Beta-carotene production engineering bacterium as well as construction method and application thereof
By integrating genes related to the β-carotene synthesis pathway into the Yarrowia lipolytica strain and utilizing the peroxisome localization signal peptide, a dual-compartment synthesis system for β-carotene was constructed, solving the problem of insufficient yield and achieving efficient production.
Patent Information
- Application Number
- CN202510831290.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-06-20
- Publication Date
- 2025-09-12
AI Technical Summary
The yield of β-carotene produced by Yarrowia lipolytica in the existing technology is insufficient to meet industrial demand.
The genes related to the β-carotene synthesis pathway are integrated into the genome of the Yarrowia lipolytica strain and expressed in the peroxisome through a peroxisome localization signal peptide. Combined with the cytoplasmic synthesis pathway, a dual compartment for β-carotene synthesis is formed to increase yield.
It effectively increases the production of beta-carotene and reduces the adverse effects of the product on cells without affecting the normal growth of cells.
Smart Images

Figure BDA0005459436980000171 
Figure BDA0005459436980000172 
Figure BDA0005459436980000201
Abstract
Description
Technical Field
[0001] The present invention relates to the field of biotechnology, and in particular to an engineering bacterium for producing beta-carotene, a construction method and an application thereof. Background Art
[0002] β-carotene (C 40 H 56 β-carotene is an important carotenoid, not only a commonly used colorant but also widely used in food, medicine, cosmetics, and animal husbandry due to its various powerful physiological functions (such as being a safe source of vitamin A in the human body, providing antioxidant properties, enhancing immunity, and protecting vision). Currently, the main sources include chemical synthesis, plant extraction, and microbial synthesis. Microbial synthesis, as an effective synthetic method, is not restricted by time, location, or environmental conditions in actual production, resulting in products with higher safety and physiological activity. Consequently, a growing number of studies are beginning to utilize microorganisms such as Escherichia coli, Saccharomyces cerevisiae, and Yarrowia lipolytica for the biosynthesis of β-carotene.
[0003] Yarrowia lipolytica is an unconventional yeast. Although it lacks an endogenous β-carotene biosynthesis pathway, its abundant intracellular acetyl-CoA, NADPH, and ATP, along with its accumulation of lipids, provide ample precursors and storage space for the synthesis of hydrophobic β-carotene, making it an ideal host for β-carotene production. However, current research focuses on the regulation of related metabolic pathways within the cytoplasm, which to some extent limits the ability of Yarrowia lipolytica to produce β-carotene. For example, by introducing exogenous genes (the lycopene dehydrogenase gene carB, the lycopene cyclase and lycopene synthase genes carRP, and the geranylgeranyl pyrophosphate (GGPP) synthase gene crtE) into Yarrowia lipolytica, β-carotene synthesis can be achieved, but the yield still cannot meet industrial production requirements and needs to be further improved. Summary of the Invention
[0004] The present invention aims to provide an engineered Yarrowia lipolytica strain capable of producing high-beta-carotene yield and its application in order to address the defects of the prior art such as low beta-carotene yield.
[0005] Solutions for solving problems
[0006] In a first aspect, the present invention provides a genetically engineered bacterium for producing β-carotene, using the Yarrowia lipolytica strain as a starting strain, into whose genome genes related to the β-carotene synthesis pathway are integrated;
[0007] Among them, genes related to the β-carotene biosynthesis pathway include MvaS, MvaE, ERG12, ERG8, ERG19, IDI, ERG20, GGPPs7, CarRP, and CarB;
[0008] The beta-carotene synthesis pathway related gene is expressed in the peroxisome through the peroxisome localization signal peptide.
[0009] Preferably, the MvaS and MvaE genes are derived from Enterococcus faecalis; the ERG12 gene is derived from Saccharomyces cerevisiae;
[0010] Preferably, the MvaS gene is a mutant gene, wherein the 110th alanine encoded by the wild-type MvaS gene is mutated to glycine. The nucleotide sequence of the MvaS gene is shown in SEQ ID NO. 45, or a degenerate sequence thereof.
[0011] Preferably, the nucleotide sequence of the MvaE gene is as shown in SEQ ID NO. 46, or a degenerate sequence thereof.
[0012] Preferably, the nucleotide sequence of the ERG12 gene is as shown in SEQ ID NO. 44, or a degenerate sequence thereof.
[0013] Preferably, the MvaS and MvaE gene insertion sites are the AXP sites of the Yarrowia lipolytica genome;
[0014] The GGPPs7, CarRP and CarB gene insertion sites are the D17 sites of the Yarrowia lipolytica strain Yarrowialipolytica genome;
[0015] The IDI and ERG20 gene insertion sites are the GUT2 sites of the Yarrowia lipolytica genome;
[0016] The ERG12, ERG8 and ERG19 gene insertion sites are the MYH1 sites of the Yarrowia lipolytica strain Yarrowialipolytica genome.
[0017] Preferably, the localization signal peptide is fused to the C-terminus of the gene expression product related to the β-carotene synthesis pathway;
[0018] Preferably, the localization signal peptide is selected from SKL or CRMVGKSKL.
[0019] Preferably, the genome of the virus also contains the key genes ERG20, GGPPs7, CarRP and CarB for synthesizing β-carotene in the cytoplasm.
