Construction of beta thalassemia model pig and Prime Editing technology-based gene repair method

Abstract

The invention belongs to the technical field of biology, particularly relates to construction of a beta thalassemia model pig and a gene repair method based on a Prime Editing technology, and provides a method for performing HBB mutant gene repair on CD34 + hematopoietic stem cells of the beta thalassemia pig based on a Prime Editing system, and the HBB mutant gene repair efficiency under different pegRNA editing systems is calculated by analyzing a sequencing result. After pig CD34 + hematopoietic stem cells repaired by HBB mutant genes are injected into beta-thalassemia pigs, related indexes such as blood routine examination, blood biochemistry and HBB expression level in blood cells of a repair group can be well recovered compared with a model group. Therefore, the Prime Editing gene repair method can be used for effectively improving the beta-thalassemia disease, and a powerful technical support is provided for gene repair of the beta-thalassemia.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, and specifically relates to the construction of a β-thalassemia model pig and a gene repair method based on PrimeEditing technology. Background Art

[0002] Beta-thalassemia (abbreviated as β-thalassemia) is a group of inherited autosomal recessive blood disorders that cause hemolytic anemia due to reduced or absent synthesis of β-globin chains. Thalassemia affects both men and women equally.

[0003] The HBB-28A>G mutation is a typical β + The TATA-box is a binding site for RNA polymerase II and the general transcription factor TFIID, which is crucial for transcription initiation.

[0004] At present, no large animal thalassemia model has been successfully developed. Pigs, as large animals, have long been the main meat supplier for humans. Their body size and physiological functions are similar to those of humans, making them easy to breed and raise on a large scale, making them ideal animal models of human diseases.

[0005] In addition, the treatment of β-thalassemia currently relies mainly on regular blood transfusions, and the use of genetic means to repair genes is still in the early stages of research and development.

[0006] In order to solve the above problems, the present invention proposes the construction of a β-thalassemia model pig and a gene repair method based on PrimeEditing technology. Summary of the Invention

[0007] In order to solve the above technical problems, the present invention provides the following technical solutions:

[0008] The purpose of the present invention is to provide a construction of a β-thalassemia model pig and a gene repair method based on Prime Editing technology.

[0009] The present invention provides a method for preparing recombinant porcine fibroblasts, comprising the following steps:

[0010] S1: HBB-T7-gU1, HBB-T7-gD1, HBB-28mut-ss111 and NCN protein were co-transfected into porcine primary fibroblasts to obtain recombinant porcine fibroblasts;

[0011] Specifically, the co-transfection is performed by electroporation;

[0012] Specifically, a mammalian nucleofection kit (Neon kit, Thermofisher) and Neon TM transfection system electroporator were used;

[0013] Specifically, the parameters of electrotransfection were set as: 1450 V, 10 ms, 3 pulses.

[0014] S2: Ratio: 100,000 primary porcine fibroblasts: 1μg HBB-T7-gU1: 1μg HBB-T7-gD1: 2μg HBB-28mut-ss111: 4μg NCN protein.

[0015] The present invention also provides a kit comprising HBB-T7-gU1, HBB-T7-gD1, HBB-28mut-ss111 and NCN protein;

[0016] The NCN protein is shown in SEQ ID NO: 3 in patent 202210973665.5;

[0017] The ratios of HBB-T7-gU1, HBB-T7-gD1, HBB-28mut-ss111 and NCN protein are: 1 μg HBB-T7-gU1: 1 μg HBB-T7-gD1: 2 μg HBB-28mut-ss111: 4 μg NCN protein.

[0018] The uses of the above kits are as follows:

[0019] (a) preparing recombinant porcine fibroblasts;

[0020] (b) preparing a β-thalassemia model pig;

[0021] (c) Preparing a β-thalassemia cell model, a β-thalassemia tissue model, or a β-thalassemia organ model.

[0022] Specifically, the HBB-T7-gU1 described in the above method is an sgRNA, and its target sequence binding region is shown in nucleotides 3-22 in SEQ ID NO: 8; the HBB-T7-gD1 is an sgRNA, and its target sequence binding region is shown in nucleotides 3-22 in SEQ ID NO: 9; the HBB-28mut-ss111 is a DonorDNA, and its sequence is shown in SEQ ID NO: 10.

[0023] The present invention also protects the recombinant porcine fibroblasts prepared by the above method.

[0024] The present invention also protects the use of the recombinant porcine fibroblasts in preparing beta-thalassemia model pigs.

[0025] The recombinant porcine fibroblasts are used as nuclear transplant donor cells to carry out somatic cell cloning to obtain cloned pigs, namely, beta-thalassemia model pigs.

[0026] The present invention also provides a method for preparing CD34+ hematopoietic stem cells with repaired HBB mutation genes, comprising the following steps:

[0027] S1: Umbilical cord blood from β-thalassemia pigs was collected using a collection tube with anticoagulant, and CD34+ hematopoietic stem cells were isolated, purified, and expanded in vitro;

[0028] Specifically, the pretreatment used the hydroxyethyl starch (HES) sedimentation method;

[0029] Specifically, 6% HES solution was added to umbilical cord blood at a ratio of 1:4, mixed, and allowed to stand for 30-45 minutes (4°C). The upper layer of leukocyte-rich suspension was aspirated and centrifuged (400×g, 10 minutes) to collect the cell pellet;

[0030] Specifically, during the isolation and purification of CD34+ hematopoietic stem cells, the cell pellet was resuspended in fresh culture medium, incubated with mouse anti-porcine CD34 monoclonal antibody (Kingfisher Biotech, Cat#: VS3-FX105) (final antibody concentration was 1:200 dilution multiple), and CD34+ hematopoietic stem cells were flow cytometry sorted;

[0031] Specifically, the basal medium for CD34+ hematopoietic stem cell culture in vitro is a serum-free medium (StemSpan TM SFEMII), followed by the following components (final concentrations): penicillin / streptomycin (1%), L-glutamine (2 mM), cytokine combination (SCF (50 ng / mL), TPO (50 ng / mL), FLT3-L (50 ng / mL), IL-6 (20 ng / mL));

[0032] Specifically, the initial cell density was 1×10 5 cells / mL; cultured in 6-well plates with low adsorption properties to minimize cell attachment loss. Culture conditions: 37°C, 5% CO2, 5% O2, 95% humidity, with half the medium replaced every 2-3 days. Count cells daily and monitor expansion to maintain a density ≤ 2 × 10 6 cells / mL to avoid overcrowding. At the same time, the small molecule inhibitor UM171 (35nM) was added to inhibit differentiation and maintain stem cell stemness, and SR1 (StemRegenin 1, 0.75μM) was added to antagonize the AHR pathway and promote hematopoietic stem cell self-renewal;

[0033] Specifically, the cell freezing medium is a special serum-free freezing medium ( CS10), the cell pellet was suspended in freezing solution, divided into cryovials, programmed to cool (-1°C / min to -80°C), and transferred to liquid nitrogen after 24 h;

[0034] Specifically, cells were thawed quickly (37°C water bath, 1-2 min) during recovery, pre-warmed culture medium was added, and the cells were centrifuged (300×g, 5 min) to remove the freezing solution and resuspended in fresh culture medium.

