molecule according to claim 3.

5. A kit comprising a dCas9 tool plasmid; the dCas9 tool plasmid is the recombinant plasmid according to claim 4.

6. The kit according to claim 5, characterized in that: The kit further comprises a gRNA tool plasmid.

7. Use of the dCas9 tool plasmid in the preparation of a kit for activating the transcription of a target gene; the dCas9 tool plasmid is the recombinant plasmid according to claim 4.

8. Use of the dCas9 tool plasmid and the gRNA tool plasmid in the preparation of a kit for activating the transcription of a target gene; the dCas9 tool plasmid is the recombinant plasmid according to claim 4.

9. A kit comprising a dCas9 tool plasmid and a gRNA tool plasmid; the dCas9 tool plasmid is the recombinant plasmid according to claim 4; the gRNA tool plasmid is a plasmid expressing an sgRNA targeting the PER2 gene.

10. Use of the dCas9 tool plasmid and the gRNA tool plasmid in the preparation of a kit; the dCas9 tool plasmid is the recombinant plasmid according to claim 4; the gRNA tool plasmid is a plasmid expressing an sgRNA targeting the PER2 gene.

Images