[0020] Preferably, the GGPPs7 gene is derived from Synechococcus sp.; the CarRP and CarB genes are derived from Mucor circinelloides; and the ERG8, ERG19, IDI and ERG20 genes are endogenous genes.
[0021] Preferably, the ERG20 gene is a mutant gene, wherein the phenylalanine at position 87 encoded by the wild-type ERG20 gene is mutated to serine. The nucleotide sequence of the ERG20 gene is shown in SEQ ID NO. 50, or a degenerate sequence thereof.
[0022] Preferably, the CarRP gene is a mutant gene, wherein the tyrosine at position 27 of the wild-type CarRP encoding gene is mutated to arginine, and the nucleotide sequence of the CarRP gene is shown in SEQ ID NO. 48, or a degenerate sequence thereof.
[0023] Preferably, the nucleotide sequence of the GGPPs7 gene is as shown in SEQ ID NO.47, or its degenerate sequence.
[0024] Preferably, the nucleotide sequence of the CarB gene is as shown in SEQ ID NO. 49, or a degenerate sequence thereof.
[0025] Preferably, the insertion site of the key gene GGPPs7 for synthesizing β-carotene in the cytoplasm is the intC-1 site of the genome of the Yarrowia lipolytica strain;
[0026] The insertion site of ERG20, a key gene for β-carotene synthesis in the cytoplasm, is the intE-1 site of the genome of the yeast strain Yarrowia lipolytica;
[0027] The insertion sites of CarRP and CarB, the key genes for β-carotene synthesis in the cytoplasm, are at the intC-2 site of the genome of the yeast Yarrowia lipolytica.
[0028] Preferably, the starting strain is Yarrowia lipolytica PO1fΔKU70-ΔKU80::CrtE+CarB+CarRP Y27R +LEU2-ΔA08::RAD52.
[0029] In a second aspect of the present invention, there is provided a use of any of the above-mentioned genetically engineered bacteria in the production of β-carotene.
[0030] In a third aspect of the present invention, a method for producing β-carotene is provided, comprising:
[0031] (1) fermenting and culturing any one of the genetically engineered bacteria described above to obtain a fermentation product;
[0032] (2) extracting the fermentation product with an organic solvent to collect β-carotene.
[0033] Effects of the Invention
[0034] The present invention introduces the MVA pathway and the β-carotene synthesis pathway into the peroxisome of the Yarrowia lipolytica strain to achieve enzyme overexpression. Specifically, the present invention fuses peroxidase localization signal peptides to the C-termini of enzymes including MvaS, MvaE, ERG12, ERG8, ERG19, IDI, ERG20, GGPPs7, CarRP and CarB, thereby completely introducing the MVA pathway and the β-carotene synthesis pathway into the peroxisome, forming a compartment for β-carotene synthesis, effectively increasing the β-carotene yield, and simultaneously reducing the adverse effects of product accumulation on cells, without affecting cell growth. BRIEF DESCRIPTION OF THE DRAWINGS
[0035] Figure 1 Schematic diagram of the structure of the MHY1 site knockout plasmid, wherein the sequence of MHY1 N20-1 is GGTGGTGGACTCCCACAGAC (SEQ ID NO. 2); the sequence of MHY1 N20-2 is CCTTTCAACTGCGACACGTG (SEQ ID NO. 3);
[0036] Figure 2This is a schematic diagram of the structure of the pUC19-△MHY1::ERG12(SKL)+ERG8(SKL)+ERG19(SKL) recombinant plasmid, which is used to insert the genes ERG12(SKL), ERG8(SKL), and ERG19(SKL) into the MHY1 locus of the yeast genome. MHY1-HL represents the upstream homology arm of the MHY1 locus, MHY1-HR represents the downstream homology arm of the MHY1 locus, pTEFin represents the promoter TEFin, pGPD represents the promoter GPD, pEXP represents the promoter EXP, tXPR2 represents the terminator XPR2, tLip2 represents the terminator Lip2, tMigl represents the terminator Migl, ERG12 represents the gene encoding mevalonate kinase (Saccharomyces cerevisiae is selected in the present invention), ERG8 is the gene encoding phosphomevalonate kinase, ERG19 is the gene encoding pyrophosphomevalonate decarboxylase, and SKL is the peroxisome localization signal peptide. DETAILED DESCRIPTION
[0037] To make the technical solutions and beneficial effects of the present invention more clearly understood, the following detailed description is given by way of specific embodiments. The accompanying drawings are not necessarily drawn to scale, and local features may be enlarged or reduced to more clearly illustrate the details of the local features. Unless otherwise defined, the technical and scientific terms used herein have the same meanings as those in the technical field to which this application belongs.
[0038] After extensive and in-depth research, the present invention uses the Yarrowia lipolytica strain PO1f0002 constructed by the applicant as the starting strain (the strain and construction method are described in Chinese patent application No. 2024107357530). Using CRISPR / Cas9 technology, the genes for enzymes related to the MVA pathway and the β-carotene synthesis pathway are integrated into the genome to achieve overexpression of the enzymes. Among them, the C-terminus of some enzymes carries a peroxisomal localization signal peptide, thereby achieving dual-compartmental synthesis of β-carotene in the cytoplasm and peroxisomes using glucose as a carbon source, thereby improving the β-carotene synthesis capacity of the engineered strain without affecting normal cell growth.