[0035] S2: Repair of HBB mutation gene in β-thalassemia pig CD34+ hematopoietic stem cells based on Prime Editing system;

[0036] Specifically, to repair the HBB defect mutation (-28A>G) in β-thalassemia pigs, four pegRNAs were designed using the online tool PREDICT (https: / / pridict.it) to find the pegRNA with the highest editing efficiency.

[0037] The pegRNA1 sequence is: (SEQ ID NO: 11)

[0038] 5'-GAGCAAATGTAGGTGGCTGCGTTTCAGAGCTATGCTGGAAACAGCATAGCAAGTTGAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCAGGAGGCTGGGGGGGCATAaAAGGAAGAGCAGAGCCAGCAGCCACCTACATTT-3'

[0039] The pegRNA2 sequence is: (SEQ ID NO: 12)

[0040] 5'-GAGCAAATGTAGGTGGCTGCGTTTCAGAGCTATGCTGGAAACAGCATAGCAAGTTGAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCG AGTCGGTGCAGGAGGCTGGGGGGGCATAaAAGGAAGAGCAGAGCCAGCA GCCACCTACATTTG-3'

[0041] The pegRNA3 sequence is: (SEQ ID NO: 13)

[0042] 5'-GAGCAAATGTAGGTGGCTGCGTTTCAGAGCTATGCTGGAAACAGCA TAGCAAGTTGAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCG AGTCGGTGCAGGAGGCTGGGGGGGCATAaAAGGAAGAGCAGAGCCAGCA GCCACCTACATT-3'

[0043] The pegRNA4 sequence is: (SEQ ID NO: 14)

[0044] 5'-GAGCAAATGTAGGTGGCTGCGTTTCAGAGCTATGCTGGAAACAGCA TAGCAAGTTGAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCG AGTCGGTGCAGGAGGCTGGGGGGGCATAaAAGGAAGAGCAGAGCCAGCA GCCACCTACAT-3'

[0045] Specifically, four pegRNA sequences were synthesized by whole-gene synthesis, and the pU6-pegRNA-GG-acceptor-0 vector (SEQ ID NO: 15) was taken and digested with the restriction endonuclease BsaI, the vector backbone (a large linear fragment of approximately 2.2 kb) was recovered, and the four pegRNA sequences were cloned into the pU6-pegRNA-GG-acceptor-0 vector respectively to obtain the recombinant pU6-pegRNA-GG-acceptor vector.

[0046] SEQ ID NO: 15

[0047]

[0048] Specifically, the four pegRNA target vectors pU6-pegRNA-GG-acceptor were co-transfected with the pCMV-PE2 vector (Addgene, Cat#: 132775) into β-thalassemia pig CD34 + hematopoietic stem cells;

[0049] Specifically, the ratio is: 200,000 β-thalassemia pig CD34+ hematopoietic stem cells: 0.83μg pU6-pegRNA-GG-acceptor: 1.17μg pCMV-PE2;

[0050] Specifically, the co-transfection is performed by electroporation;

[0051] Specifically, a mammalian nucleofection kit (Neon kit, Thermofisher) and Neon TM transfection system electroporator were used;

[0052] Specifically, the parameters of electrotransfection were set to 1550 V, 10 ms, and 3 pulses.

[0053] S3: Collect the edited CD34+ cell population, extract genomic DNA, prepare the HBB gene target site second-generation sequencing library, and sequence it using high-throughput sequencing technology;

[0054] Specifically, the repair efficiency of HBB mutant genes under different pegRNA editing systems was calculated by analyzing the sequencing results;

[0055] Specifically, the HBB mutant gene repair efficiency of CD34+ population cells was 16.87%±1.63% (pegRNA1), 3.65%±0.83% (pegRNA2), 9.23%±1.44% (pegRNA3), and 5.69%±1.02% (pegRNA4), respectively.

[0056] Specifically, the pegRNA target vector pU6-pegRNA-GG-acceptor is a pegRNA expression vector, characterized in that the expression vector expresses the pegRNA shown in SEQ ID NO.11-14, and the vector backbone of the expression vector is pU6-pegRNA-GG-acceptor-0, and the full plasmid sequence is shown in SEQ ID NO: 15. The pegRNA target vector pU6-pegRNA-GG-acceptor is characterized in that the expression vector is obtained by inserting the pegRNA sequence shown in SEQ ID NO.11-14 into the vector backbone pU6-pegRNA-GG-acceptor-0;

[0057] Specifically, the pCMV-PE2 is a commercial plasmid (Addgene, Cat#: 132775).

[0058] The present invention also provides a kit, comprising a pegRNA target vector pU6-pegRNA-GG-acceptor and a pCMV-PE2 vector;

[0059] The ratio of pegRNA target vector pU6-pegRNA-GG-acceptor and pCMV-PE2 vector is: 0.83 μg pU6-pegRNA-GG-acceptor: 1.17 μg pCMV-PE2;

[0060] The purpose of the above kit is to prepare CD34+ hematopoietic stem cells with repaired HBB mutation gene;

[0061] The present invention also protects the use of the prepared β-thalassemia model pig in gene repair;

[0062] The present invention selects a group of cells with the highest efficiency in repairing the HBB mutant gene, namely the pegRNA1 group, and infuses them back into the bodies of β-thalassemia pigs via intravenous injection. 48 hours after the injection, venous blood is collected from the cloned pigs to measure blood routine, blood biochemistry, and HBB expression levels in blood cells, and to evaluate the effect of infusion of CD34+ hematopoietic stem cells with repaired HBB mutant genes on alleviating β-thalassemia symptoms.

[0063] The present invention also protects the use of the HBB mutant gene-repaired CD34+ hematopoietic stem cells in repairing beta-thalassemia model pigs.

[0064] The beneficial effects of the present invention are:

[0065] 1. The research subjects (pigs) are more applicable than other animals (mice, rats, and primates). Mice and other rodents are very different from humans in terms of body shape, organ size, physiology, and pathology, and cannot truly simulate the normal physiological and pathological conditions of humans. Studies have shown that more than 95% of drugs that have been proven effective in mice are ineffective in human clinical trials. As far as large animals are concerned, primates are the animals that are most closely related to humans, but they are small in size, mature sexually late, and are single-birth animals. The population expansion rate is extremely slow, and the breeding cost is very high. In addition, primate cloning is inefficient, difficult, and costly;

[0066] As a model animal, pigs do not have the above disadvantages. They are the animals that are most closely related to humans besides primates. Their body shape, weight, organ size, etc. are similar to those of humans. They are very similar to humans in terms of anatomy, physiology, immunology, nutritional metabolism, and disease pathogenesis. At the same time, pigs reach sexual maturity early (4-6 months), have high fertility, and can have many offspring per litter. A large group can be formed within 2-3 years. In addition, pig cloning technology is very mature, and the cost of cloning and raising pigs is much lower than that of primates. Therefore, pigs are very suitable animals as models of human diseases;

[0067] 2. Gene editing was performed using the NCN high-efficiency protein in combination with in vitro transcribed gRNA of the high-efficiency target screened by the present invention, with synthetic ssODN as donor DNA. The optimal dosage ratio of NCN protein, gRNA, and donor DNA was optimized. The single-cell clone rate of target site point mutation was as high as 36.7%, which is much higher than the conventional point mutation efficiency (<5%).