[0039] In a first aspect, the present invention provides a genetically engineered bacterium for producing β-carotene, using the Yarrowia lipolytica strain as a starting strain, into whose genome genes related to the β-carotene synthesis pathway are integrated;
[0040] Among them, genes related to the β-carotene biosynthesis pathway include MvaS, MvaE, ERG12, ERG8, ERG19, IDI, ERG20, GGPPs7, CarRP, and CarB;
[0041] The beta-carotene synthesis pathway related gene is expressed in the peroxisome through the peroxisome localization signal peptide.
[0042] In another preferred embodiment, the MvaS and MvaE genes are derived from Enterococcus faecalis; the ERG12 gene is derived from Saccharomyces cerevisiae;
[0043] In another preferred embodiment, the MvaS gene is a mutant gene, wherein the 110th alanine encoded by the wild-type MvaS gene is mutated to glycine. The nucleotide sequence of the MvaS gene is shown in SEQ ID NO. 45, or a degenerate sequence thereof.
[0044] SEQ ID NO.45: MvaS A110G [Enterococcus faecalis]
[0045]
[0046] In another preferred embodiment, the nucleotide sequence of the MvaE gene is as shown in SEQ ID NO. 46, or a degenerate sequence thereof.
[0047] SEQ ID NO.46: MvaE[Enterococcus faecalis]
[0048]
[0049] In another preferred embodiment, the nucleotide sequence of the ERG12 gene is as shown in SEQ ID NO. 44, or a degenerate sequence thereof.
[0050] SEQ ID NO.44: ERG12[Saccharomyces cerevisiae]
[0051]
[0052] In another preferred embodiment, the MvaS and MvaE gene insertion sites are the AXP sites of the Yarrowia lipolytica genome;
[0053] The GGPPs7, CarRP and CarB gene insertion sites are the D17 sites of the Yarrowia lipolytica strain Yarrowialipolytica genome;
[0054] The IDI and ERG20 gene insertion sites are the GUT2 sites of the Yarrowia lipolytica genome;
[0055] The ERG12, ERG8 and ERG19 gene insertion sites are the MYH1 sites of the Yarrowia lipolytica strain Yarrowialipolytica genome.
[0056] In a specific and preferred example, MvaS A110G (SKL), MvaE(SKL) were sequentially integrated into the AXP site of the Yarrowia lipolytica strain.
[0057] In a specific and preferred example, ERG12 (SKL), ERG8 (SKL), and ERG19 (SKL) are sequentially integrated into the MHY1 site of the Yarrowia lipolytica strain.
[0058] In a specific and preferred example, IDI (SKL), ERG20 F87S (SKL) were sequentially integrated in tandem into the GUT2 locus of the Yarrowia lipolytica strain.
[0059] In a specific and preferred example, GGPPs7 (SKL), CarRP Y27R (SKL), CarB(SKL) were sequentially integrated into the D17 site of the Yarrowia lipolytica strain.
[0060] In another preferred embodiment, the localization signal peptide is fused to the C-terminus of the gene expression product related to the β-carotene synthesis pathway;
[0061] In another preferred embodiment, the localization signal peptide is selected from SKL or CRMVGKSKL.
[0062] In another preferred embodiment, the genome of the strain is also integrated with the key genes ERG20, GGPPs7, CarRP and CarB for synthesizing β-carotene in the cytoplasm.
[0063] In another preferred embodiment, the GGPPs7 gene is derived from the cyanobacterium Synechococcus sp.; the CarRP and CarB genes are derived from Mucor circinelloides;
[0064] In another preferred embodiment, the CarRP gene is a mutant gene, wherein the tyrosine at position 27 encoded by the wild-type CarRP gene is mutated to arginine. The nucleotide sequence of the CarRP gene is shown in SEQ ID NO. 48, or a degenerate sequence thereof.
[0065] SEQ ID NO.48: CarRP Y27R [Mucor circinelloides]
[0066]
[0067] In another preferred embodiment, the nucleotide sequence of the GGPPs7 gene is as shown in SEQ ID NO. 47, or a degenerate sequence thereof.
[0068] SEQ ID NO.47: GGPPs7[Synechococcus sp.]