[0068] 3. Using the target gene point mutation single-cell clone obtained by the present invention for somatic cell nuclear transfer animal cloning can directly obtain cloned pigs containing target site mutations, and the mutation can be stably inherited;

[0069] The method used in mouse model production involves microinjecting gene-edited materials into fertilized eggs and then performing embryo transplantation. However, the probability of directly obtaining offspring with point mutations is very low (less than 1%), requiring hybridization and selection of offspring. This is not suitable for model production in large animals (such as pigs) with long gestation periods. Therefore, the present invention uses a technically difficult and challenging method of in vitro editing of primary cells and homologous recombination of donor DNA and screening for positively edited single-cell clones, and then directly obtains β-thalassemia model pigs through somatic cell nuclear transfer animal cloning technology. This can greatly shorten the model pig production cycle and save manpower, material, and financial resources.

[0070] 4. This invention uses CRISPR / Cas9 technology combined with donor DNA homologous recombination technology to perform site-directed mutagenesis in the HBB gene, mimicking the naturally occurring genetic characteristics of β-thalassemia. Single-cell clones with HBB gene point mutations were obtained, and β-thalassemia model pigs with HBB gene point mutations were bred using somatic cell nuclear transfer animal cloning technology. This model pig will help study and reveal the pathogenesis of β-thalassemia caused by HBB gene point mutations. It can also be used for drug screening, drug efficacy testing, gene therapy, and cell therapy research. It can provide effective experimental data for further clinical applications and provide a powerful experimental method for the successful treatment of human β-thalassemia, with significant application value.

[0071] 5. This study uses Prime Editing technology to repair the HBB mutant gene in β-thalassemia. After injecting porcine CD34+ hematopoietic stem cells with the repaired HBB mutant gene into β-thalassemia pigs, the repaired group showed significantly improved blood counts, blood biochemistry, and HBB expression levels in blood cells compared to the model group. This demonstrates that Prime Editing gene repair can effectively improve β-thalassemia symptoms, and this study provides strong technical support for gene repair in β-thalassemia. BRIEF DESCRIPTION OF THE DRAWINGS

[0072] The accompanying drawings are used to provide a further understanding of the present invention and constitute a part of the specification. Together with the embodiments of the present invention, they are used to explain the present invention and do not constitute a limitation of the present invention. In the accompanying drawings:

[0073] Figure 1 This is a sequencing peak diagram of the target site region of the wild-type pig of the present invention;

[0074] Figure 2 It is a sequencing peak diagram of the target site region of the heterozygous mutant pig of the present invention;

[0075] Figure 3 This is a sequencing peak diagram of the target site region of the homozygous mutant pig of the present invention;

[0076] Figure 4 This is a schematic diagram of the comparison results of blood routine indicators between the model group and the control group of the present invention;

[0077] Figure 5 This is a schematic diagram of the comparison results of blood biochemical indicators between the model group and the control group of the present invention;

[0078] Figure 6 This is a schematic diagram of the comparison results of organ weight coefficients between the model group and the control group of the present invention;

[0079] Figure 7 This is a comparison of the heart sizes of the model group and the control group of the present invention;

[0080] Figure 8 This is a comparison of spleen sizes between the model group and the control group of the present invention;

[0081] Figure 9 This is a schematic diagram showing the comparison of HBB mRNA expression levels in blood cells between the model group and the control group of the present invention;

[0082] Figure 10 This is a schematic diagram of the comparison results of various blood routine indicators among the repair group, model group and control group of the present invention;

[0083] Figure 11 This is a schematic diagram of the comparison results of blood biochemical indicators among the repair group, model group and control group of the present invention;

[0084] Figure 12 This is a schematic diagram showing the comparison of HBB mRNA expression levels in blood cells of the repair group, model group, and control group of the present invention; DETAILED DESCRIPTION

[0085] The preferred embodiments of the present invention are described below with reference to the accompanying drawings. It should be understood that the preferred embodiments described herein are only used to illustrate and explain the present invention, and are not used to limit the present invention.

[0086] Unless otherwise noted, the experimental methods in the following examples are conventional methods and were performed according to the techniques and conditions described in literature in the field or according to product specifications. The materials and reagents used in the following examples are commercially available unless otherwise noted. The recombinant plasmids constructed in the examples have been verified by sequencing.

[0087] Example 1: Screening of efficient gRNA targets for the HBB gene

[0088] 1. HBB gene information

[0089] Pig HBB gene information: hemoglobin beta globin, located on chromosome 9; GeneID is 407066, Susscrofa.

[0090] In genomic DNA, the porcine HBB gene has three exons.

[0091] In porcine genomic DNA, the -28A>G mutation site of the HBB gene and its 300 bp upstream and downstream sequences are shown in SEQ ID NO: 1. The nucleotide sequence of the TATA-box region of porcine HBB is highly conserved with that of human HBB (-30 to -24 region).

[0092] SEQ ID NO: 1

[0093] Tccttggattcttcgtttgtgtactaagaaaatggggaggcagtctctaagagattgctacagtgggactcaactctaaaagttgtacagacttgctaaggaggatgaaattagtagcactttgcactgtgaggatgggacctagagctccccagagaagggctgaaggtctgaagttggtgccaggaacgccgaagacaggtatactgtcaacattcaagcctcaccctgtggaaccacgccctggcctgggccaatctgctcccagaagcagggagggcaggaggctgggggggcataaaaggaagagcagagccagcagccacctacatttgcttctgacacaaccgtgttcactagcaactgcacaaacagacaacatggtgcatctgtctgctgaggagaaggaggccgtcctcggcctgtggggcaaagtgaatgtggacgaagttggtggtgaggccctgggcaggttggtatccagggcttcaggagagggagcgggaggtgggcaggtggggacagagccacccctgcctttctgacaggtgctgactccctcgggccttgcgctcttttcacccctcaggctgctggttgt

[0094] Plasmid pKG-GE3 is a circular plasmid as shown in SEQ ID NO: 2 in Patent Application 202010084343.6.

[0095] In SEQ ID NO: 2 in patent application 202010084343.6, nucleotides 395-680 constitute the CMV enhancer, nucleotides 682-890 constitute the EF1a promoter, nucleotides 986-1006 encode the nuclear localization signal (NLS), nucleotides 1016-1036 encode the nuclear localization signal (NLS), nucleotides 1037-5161 encode the Cas9 protein, nucleotides 5162-5209 encode the nuclear localization signal (NLS), nucleotides 5219-5266 encode the nuclear localization signal (NLS), and nucleotides 5276-5332 encode the self-cleaving polypeptide P2A (the amino acid sequence of the self-cleaving polypeptide P2A is "ATNFSLLKQAGDVEENPGP", and the cleavage position where self-cleavage occurs is The invention discloses a novel oligonucleotide encoding a cleavage site comprising a nucleotide sequence of at least 50 amino acids, comprising a WPRE sequence element, a nucleotide sequence of at least 50 amino acids ...

[0096] In SEQ ID NO: 2 in patent application 202010084343.6, nucleotides 911-6706 form a fusion gene and express a fusion protein.

[0097] Due to the presence of the self-cleaving polypeptide P2A and the self-cleaving polypeptide T2A, the fusion protein spontaneously forms the following three proteins: a protein with Cas9 protein, a protein with EGFP protein, and a protein with Puro protein.

[0098] The pKG-U6gRNA vector, i.e., the plasmid pKG-U6gRNA, is a circular plasmid, as shown in SEQ ID NO: 3 in patent application 202010084343.6. In SEQ ID NO: 3 in patent application 202010084343.6, nucleotides 2280-2539 constitute the hU6 promoter, and nucleotides 2558-2637 are used for transcription to form the gRNA backbone.

[0099] When used, a DNA molecule of about 20 bp (used to transcribe the target sequence binding region of gRNA) is inserted into the plasmid pKG-U6gRNA to form a recombinant plasmid, and the recombinant plasmid is transcribed in the cell to obtain gRNA.

[0100] According to the porcine HBB genome reference sequence published by NCBI, primers were designed using Primer-BLAST to amplify the sequence at the 3' end of the promoter region of porcine HBB close to the transcription start site.

[0101] HBB-F1: TTGCTACAGTGGGACTCAACTC;

[0102] HBB-R441: CTCCTGAAGCCCTGGATACC.

[0103] Wild-type Bama Xiang pig ear tissue was used as a template for PCR amplification using the HBB-F1 / HBB-R441 primer pair. The target bands were then recovered and sequenced after electrophoresis on a 1% agarose gel. Sequencing results were aligned with the HBB gene sequence of the porcine reference genome (sus scrofa 11.1). SNP-free regions were selected for gRNA target design.

[0104] 2. Screening gRNA targets

[0105] An online tool (https: / / www.benchling.com) was used to design gRNA targeting the porcine HBB gene. A total of four gRNAs were designed, and the four target sequences are as follows:

[0106] HBB-gU1:5'-ATCTGCTCCCAGAAGCAGGG-3'

[0107] HBB-gU2:5'-CCAATCTGCTCCCAGAAGCA-3'

[0108] HBB-gD1:5'-GTGTCAGAAGCAAATGTAGG-3'

[0109] HBB-gD2:5'-GTTGTGTCAGAAGCAAATGT-3'

[0110] 3. Preparation of recombinant plasmid

[0111] The plasmid pKG-U6gRNA was taken and digested with the restriction endonuclease BbsI to recover the vector backbone (a large linear fragment of about 3 kb).

[0112] HBB-gU1-S and HBB-gU1-A were synthesized separately, mixed, and annealed to generate double-stranded DNA molecules with sticky ends. These double-stranded DNA molecules with sticky ends were ligated to the vector backbone to generate the plasmid pKG-U6gRNA(HBB-gU1). The plasmid pKG-U6gRNA(HBB-gU1) expresses the sgRNA HBB-gU1 set forth in SEQ ID NO: 2.

[0113] sgRNAHBB-gU1 (SEQ ID NO: 2):

[0114] AUCUGCUCCCAGAAGCAGGGguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu.

[0115] HBB-gU2-S and HBB-gU2-A were synthesized separately, mixed, and annealed to generate double-stranded DNA molecules with sticky ends. These double-stranded DNA molecules with sticky ends were ligated to the vector backbone to generate the plasmid pKG-U6gRNA (HBB-gU2). The plasmid pKG-U6gRNA (HBB-gU2) expressed the sgRNA HBB-gU2 set forth in SEQ ID NO: 3.

[0116] sgRNAHBB-gU2 (SEQ ID NO: 3):

[0117] CCAAUCUGCUCCCAGAAGCAguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu.

[0118] HBB-gD1-S and HBB-gD1-A were synthesized separately, mixed, and annealed to generate double-stranded DNA molecules with sticky ends. These double-stranded DNA molecules with sticky ends were ligated to a vector backbone to generate the plasmid pKG-U6gRNA (HBB-gD1). The plasmid pKG-U6gRNA (HBB-gD1) expressed the sgRNA HBB-gD1 set forth in SEQ ID NO: 4.

[0119] sgRNAHBB-gD1 (SEQ ID NO: 4):

[0120] GUGUCAGAAGCAAAUGUAGGguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu.

[0121] HBB-gD2-S and HBB-gD2-A were synthesized separately, mixed, and annealed to generate double-stranded DNA molecules with sticky ends. The double-stranded DNA molecules with sticky ends were ligated to the vector backbone to generate the plasmid pKG-U6gRNA(HBB-gD2). The plasmid pKG-U6gRNA(HBB-gD2) expresses the sgRNA HBB-gD2 set forth in SEQ ID NO:5.

[0122] sgRNAHBB-gD2 (SEQ ID NO: 5):

[0123] GUUGUGUCAGAAGCAAAUGUguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu.

[0124] HBB-gU1-S: caccgATCTGCTCCCAGAAGCAGGG

[0125] HBB-gU1-A:aaacCCCTGCTTTCGGGAGCAGATc

[0126] HBB-gU2-S:caccgCCAATCTGCTCCCAGAAGCA

[0127] HBB-gU2-A:aaacTGCTTCTGGGAGCAGATTGGc

[0128] HBB-gD1-S:caccGTGTCAGAAGCAAATGTAGG

[0129] HBB-gD1-A:aaacCCTACATTTGCTTCTTGACAC

[0130] HBB-gD2-S: caccGTTGTGTCAGAAGCAAATGT

[0131] HBB-gD2-A:aaacACATTTGCTTCTGACACAAC

[0132] HBB-gU1-S, HBB-gU1-A, HBB-gU2-S, HBB-gU2-A, HBB-gD1-S, HBB-gD1-A, HBB-gD2-S, and HBB-gD2-A are all single-stranded DNA molecules.

[0133] 4. Comparison of Editing Efficiency of Different Targets

[0134] Group 1: Co-transfect primary porcine fibroblasts with plasmid pKG-U6gRNA (HBB-gU1) and plasmid pKG-GE3. Ratio: approximately 200,000 primary porcine fibroblasts: 0.92 μg plasmid pKG-U6gRNA (HBB-gU1): 1.08 μg plasmid pKG-GE3.

[0135] Group 2: Co-transfect primary porcine fibroblasts with plasmid pKG-U6gRNA (HBB-gU2) and plasmid pKG-GE3. Ratio: approximately 200,000 primary porcine fibroblasts: 0.92 μg plasmid pKG-U6gRNA (HBB-gU2): 1.08 μg plasmid pKG-GE3.

[0136] Group 3: Co-transfect primary porcine fibroblasts with plasmid pKG-U6gRNA (HBB-gD1) and plasmid pKG-GE3. Ratio: approximately 200,000 primary porcine fibroblasts: 0.92 μg plasmid pKG-U6gRNA (HBB-gD1): 1.08 μg plasmid pKG-GE3.

[0137] Group 4: Co-transfect primary porcine fibroblasts with plasmid pKG-U6gRNA (HBB-gD2) and plasmid pKG-GE3. Ratio: approximately 200,000 primary porcine fibroblasts: 0.92 μg plasmid pKG-U6gRNA (HBB-gD2): 1.08 μg plasmid pKG-GE3.

[0138] Group 5: Primary porcine fibroblasts, electroporated with the same electroporation parameters but without adding plasmids.

[0139] Co-transfection was performed by electroporation using a mammalian nuclear transfection kit (Neon kit, Thermofisher) and a Neon™ transfection system electroporator.