[0069] ATGGTCGCACAAACTTTCAACCTGGATACCTACTTATCCCAAAGACAACAACAAGTTGAAGAGGCCCTAAGTGCTGCTCTTGTGCCAGCTTATCCTGAGAGAATATACGAAGCTATGAGATACTCCCTCCTGGCAGGTGGCAAAAGATTAAGACCTATCTTATGTTTAGCTGCTTGCGAATTGGCAGGTGGTTCTGTTGAACAAGCCATGCCAACTGCGTGTGCACTTGAAATGATCCATACAATGTCACTAATTCATGATGACCTGCCAGCCATGGATAACGATGATTTCAGAAGAGGAAAGCCAACTAATCACAAGGTGTTCGGGGAAGATATAGCCATCTTAGCGGGTGATGCGCTTTTAGCTTACGCTTTTGAACATATTGCTTCTCAAACAAGAGGAGTACCACCTCAATTGGTGCTACAAGTTATTGCTAGAATCGGACACGCCGTTGCTGCAACAGGCCTCGTTGGAGGCCAAGTCGTAGACCTTGAATCTGAAGGTAAAGCTATTTCCTTAGAAACATTGGAGTATATTCACTCACATAAGACTGGAGCCTTGCTGGAAGCATCAGTTGTCTCAGGCGGTATTCTCGCAGGGGCAGATGAAGAGCTTTTGGCCAGATTGTCTCATTACGCTAGAGATATAGGCTTGGCTTTTCAAATCGTCGATGATATCCTGGATGTTACTGCTACATCTGAACAGTTGGGGAAAACCGCTGGTAAAGACCAGGCAGCCGCAAAGGCAACTTATCCAAGTCTATTGGGTTTAGAAGCCTCTAGACAGAAAGCGGAAGAGTTGATTCAATCTGCTAAGGAAGCCTTAAGACCTTACGGTTCACAAGCAGAGCCACTCCTAGCGCTGGCAGACTTCATCACACGTCGTCAGCATTAA
[0070] In another preferred embodiment, the nucleotide sequence of the CarB gene is as shown in SEQ ID NO.49, or its degenerate sequence.
[0071] SEQ ID NO.49:CarB[Mucor circinelloides]
[0072]
[0073] In another preferred embodiment, the ERG8, ERG19, IDI and ERG20 genes are endogenous genes derived from Yarrowia lipolytica PO 1f.
[0074] In another preferred embodiment, the ERG20 gene is a mutant gene, wherein the phenylalanine at position 87 encoded by the wild-type ERG20 gene is mutated to serine. The nucleotide sequence of the ERG20 gene is shown in SEQ ID NO. 50, or a degenerate sequence thereof.
[0075] SEQ ID NO.50: ERG20[Yarrowia lipolytica]
[0076]
[0077] In another preferred embodiment, the insertion site of the key gene GGPPs7 for synthesizing β-carotene in the cytoplasm is the intC-1 site of the genome of the Yarrowia lipolytica strain;
[0078] The insertion site of ERG20, a key gene for β-carotene synthesis in the cytoplasm, is the intE-1 site of the genome of the yeast strain Yarrowia lipolytica;
[0079] The insertion site of the key genes CarRP and / or CarB for synthesizing β-carotene in the cytoplasm is the intC-2 site of the genome of the Yarrowia lipolytica strain.
[0080] In a preferred embodiment, CarRP is overexpressed in the cytoplasm. Y27R , CarB were sequentially integrated into the intC-2 site of the Yarrowia lipolytica strain.
[0081] In another preferred embodiment, the starting strain is Yarrowia lipolytica PO1fΔKU70-ΔKU80::CrtE+CarB+CarRP Y27R +LEU2-ΔA08::RAD52.
[0082] In the present invention, the starting strain of Yarrowia lipolytica is the strain PO1f0002 of Patent No. 2024107357530, and its genotype is PO1fΔKU70-ΔKU80::CrtE+CarB+CarRP Y27R +LEU2-ΔA08::RAD52.
[0083] According to the explanation in the "TIG Genetic Nomenclature Guide", "Δ" indicates gene deletion, followed by the name of the deleted gene, for example, ΔKU70 means the deletion of the KU70 gene; "::" indicates gene insertion, and the gene before "::" is broken due to the insertion of the gene after "::", for example, ΔA08::RAD52 means the insertion of the RAD52 gene at the A08 site.
[0084] The genotype is PO1fΔKU70-ΔKU80::CrtE+CarB+CarRP Y27R +LEU2-ΔA08::RAD52 refers to the knockout of KU70 and KU80 in Yarrowia lipolytica PO1f, and the integration of CrtE, CarB, and CarRP at the KU80 locus. Y27R As well as the tag gene LEU2, the RAD52 gene is integrated at the A08 site.
[0085] In another preferred embodiment, the CrtE gene is derived from Phaffia rhodozyma;
[0086] In another preferred embodiment, the CrtE gene has the nucleotide sequence shown in SEQ ID NO. 51, or a degenerate sequence thereof.
[0087] SEQ ID NO.51: crtE[Phaffia rhodozyma]
[0088]
[0089] In another preferred embodiment, the RAD52 gene is derived from Saccharomyces cerevisiae.
[0090] In another preferred embodiment, the RAD52 gene sequence is obtained through codon optimization, and the RAD52 gene has a nucleotide sequence shown in SEQ ID NO. 52, or a degenerate sequence thereof.
[0091] SEQ ID NO.52: RAD52[Saccharomyces cerevisiae]
[0092]
[0093] In the present application, the construction method of the recombinant vector carrying each gene expression cassette and the construction method of the recombinant strain refer to patent document 2024107357530.
[0094] In the present invention, the promoter of the expression cassette of each gene is selected from any one of pEXP, pTEFin, pGPD and pHp4d; and the terminator is selected from any one of tXPR2, tMigl, tCYC1T and tLip2.