[0140] The parameters of electroporation were set as: 1450 V, 10 ms, 3 pulses.

[0141] After completing the above steps, culture the cells in complete culture medium for 12-18 hours, then replace with fresh complete culture medium. The total culture time after electroporation is 48 hours.

[0142] After completing the above steps, trypsin was used to digest and collect the cells, the cells were lysed, genomic DNA was extracted, PCR amplification was performed using a primer pair consisting of HBB-F1 / HBB-R441, and then 1% agarose gel electrophoresis was performed to detect the mutation of the cell target gene.

[0143] The target product is excised and recovered from the gel and sent to a sequencing company for sequencing. The sequencing results are then analyzed using the web-based Synthego ICE tool to analyze the sequencing peak graph and determine the gene editing efficiency of different targets.

[0144] The gene editing efficiencies of groups 1 to 4 were 68%, 46%, 57%, and 43%, respectively, with no gene editing occurring in group 5. The results showed that HBB-gU1 and HBB-gD1 had high editing efficiencies.

[0145] Example 2: Preparation of single cell clones with HBB gene mutations

[0146] The two highly efficient gRNA targets (HBB-gU1 and HBB-gD1) screened in Example 1 were selected.

[0147] 1. Preparation of gRNA

[0148] 1. Preparation of HBB-gU1 and HBB-gD1 transcription templates

[0149] The HBB-T7-gU1 transcription template is a double-stranded DNA molecule, as shown in SEQ ID NO:6.

[0150] SEQ ID NO: 6

[0151] GGCTTGTCGGACTCTTCGCTATTACGCCAGCTGGCGAAGGGGGATGTGCTGCAAGGCGATTAAGTTGGGTAACCGCCAGGGTTTTCCCAGTCACGACGTTTAGGAAATTAATACGACTCACTATAGGATCTGCTCCCAGAAGCAGGGGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTT;

[0152] The HBB-T7-gD1 transcription template is a double-stranded DNA molecule, as shown in SEQ ID NO:7.

[0153] SEQ ID NO: 7

[0154] GGCTTGTCGGACTCTTCGCTATTACGCCAGCTGGCGAAGGGGGATGTGCTGCAAGGCGATTAAGTTGGGTAACGCCCAGGGTTTTCCCAGTCACGACGTTTAGGAAATTAATACGACTCACTATAGGGTGTCAGAAGCAAATGTAGGGTTTAAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTT.

[0155] 2. Obtain gRNA by in vitro transcription

[0156] Take HBB-T7-gU1 transcription template, use TranscriptAidT7HighYieldTranscription Kit (Fermentas, K0441) for in vitro transcription, and then use MEGAclear TM The RNA was recovered and purified using Transcription Clean-Up Kit (Thermo, AM1908) to obtain HBB-T7-gU1, which is a single-stranded RNA as shown in SEQ ID NO: 8.

[0157] SEQ ID NO: 8

[0158] GGATCTGCTCCCAGAAGCAGGGGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCCGGUGCUUUU;

[0159] Take HBB-T7-gD1 transcription template, use TranscriptAidT7HighYieldTranscription Kit (Fermentas, K0441) for in vitro transcription, and then use MEGAclear TM The RNA was recovered and purified using Transcription Clean-Up Kit (Thermo, AM1908) to obtain HBB-T7-gD1, which is a single-stranded RNA as shown in SEQ ID NO: 9.

[0160] SEQ ID NO: 9

[0161] GGGTGTCAGAAGCAAATGTAGGGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCCGGUGCUUUU.

[0162] 2. Synthesis of HBB-28A>G mutant single-stranded donor DNA

[0163] A single-stranded DNA corresponding to the HBB-28A>G mutation was synthesized as donor DNA, and the single-stranded donor DNA was named HBB-28mut-ss111.

[0164] HBB-28mut-ss111 is shown in SEQ ID NO:10.

[0165] SEQ ID NO: 10

[0166] 5′-AAGCCTCACCCTGTGGAACCACGCCCTGGCCTGGGCCAATCTGCTCCCAGAAGCAGGGAGGGCAGGAGGCTGGGGGGGCATAgAAGGAAGAGCAGAGCCAGCAGCCACCTACATTTGCTTCTGACACAACCGTGTTCACTAGCAACTGCACAAACAGACAACATG-3'

[0167] The NCN protein is a Cas9 protein, and its sequence is shown in SEQ ID NO: 3 in patent 202210973665.5.

[0168] 3. Transfection of Primary Porcine Fibroblasts

[0169] 1. Co-transfect porcine primary fibroblasts with HBB-T7-gU1, HBB-T7-gD1, HBB-28mut-ss111, and NCN protein. Ratio: approximately 100,000 porcine primary fibroblasts: 1 μg HBB-T7-gU1: 1 μg HBB-T7-gD1: 2 μg HBB-28mut-ss111: 4 μg NCN protein. Co-transfection was performed by electroporation using the Mammalian Nucleofection Kit (Neonkit, ThermoFisher) and the Neon™ transfection system (parameters: 1450V, 10 ms, 3 pulses).

[0170] 2. After completing step 1, culture the cells in complete culture medium for 16-18 hours, then replace with fresh complete culture medium. The total culture time after electroporation is 48 hours.

[0171] 3. After completing step 2, use trypsin to digest and collect the cells, then wash with complete culture medium, and then resuspend in complete culture medium. Then pick each monoclonal clone and transfer it to a 96-well plate (1 cell per well, each well contains 100 μl complete culture medium) and culture for about 10 days (replace new complete culture medium every 2-3 days).

[0172] 4. After completing step 3, trypsinize and collect the cells (about 2 / 3 of the cells obtained in each well are inoculated into a 6-well plate filled with complete culture medium, and the remaining 1 / 3 are collected in a 1.5 mL centrifuge tube).

[0173] 5. Take the 6-well plate from step 4 and culture until the cells grow to 80% confluence, digest and collect the cells with trypsin, and freeze the cells using cell freezing solution (90% complete culture medium + 10% DMSO, volume ratio).

[0174] 6. Take the centrifuge tube from step 4, remove the cells, lyse the cells and extract genomic DNA. Amplify the DNA by PCR using the HBB-F1 / HBB-R441 primer pair, and then perform electrophoresis. Use primary porcine fibroblasts as a wild-type control (WT).

[0175] 7. After completing step 6, recover the PCR amplification product and sequence it.

[0176] The sequencing results of wild-type porcine primary fibroblasts are considered wild-type. If the sequencing results of a single-cell clone show an A / G overlap peak at the HBB-28 locus and other loci are consistent with the wild type, the genotype of the single-cell clone is a heterozygous mutant type;

[0177] If the sequencing result of a single cell clone shows a single G peak at the HBB-28 site and other sites are consistent with the wild type, the genotype of the single cell clone is a homozygous mutant.

[0178] A total of 139 single-cell clones were obtained. After identification, 36 of them were heterozygous target mutation clones and 15 were homozygous target mutation clones. The editing efficiency of the HBB target mutation (-28A>G) (including heterozygous mutations and homozygous mutations at the target site) was (36+15) / 139=36.7%, of which the homozygous editing efficiency was 15 / 139=10.8%.

[0179] Exemplary sequencing comparison results are shown in Figure 1-Figure 3 shown.

[0180] Example 3: Cloning and Production of Model Pigs

[0181] 1. Oocyte maturation in vitro

[0182] Fresh isolated porcine ovaries (ovaries from Duroc-Changda hybrid sows) were collected from the slaughterhouse, preserved in 0.9% sodium chloride solution containing 75 mg / mL penicillin and 50 mg / mL streptomycin, and transported to the laboratory at 25-30°C.

[0183] Ovaries were harvested and cumulus-oocyte complexes (COCs) were extracted from follicles 3 to 6 mm in diameter. COCs with at least three layers of dense cumulus cells were selected and seeded into 4-well plates. Each well contained 200 μl of porcine oocyte in vitro maturation medium, with 50 COCs seeded per well. Each transplant required 300-400 COCs. The plates containing the COCs were incubated in a 38.5°C, 5% CO2, and saturated humidity incubator for 42-44 hours.

[0184] Porcine oocyte in vitro maturation medium (IVM medium): contains 0.1 mg / mL pyruvate, 0.1 mg / mL cysteine ​​hydrochloride, 10 ng / mL epidermal growth factor, 10% (v / v) porcine follicular fluid, 75 mg / mL penicillin, 50 mg / mL streptomycin, 10 IU / mL eCG and 10 IU / mL hCG, with the balance being TCM-199 medium.

[0185] 2. Somatic Cell Nuclear Transfer and Embryo Transfer

[0186] (1) Somatic cell nuclear transfer (SCNT)

[0187] The nuclear donor cell is the mutant recombinant cell obtained in Example 2.

[0188] After completing step 1, the expanded cumulus cells of the COCs were removed by repeated pipetting with 0.1% (w / v) hyaluronidase. Oocytes with intact membranes and extruded first polar bodies were cultured in NCSU23 medium containing 0.1 mg / mL demeclocycline, 0.05 M sucrose, and 4 mg / mL bovine serum albumin for 0.5-1 h to induce oocyte nuclear protrusion. The protruding nuclei and polar bodies were then removed using a microinjection needle with a beveled tip (approximately 20 μm diameter) in Tyrode's lactate medium containing 10 μM HEPES, 0.3% (w / v) polyvinylpyrrolidone, 10% FBS, 0.1 mg / mL demeclocycline, and 5 mg / mL cytochalasin B. A single nuclear donor cell was injected into the perivitelline space of an enucleated oocyte. The donor cell and recipient oocyte were fused for 20 μs using an embryonic cell fusion instrument (ET3, Fujihira Industry) in fusion medium using a 200 V / mm direct current pulse. The reconstructed embryos were then cultured in PZM-3 medium (formula see Table 1) for 2 h to allow nuclear reprogramming and then activated with a single pulse of 150 V / mm for 100 μs in activation medium. The activated reconstructed embryos were then placed in PZM-3 medium supplemented with 5 μg / mL cytochalasin B for 2 h in an incubator at 38.5°C, 5% CO₂, 5% O₂, 90% N₂, and saturated humidity for further activation. The reconstructed embryos were then placed in PZM-3 medium in an incubator at 38.5°C, 5% CO₂, 5% O₂, 90% N₂, and saturated humidity. Most reconstructed embryos were ready for subsequent embryo transfer within 6 h of activation.

[0189] Fusion medium: contains 0.25M D-sorbitol, 0.05mM Mg(C2H3O2)2, 20mg / mL BSA and 0.5mM HEPES [acid-free], with the balance being water.

[0190] Activation medium: containing 0.25M D-sorbitol, 0.01mM Ca(C2H3O 2)2 , 0.05 mM MgCa(C2H3O2)2 and 0.1 mg / mL BSA, with the balance being water.

[0191] Table 1 Formulation of PZM-3 medium

[0192] Element g / 50mL 1 NaCl 0.3156g 2 KCl 0.0373g 3 <![CDATA[KH2PO4]]> 0.0024g 4 <![CDATA[MgSO4·7H2O]]> 0.0024g 5 <![CDATA[NaHCO3]]> 0.1055g 6 Na-pyruvate 0.0011g 7 <![CDATA[Ca-(lactate)2·5H2O]]> 0.0308g 8 Myo-Inositol 0.0250 9 Phenol Red (stock solution 10 mg / mL) 0.5mL stock solution 10 L-glutamine* 0.0073g 11 hypotaurine* 0.0273g 12 BME essential amino acid(50×)* 1mL 13 MEM non-essential amino acid(100×)* 0.5mL 14 Ultrapure water Make up to 50mL

[0193] Note: *Add before use

[0194] (2) Embryo transfer

[0195] Hybrid sow: A sow obtained by hybridizing a Large White pig (female) and a Landrace pig (male).

[0196] Six hybrid sows in estrus were selected as surrogate sows for the reconstructed embryos. The reconstructed embryos, activated and cultured for six hours, were transplanted into the oviducts of the surrogate sows, with 300-350 reconstructed embryos transferred to each sow. Approximately 23 days after embryo transfer, pregnancy was confirmed using an ultrasound scanner (HS-101V, Honda Electronics, Japan). Of the six surrogate sows, four became pregnant.

[0197] The cloned pigs were born around 116-117 days after embryo transfer.

[0198] The four successfully pregnant sows gave birth to a total of 16 cloned pigs, which are known as model pigs.

[0199] 3. Preparation of wild-type control pigs

[0200] Using primary porcine fibroblasts from the same source as the recombinant cells as nuclear donors in step 2, four cloned pigs were obtained, which became wild-type control pigs. The genetic background of the wild-type control pigs was identical to that of the model pigs, except for the lack of exogenous replacement DNA.

[0201] Example 4: Physiological, pathological and phenotypic characteristics of model pigs

[0202] 1. Hematological parameter testing

[0203] The peripheral anticoagulated blood of the pigs in the model group and the control group was collected, and the blood routine and blood biochemistry tests were performed using an animal blood routine analyzer (IDEX) and an animal blood biochemistry analyzer (IDEX).

[0204] Routine blood test: focus on anemia-related indicators such as RBC (red blood cell count), HGB (hemoglobin concentration), HCT (hematocrit), MCV (mean corpuscular volume), MCH (mean hemoglobin content), RDW (red blood cell distribution width), PLT (platelet count), WBC (white blood cell count), and LYM (lymphocytes).

[0205] Blood biochemistry: focus on hemolytic indicators such as TBIL (total bilirubin) and LDH (lactate dehydrogenase).

[0206] like Figure 4 As shown in the data, the RBC, HGB, HCT, MCV, and MCH in the model group were significantly lower than those in the control group, while the RDW, PLT, WBC, and LYM in the model group were significantly higher than those in the control group.

[0207] like Figure 5 As shown in the figure, TBIL and LDH in the blood biochemical indicators of the model group were significantly higher than those of the control group.

[0208] 2. Organ weight coefficient detection

[0209] The pigs in the model group and the control group were anesthetized and then killed. The hearts and spleens were taken out and weighed, and the weight coefficients of the organs were calculated.

[0210] Organ weight coefficient = (organ weight / body weight) × 100%.

[0211] like Figure 6 As shown in the figure, the spleen weight coefficient and heart weight coefficient of the model group were significantly increased compared with the control group.

[0212] Figure 7 Shown are comparison images of the hearts of the model group and the control group.