[0095] In another preferred embodiment, the corresponding relationship between the promoter and terminator in the expression cassette of each gene and the target gene is conventionally selected in the art, for example, including but not limited to, using pHp4d promoter and tXPR2 terminator to overexpress MvaS with SKL tag fused at the 3' end. A110G Gene;
[0096] The pTEFin promoter and tLip2 terminator were used to overexpress the MvaE gene with an SKL tag fused to its 3' end;
[0097] The ERG12 gene with an SKL tag fused to its 3' end was overexpressed using the pTEFin promoter and tXPR2 terminator;
[0098] The pGPD promoter and tLip2 terminator were used to overexpress the ERG8 gene with an SKL tag fused to its 3' end;
[0099] The pEXP promoter and tMigl terminator were used to overexpress the ERG19 gene with an SKL tag fused to its 3' end;
[0100] The pHp4d promoter and tXPR2 terminator were used to overexpress the IDI gene with an SKL tag fused to its 3' end;
[0101] The pTEFin promoter and tMigl terminator were used to overexpress ERG20 fused with an SKL tag at its 3' end. F87S Gene;
[0102] The pHp4d promoter and tXPR2 terminator were used to overexpress the GGPPs7 gene with an SKL tag fused to its 3' end;
[0103] The pTEFin promoter and tLip2 terminator were used to overexpress CarRP with SKL tag fused at the 3' end. Y27R Gene;
[0104] The pGPD promoter and tMigl terminator were used to overexpress the CarB gene with an SKL tag fused to its 3' end;
[0105] Overexpression of CarRP in the cytoplasm using the pEXP promoter and tLip2 terminator Y27R Gene;
[0106] The pGPD promoter and tMigl terminator were used to overexpress the cytoplasmic CarB gene;
[0107] The pHp4d promoter and tXPR2 terminator were used to overexpress the cytoplasmic GGPPs7 gene;
[0108] Overexpression of ERG20 in the cytoplasm using the pTEFin promoter and tMigl terminator F87S Gene.
[0109] In a third aspect of the present invention, a method for constructing any of the above-mentioned genetically engineered bacteria is provided, the method comprising:
[0110] The nucleotide sequence of the peroxisome signal peptide SKL is separately and independently added to the 3' end of the MvaS, MvaE, ERG12, ERG8, ERG19, IDI, ERG20, GGPPs7, CarRP and / or CarB gene, so that the C-terminus of the protein encoded by the gene is fused with the signal peptide and integrated into the genome;
[0111] The key genes ERG20, GGPPs7, CarRP and CarB for β-carotene synthesis in the cytoplasm were integrated into the genome of the Yarrowia lipolytica strain.
[0112] The full-length sequences of the genes of the present invention or fragments thereof can generally be obtained by PCR amplification, recombination, or synthetic methods. For PCR amplification, primers can be designed based on the nucleotide sequences disclosed herein, particularly the open reading frame sequences, to amplify the relevant sequences. For longer sequences, two or more PCR amplifications can be performed, and the fragments amplified from each amplification can then be spliced together in the correct order.
[0113] In a fourth aspect of the present invention, there is provided use of any of the above-mentioned genetically engineered bacteria in producing β-carotene.
[0114] In a fifth aspect of the present invention, a method for producing β-carotene is provided, comprising:
[0115] (1) fermenting and culturing any one of the genetically engineered bacteria described above to obtain a fermentation product;
[0116] (2) extracting the fermentation product with an organic solvent to collect β-carotene.
[0117] The present invention will be further described below with reference to specific examples. It should be understood that these examples are intended to illustrate the present invention only and are not intended to limit the scope of the present invention. The experimental procedures in the following examples, for which specific conditions are not specified, were generally performed under conventional conditions, such as those described in Sam Brook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or according to the conditions recommended by the manufacturer. Unless otherwise indicated, percentages and parts are by weight.
[0118] General Materials and Methods
[0119] The main materials and methods involved in the following examples are as follows:
[0120] 1. Main culture medium
[0121] LB solid medium formula: 10 g / L peptone, 5 g / L yeast extract powder, 10 g / L sodium chloride, and 15 g / L agar powder.
[0122] LB liquid culture medium formula: 10 g / L peptone, 5 g / L yeast extract powder, 10 g / L sodium chloride.
[0123] YPD solid culture medium formula: glucose 20 g / L, yeast extract 10 g / L, peptone 20 g / L, agar 15 g / L.
[0124] YPD liquid culture medium formula: glucose 20 g / L, yeast extract 10 g / L, peptone 20 g / L.
[0125] SD-Ura nutrient-deficient medium formula: glucose 20 g / L, YNB 6.7 g / L, DO-Supplement-URA 0.77 g / L, agar 15 g / L.
[0126] Shake flask fermentation medium formula: 10 g / L yeast extract, 10 g / L peptone, 50 g / L glucose.
[0127] 2. β-carotene extraction method: The extraction and detection method of β-carotene is described in patent document 2024107357530, including:
[0128] a) Take a certain volume of fermentation broth and centrifuge it at 12000 rpm for 5 min.
[0129] b) Wash the bacterial pellet twice with pure water, resuspend in 600 μL of dimethyl sulfoxide (DMSO) preheated at 60°C, shake to mix, and incubate in a 60°C water bath for 5 min.
[0130] c) Add 600 μL of acetone and incubate in a 50°C water bath for 15 min (protect from light).
[0131] d) Centrifuge at 12000 rpm for 5 min and collect the supernatant.