[0213] Figure 8 Shown are comparison images of the spleens of the model group and the control group.

[0214] 3. Detection of HBB expression level

[0215] qPCR primers were designed to detect porcine HBB and β-actin mRNA, and the expression levels of HBB mRNA in blood cells of pigs in the model and control groups were measured. The primer sequences are shown in Table 2.

[0216] Table 2 qPCR primer sequences for porcine HBB and β-actin

[0217]

[0218] like Figure 9 As shown in the figure, the mRNA expression level of HBB in blood cells in the model group was significantly decreased compared with the control group.

[0219] Regarding the detection of HBB protein expression levels, since there is currently no suitable commercial antibody for porcine HBB protein, after multiple attempts, the expression level of the protein could not be detected due to the species differences of the antibodies.

[0220] Example 5: Gene repair scheme and repair effect based on Prime Editing technology system

[0221] 1. Isolation, purification, and culture of CD34+ hematopoietic stem cells

[0222] When the sows give birth, the umbilical cord blood of β-thalassemia pigs is collected using a collection tube with anticoagulant, and then CD34+ hematopoietic stem cells are isolated, purified and expanded in vitro.

[0223] 1. Collection of umbilical cord blood

[0224] (1) After the piglets are born, wipe off the mucus on their body surface.

[0225] (2) Gently squeeze the umbilical cord blood into the collection tube along the umbilical cord and shake it slightly to allow the anticoagulant to fully contact the blood. After collection, tie the umbilical cord with a thin rope 3-4 cm from the base of the umbilical cord and cut it 5-6 cm from the base of the umbilical cord. Disinfect it with iodine tincture and place the piglet in an incubator.

[0226] 2. Pretreatment (removal of red blood cells and plasma)

[0227] (1) Hydroxyethyl starch (HES) sedimentation method:

[0228] Add 6% HES solution to umbilical cord blood at a ratio of 1:4, mix well, and let stand for 30-45 minutes (4°C). Aspirate the upper layer of leukocyte-rich suspension and centrifuge (400×g, 10 minutes) to collect the cell pellet.

[0229] 3. Isolation and purification of CD34+ hematopoietic stem cells (HSC)

[0230] The cell pellet was resuspended in fresh culture medium and incubated with mouse anti-porcine CD34 monoclonal antibody (Kingfisher Biotech, Cat#: VS3-FX105) (final antibody concentration was 1:200 dilution multiple), and CD34+ hematopoietic stem cells were separated by flow cytometry.

[0231] 4. In vitro culture and expansion of CD34+ hematopoietic stem cells

[0232] (1) Culture medium formulation

[0233] The basal medium was serum-free medium (StemSpan TM SFEM II), followed by the following components (final concentrations): penicillin / streptomycin (1%), L-glutamine (2 mM), cytokine combination (SCF (50 ng / mL), TPO (50 ng / mL), FLT3-L (50 ng / mL), IL-6 (20 ng / mL)).

[0234] (2) Cell culture conditions, freezing and thawing

[0235] Culture conditions: The initial cell density was 1×10 5 cells / mL; cultured in 6-well plates with low adsorption properties (to reduce cell attachment loss). Culture conditions: 37°C, 5% CO2, 5% O2, 95% humidity, with half the medium replaced every 2-3 days. Count cells daily and monitor expansion to maintain a density ≤ 2 × 10 6cells / mL (avoid overcrowding). At the same time, the small molecule inhibitor UM171 (35nM) was added to inhibit differentiation and maintain stem cell stemness, and SR1 (StemRegenin 1, 0.75μM) was added to antagonize the AHR pathway and promote the self-renewal of CD34+ hematopoietic stem cells.

[0236] Cell cryopreservation: Select a serum-free cryopreservation medium ( CS10). The cell pellet was suspended in freezing solution, divided into cryovials, programmed to cool (-1°C / min to -80°C), and transferred to liquid nitrogen after 24 hours.

[0237] Cell recovery: Thaw quickly (37°C water bath, 1-2 min), add pre-warmed culture medium, centrifuge (300×g, 5 min) to remove the freezing solution, and resuspend in fresh culture medium.

[0238] 2. Repair of HBB mutation gene in CD34+ hematopoietic stem cells based on the Prime Editing system

[0239] 1. pegRNA sequence design and vector construction

[0240] To repair the HBB defect mutation (-28A>G) in β-thalassemia pigs, four pegRNAs were designed using the online tool PREDICT (https: / / pridict.it) to find the pegRNA with the highest editing efficiency.

[0241] The pegRNA1 sequence is: (SEQ ID NO: 11):

[0242] 5'-GAGCAAATGTAGGTGGCTGCGTTTCAGAGCTATGCTGGAAACAGCA TAGCAAGTTGAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCG AGTCGGTGCAGGAGGCTGGGGGGGCATAaAAGGAAGAGCAGAGCCAGCA GCCACCTACATTT-3'

[0243] The pegRNA2 sequence is: (SEQ ID NO: 12)

[0244] 5'-GAGCAAATGTAGGTGGCTGCGTTTCAGAGCTATGCTGGAAACAGCA TAGCAAGTTGAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCG AGTCGGTGCAGGAGGCTGGGGGGGCATAaAAGGAAGAGCAGAGCCAGCA GCCACCTACATTTG-3'

[0245] The pegRNA3 sequence is: (SEQ ID NO: 13)

[0246] 5'-GAGCAAATGTAGGTGGCTGCGTTTCAGAGCTATGCTGGAAACAGCA TAGCAAGTTGAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCG AGTCGGTGCAGGAGGCTGGGGGGGCATAaAAGGAAGAGCAGAGCCAGCA GCCACCTACATT-3'

[0247] The pegRNA4 sequence is: (SEQ ID NO: 14)

[0248] 5'-GAGCAAATGTAGGTGGCTGCGTTTCAGAGCTATGCTGGAAACAGCA TAGCAAGTTGAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCG AGTCGGTGCAGGAGGCTGGGGGGGCATAaAAGGAAGAGCAGAGCCAGCA GCCACCTACAT-3'

[0249] The target sequence (spacer), position binding sequence (PBS), reverse transcription template (RT template, RTT) and other related element sequences of different pegRNAs are shown in Table 3.

[0250] Table 3 pegRNA component sequences

[0251]

[0252] Four pegRNA sequences were synthesized by full gene synthesis. The pU6-pegRNA-GG-acceptor-0 vector (SEQ ID NO: 15) was taken and digested with the restriction endonuclease BsaI to recover the vector backbone (a large linear fragment of approximately 2.2 kb). The four pegRNA sequences were then cloned into the pU6-pegRNA-GG-acceptor-0 vector to obtain the recombinant pU6-pegRNA-GG-acceptor vector.

[0253] SEQ ID NO:15

[0254]

[0255] 2. Co-transfection of porcine CD34+ hematopoietic stem cells to explore the editing efficiency of pegRNA

[0256] The pCMV-PE2 vector (a commercial plasmid (Addgene, Cat#: 132775)) and the pU6-pegRNA-GG-acceptor vector containing different pegRNAs were respectively delivered in a molar ratio of 1:3, with a total amount of 2 μg, to the in vitro cultured umbilical cord blood CD34+ hematopoietic stem cells of β-thalassemia pigs by electroporation, and three replicate groups were set up.

[0257] Four pegRNA target vectors, pU6-pegRNA-GG-acceptor, were co-transfected with pCMV-PE2 vectors into porcine CD34+ hematopoietic stem cells. The ratio was: 200,000 β-thalassemia pig CD34+ hematopoietic stem cells: 0.83 μg pU6-pegRNA-GG-acceptor: 1.17 μg pCMV-PE2.

[0258] The method for transfecting porcine CD34+ hematopoietic stem cells was performed according to the procedure described in Example 2, and the electroporation parameters were set to: 1550 V, 10 ms, 3 pulses.

[0259] 3. Mutation gene repair efficiency

[0260] Collect the edited CD34+ cell population, extract genomic DNA, prepare the HBB gene target site second-generation sequencing library, perform high-throughput sequencing, and calculate the HBB gene repair efficiency under different pegRNA editing systems by analyzing the sequencing results;

[0261] After analysis, the HBB gene repair efficiency of CD34+ population cells was 16.87%±1.63% (pegRNA1), 3.65%±0.83% (pegRNA2), 9.23%±1.44% (pegRNA3), and 5.69%±1.02% (pegRNA4), respectively.

[0262] 4. Effect of gene repair on β-thalassemia pigs

[0263] A group of cells with the highest HBB gene repair efficiency, namely the pegRNA1 group, was selected and injected back into the β-thalassemia pigs through intravenous injection. 48 hours after the injection, venous blood was collected from the cloned pigs to measure blood routine, blood biochemistry and HBB expression levels in blood cells, and the results were analyzed.

[0264] 1. Blood routine test results

[0265] Pig blood routine results Figure 10 As shown in the figure, all blood routine related indicators in the repair group recovered better than those in the model group.

[0266] 2. Blood biochemistry results

[0267] Pig blood biochemical results Figure 11 As shown in the figure, all blood biochemical indicators in the repair group recovered better than those in the model group.

[0268] 3. HBB expression results

[0269] The expression level of HBB in pig blood cells is as follows Figure 12 As shown in the figure, the expression level of HBB in blood cells of the repair group increased significantly compared with that of the model group.

[0270] Finally, it should be noted that the above descriptions are merely preferred embodiments of the present invention and are not intended to limit the present invention. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art will be able to modify the technical solutions described in the aforementioned embodiments or substitute equivalents for some of the technical features. Any modifications, equivalent substitutions, and improvements made within the spirit and principles of the present invention shall be included within the scope of protection of the present invention.

Claims

1. A method for preparing a recombinant cell, comprising the following steps: S1: HBB-T7-gU1, HBB-T7-gD1, HBB-28mut-ss111 and NCN protein were co-transfected into porcine primary fibroblasts to obtain recombinant porcine fibroblasts; S2: The ratios of porcine primary fibroblasts, HBB-T7-gU1, HBB-T7-gD1, HBB-28mut-ss111, and NCN protein are as follows: 100,000 porcine primary fibroblasts: 1 μg HBB-T7-gU1: 1 μg HBB-T7-gD1: 2 μg HBB-28mut-ss111: 4 μg NCN protein; The HBB-T7-gU1 is an sgRNA, and its target sequence binding region is shown in nucleotides 3-22 of SEQ ID NO: 8; the HBB-T7-gD1 is an sgRNA, and its target sequence binding region is shown in nucleotides 3-22 of SEQ ID NO: 9; the HBB-28mut-ss111 is a donor DNA, and its sequence is shown in SEQ ID NO: 10; S3: Umbilical cord blood from β-thalassemia pigs was collected using a collection tube with anticoagulant, and CD34+ hematopoietic stem cells were isolated, purified, and expanded in vitro; S4: Repair of HBB mutation gene in β-thalassemia pig CD34+ hematopoietic stem cells based on Prime Editing system; The Prime Editing system includes a pegRNA target vector pU6-pegRNA-GG-acceptor and a pCMV-PE2 vector; The pegRNA target vector pU6-pegRNA-GG-acceptor and pCMV-PE2 vector were co-transfected into β-thalassemia pig CD34+ hematopoietic stem cells; Ratio: 200,000 β-thalassemia pig CD34+ hematopoietic stem cells: 0.83μg pU6-pegRNA-GG-acceptor: 1.17μg pCMV-PE2; The pegRNA target vector pU6-pegRNA-GG-acceptor is a pegRNA expression vector, which expresses the pegRNA shown in SEQ ID NO.11-14, and the vector backbone of the expression vector is pU6-pegRNA-GG-acceptor-0, and the full plasmid sequence is shown in SEQ ID NO:15; The pegRNA target vector pU6-pegRNA-GG-acceptor is an expression vector obtained by inserting the pegRNA sequence shown in SEQ ID NO.11-14 into the vector backbone pU6-pegRNA-GG-acceptor-0; S5: Collect the edited CD34+ cell population, extract genomic DNA, prepare the HBB gene target site second-generation sequencing library, sequence it using high-throughput sequencing technology, analyze the sequencing results, and calculate the HBB mutant gene repair efficiency.

2. A kit comprising the HBB-T7-gU1, HBB-T7-gD1, HBB-28mut-ss111 and NCN protein according to claim 1; The ratios of HBB-T7-gU1, HBB-T7-gD1, HBB-28mut-ss111 and NCN protein are: 1 μg HBB-T7-gU1: 1 μg HBB-T7-gD1: 2 μg HBB-28mut-ss111: 4 μg NCN protein.

3. A kit comprising the pegRNA target vector pU6-pegRNA-GG-acceptor and the pCMV-PE2 vector according to claim 1; The ratio of pegRNA target vector pU6-pegRNA-GG-acceptor and pCMV-PE2 vector is: 0.83μg pU6-pegRNA-GG-acceptor: 1.17μg pCMV-PE2.

4. The use of the kit according to claim 2 is as follows (a) or (b) or (c): (a) preparing recombinant porcine fibroblasts; (b) preparing a β-thalassemia model pig; (c) Preparing a β-thalassemia cell model, a β-thalassemia tissue model, or a β-thalassemia organ model.

5. The use of the kit according to claim 3 is to prepare CD34+ hematopoietic stem cells with repaired HBB mutation gene.

6. The recombinant porcine fibroblasts prepared according to the method of claim 1.

7. Use of the recombinant porcine fibroblasts according to claim 6 in preparing a β-thalassemia model pig.

8. Pig tissues, pig organs or pig cells of a β-thalassemia model pig prepared using the recombinant porcine fibroblasts according to claim 6.

9. Uses of the recombinant porcine fibroblasts according to claim 6, the porcine tissue according to claim 8, the porcine organ according to claim 8, the porcine cells according to claim 8, or the β-thalassemia model pig prepared using the recombinant porcine fibroblasts according to claim 6, including screening drugs for treating β-thalassemia, evaluating the efficacy of β-thalassemia drugs, evaluating the efficacy of gene therapy and cell therapy for β-thalassemia, and studying the pathogenesis of β-thalassemia.

10. CD34+ hematopoietic stem cells with repaired HBB mutation gene prepared by the method according to claim 1.

11. Use of the CD34+ hematopoietic stem cells with repaired HBB mutation gene according to claim 10 in repairing β-thalassemia model pigs.

Images