[0132] e) Filter the organic phase through a 0.22 μm membrane filter and determine the β-carotene content (keep the sample away from light).
[0133] 3. β-carotene detection method:
[0134] The concentration of β-carotene was determined using a high performance liquid chromatography (HPLC) UV detector. The column was Acclaim TM C30HPLC column, ultraviolet absorption wavelength is 450nm, mobile phase is phase A 65% (acetonitrile), phase B 34.5% (methanol: ethyl acetate = 1:1), phase C 0.5% (200mM acetic acid), flow rate is 1.5ml / min, column temperature is 30℃, and detection time is 30min.
[0135] Example 1 Construction of recombinant plasmid
[0136] 1. Construction of pCRISPRyl-△MHY1 plasmid ( Figure 1 )
[0137] (1) The sequence information of the MHY1 gene was found on the Yarrowia lipolytica PO1f genome, the knockout position was determined, the N20 sequence (SEQ ID NO. 2 / 3) was selected, and primers were designed.
[0138] (2) Using the pCRISPRyl plasmid as a template, replace the N20 sequence of the MHY1 gene with that of the MHY1 gene by PCR. The specific method is as follows:
[0139] (2-1) Using the double N20 pCRISPRyl plasmid as a template and MHY1 N20 F / R as primers, PCR amplification was performed to obtain the N20 fragment of the MHY1 gene. The double N20 pCRISPRyl plasmid was constructed using the pCRISPRyl plasmid (addgene: 70007) as a template.
[0140] MHY1 N20 F: GTCGGCGCAGGTTGACCTGGTGGTGGACTCCCACAGACGTTTTAGAGCTAGAAATAGC (SEQ ID NO. 12);
[0141] MHY1 N20 R: TATTTCTAGCTCTAAAACCACGTGTCGCAGTTGAAAGGAGGTCAACCTGCGCCGACCC (SEQ ID NO. 13).
[0142] (2-2) Using the pCRISPRyl plasmid as a template and Cas9 F / R, AmpR F / R, and Marker F / R as primers, PCR amplification was performed to obtain the Cas9 fragment, AmpR fragment, and URA3 fragment of the plasmid.
[0143] Cas9 F (SEQ ID NO.14): CGCCACAATGGATAAGAAATACTCATTGGCCTGG
[0144] Cas9 R (SEQ ID NO.15): GGCTAGCTTACACCTTTCGC
[0145] AmpR F (SEQ ID NO. 16): AAAGGTGTAAGCTAGCCTCATGTAATTAGTTATGTCACGCTTACATTC
[0146] AmpR R (SEQ ID NO.17): AGGTCAACCTGCGCCGACCCGGAATCGAACCGGGGGMarker F (SEQ ID NO.18): GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGMarker R (SEQ ID NO.19): TTTCTTATCCATTGTGGCGCGCCTTTGAATGA
[0147] PCR amplification was performed using Vazyme's "2×Phanta Flash Master Mix (Dye Plus)". The amplification system and procedure are shown in Table 1:
[0148] Table 1
[0149] Components volume <![CDATA[ddH2O]]> Make up to 50 μL 2×Phanta Flash Master Mix(Dye Plus) 25 μL Upstream primer (10 μM) 2.0 μL Downstream primer (10 μM) 2.0 μL Template DNA XμL
[0150] Reaction conditions: Pre-denaturation at 98°C for 30 seconds, denaturation at 98°C for 10 seconds, annealing at X°C for 5 seconds, extension at 72°C for Y seconds (4-5 seconds / kb), and supplemental extension at 72°C for 1 minute, for 35 cycles. The annealing temperature (X) and extension time (Y) in this PCR protocol vary depending on the primers used and the length of the amplified fragment, and are generally selected or used in the appropriate amounts. The volume of template DNA used varies depending on the template concentration and is generally selected or used in the appropriate amounts, with a typical requirement of 100 ng of DNA template.
[0151] (2-3) The four fragments (with regions of homology between them) were seamlessly cloned and ligated using Vazyme's "ClonExpress Ultra One Step Cloning Kit V2." The fragments were then chemically transformed into DH5α competent cells, plated onto 50 μg / ml ampicillin-resistant LB plates, and cultured overnight at 37°C. The seamless cloning system and procedures are shown in Table 2:
[0152] Table 2
[0153]
[0154] Reaction conditions: 50°C, 30 min; cool to 4°C or immediately cool on ice.
[0155] (2-4) Single clones were selected for expansion and sequencing verification. The plasmid that successfully replaced the N20 sequence was considered a positive clone. The positive clone was selected for shake culture and plasmid extraction to obtain the pCRISPRyl-△MHY1 plasmid.
[0156] According to the plasmid construction method described above, pCRISPRyl-ΔAXP, pCRISPRyl-ΔGUT2, pCRISPRyl-ΔD17, pCRISPRyl-ΔintC-2, pCRISPRyl-ΔintC-1 and pCRISPRyl-ΔintE-1 were constructed, and specific N20 primers were designed and synthesized based on the selected N20 sequence (Table 3).
[0157] Table 3
[0158]
[0159] 2. Construction of pUC19-ΔMHY1::ERG12(SKL)+ERG8(SKL)+ERG19(SKL) plasmid ( Figure 2 )
[0160] 1) Using the Yarrowia lipolytica PO1f genome as a template, primers MHY1 HL F / R and MHY1 HR F / R were used to amplify the upstream and downstream homology arms of the MHY1 gene, and primers ERG8 F / R and ERG19 F / R were used to amplify the endogenous genes ERG8 and ERG19, respectively.
[0161] MHY1 HL F (SEQ ID NO.20): GCTGCTTGTTCGTACCTACGTATATC
[0162] MHY1 HL R(SEQ ID NO.21):TGGAATGCAAGACGGGAATTTCCAATTC
[0163] MHY1 HR F(SEQ ID NO.22):GTCGGACAATCTCGCCCAGCATATG
[0164] MHY1 HR R(SEQ ID NO.23):GTCATGAAGTCTCGGTCAGGAGAGAG
[0165] ERG8 F (SEQ ID NO.24):ATGACCACCTATTCGGCTCCGGG
[0166] ERG8 R (SEQ ID NO.25): CAGCTTGGACTTGAACCCCTTCTC
[0167] ERG19 F (SEQ ID NO.26): ATGATCCACCAGGCCTCCACCAC
[0168] ERG19 R (SEQ ID NO.27): CAGCTTGGACTTGCTGTTCTTCAG
[0169] 2) Using the Yarrowia lipolytica PO1f genome as a template, the promoters TEFin, GPD, EXP and the terminators XPR2, Lip2, and Migl were amplified using primers pTEFin F / R, pGPD F / R, pEXP F / R, tXPR2F / R, tLip2 F / R, and tMigl F / R, respectively.
[0170] pTEFin F (SEQ ID NO. 28): AGGGCGTCTGGAAGTCGACCAG
[0171] pTEFin R(SEQ ID NO.29): CTGCGGTTAGTACTGCAAAAAG
[0172] pGPD F (SEQ ID NO.30):GACGCAGTAGGATGTCCTGCAC
[0173] pGPD R (SEQ ID NO. 31): GTTGATTGTGTTTAATTCAAGAATG
[0174] pEXP F (SEQ ID NO.32): AAGGAGTTTGGCGCCCGTTTTTTC
[0175] pEXP R (SEQ ID NO. 33): TGTAGATATGTCTTGTGTGTAAGG
[0176] tXPR2 F (SEQ ID NO. 34): AGGGATCCAACTACGGAACTTGTG
[0177] tXPR2 R (SEQ ID NO.35):TCGGACACGGGCATCTCACTTGCG
[0178] tLip2 F (SEQ ID NO.36): ATCTAAGCTATTTATCACTCTTTAC
[0179] tLip2 R (SEQ ID NO.37): CCTCCACCTGTGTCAATCTTCTC
[0180] tMigl F (SEQ ID NO.38): ACACTGGCCGGTCGATAATTTAAC
[0181] tMigl R (SEQ ID NO.39):AAACCCAAAAGGGCCGAAGGCTGG
[0182] 3) The ERG12 gene from Saccharomyces cerevisiae was optimized according to the codon preference of Yarrowia lipolytica and synthesized by Suzhou Jinweizhi Biotechnology Co., Ltd. (SEQ ID NO. 44). The gene fragment was then amplified from ERG12F / R, and its nucleotide sequence is shown in SEQ ID NO. 44. ERG12 F (SEQ ID NO. 40): ATGTCTCTGCCCTTCCTGACCTC
[0183] ERG12 R (SEQ ID NO.41): CAGCTTGGAAGAGGTCCAGGGCAG
[0184] 4) The peroxisome localization signal peptide SKL (nucleotide sequence: 5′-TCCAAGCTG-3′) was linked to the 3′ end of the target genes ERG12, ERG8, and ERG19, respectively.
[0185] 5) Design and synthesize primers with homology arms for further PCR amplification of the target fragments, so that there are homology regions between the fragments for subsequent fragment recombination.
[0186] 6) Using the pUC19 plasmid as a template and primers pUC19 F / R, reverse PCR was performed to amplify the linearized pUC19 fragment.
[0187] pUC19 F (SEQ ID NO.42):TATGGTGCACTCTCAGTACAATC
[0188] pUC19 R (SEQ ID NO.43): CGCGCCGAGCTTGGCTCGAG
[0189] 7) The above fragments (there are homologous regions between the fragments) were seamlessly cloned and ligated, and the ligation products were transformed into DH5α competent cells, plated onto 50 μg / ml kanamycin-resistant LB solid plates, and cultured at 37°C overnight.
[0190] 8) Single clones were selected for expansion and sequencing verification. The plasmids successfully sequenced were designated as positive clones. Positive clones were selected for shake culture and plasmid extraction to obtain the pUC19-ΔMHY1::ERG12(SKL)+ERG8(SKL)+ERG19(SKL) plasmid.
[0191] The plasmid pUC19-ΔAXP::MvaS was constructed according to the above-described plasmid construction method. A110G (SKL)+MvaE(SKL), pUC19-ΔGUT2::IDI(SKL)+ERG20 F87S (SKL), pUC19-ΔD17::GGPPs7(SKL)+CarRP Y27R (SKL)+CarB(SKL), pUC19-ΔintC-2::CarRP Y27R +CarB, pUC19-ΔintC-1::GGPPs7, and pUC19-ΔintE-1::ERG20 F87S Based on the connected fragments, specific amplification primers with homology arms were designed and synthesized (Table 4). A110G and MvaE from Enterococcus faecalis (nucleotide sequences shown in SEQ ID NO.45 and SEQ ID NO.46), GGPPs7 Synechococcus sp. (nucleotide sequence shown in SEQ ID NO.47), CarRP Y27R The CarB and CarB genes are derived from Mucor circinelloides (nucleotide sequences shown in SEQ ID NO. 48 and SEQ ID NO. 49), and were optimized according to the codon preference of Yarrowia lipolytica. Synthesis was commissioned by Suzhou Jinweizhi Biotechnology Co., Ltd. The endogenous ERG20 gene was synthesized in the F87S mutant form (phenylalanine at position 87 was mutated to serine).
[0192] Table 4
[0193] Amplified fragment Amplification primers SEQ ID NO. AXP HL F GACAGTCATGCTATCAGAACAAC 53 AXP HL R ATCCGCAACGCACCACTCCAAAAC 54 AXP HR F CGCCGTTATCGCCCACCTTATTTG 55 AXP HR R AAGGCTCCACCTGGCGATCATGTTC 56 pHp4d F CCGCCGCCGCAAGGAATGGTGC 57 pHp4d R CGTGGATGTGTGTGGTTGTATGTG 58 GUT2 HL F GGAAAATAAGGTGAAGGATTGGCC 59 GUT2 HL R CCGGAGGAAGGAGCACAGATCTCC 60 GUT2 HR F ACGAGAGGACGTTCTGGCCGCC 61 GUT2 HR R CCGAAGCGTGTGATCTGCGGTAAG 62 D17HL F GCCAGATCAAACACTGCTCGCAG 63 D17HL R ACGAGCTATAATAGAGTACGTAGAAAC 64 D17HR F TGCGACAAGATCAACGAATACTGGC 65 D17HR R GAGTCAGTACCCACTAGGCCAG 66 intC-2HL F GTGCTCCAAACCACAAGTGCCG 67 intC-2HL R AGACCTACATTCGTCTGTTAGC 68 intC-2HR F GGGTCTAAGCTCATCGGAAAGAAC 69 intC-2HR R TAGGGATTCTTCAGACAAATCGAG 70 intC-1HL F CCGTTTGAGCACCACGGGCATG 71 intC-1HL R ATTCCTTGCGGCGGCGGTGGTATTTG 72 intC-1HR F GTGTCTCGCGTGGACATGTTATG 73 intC-1HR R GGTCTTGCCACTGCGCCCGTTCTG 74 intE-1HL F TCGTACCTGTACTACGAGACCTTTG 75 intE-1HL R TTGTGTCGAAATACAACAGCCAGTC 76 intE-1HR F GCTGTATGCTTGTCGACGCTCGGAC 77 intE-1HR R GGAGAAGCGAGAGACGACGGGGATC 78
[0194] Example 2 Construction of recombinant strains
[0195] 1. Construction of strain PO1f0004
[0196] 1) Using the β-carotene synthesis strain PO1f0002 constructed in the laboratory in the early stage as the background strain (recorded in the patent document with application number 2024107357530), the pCRISPRyl-ΔAXP plasmid and pUC19-ΔAXP::MvaS A110G The linearized fragments of (SKL) + MvaE (SKL) were co-transformed into PO1f0002 competent cells for integration of the "MvaSA110G (SKL) + MvaE (SKL)" gene expression cassette. For the specific preparation and transformation methods of competent cells, refer to the instructions of the Frozen-EZ Yeast Transformation II Kit (Zhuangmeng Bio).
[0197] 2) Spread the plate onto SD-Ura auxotrophic plates and incubate at 30°C for 24-48 hours to screen for positive clones.
[0198] 3) Yeast colony PCR was performed using KOD FX Neo (TOYOBO). The reaction system and procedure are shown in Table 5:
[0199] Table 5
[0200]
[0201] Reaction conditions: Initial denaturation at 94°C for 2 minutes, denaturation at 98°C for 10 seconds, annealing at X°C for 30 seconds, extension at 68°C for Y seconds (1 minute / kb), and supplemental extension at 68°C for 7 minutes, for 35 cycles. The annealing temperature (X) and extension time (Y) in the PCR protocol vary depending on the primers used and the length of the amplified fragment, and are generally selected or used in the appropriate quantities. The volume of template colonies used varies depending on the template concentration and is generally selected or used in the appropriate quantities.
[0202] 4) Based on the identification results, a single colony that successfully integrated "MvaSA110G(SKL)+MvaE(SKL)" at the genomic AXP site was selected and inoculated into YPD liquid medium and cultured at 30°C, 220 rpm for 24 h to eliminate the pCRISPRyl-△AXP plasmid.
[0203] 5) After 24 hours, streak the culture onto YPD plates (containing 100 mg / mL 5-fluoroorotic acid) and incubate at 30°C for 24-48 hours. Once a single colony has grown, perform a spot plate experiment. Select a single colony that grows on YPD plates but not on SD-Ura auxotrophic plates (engineered bacteria in which the pCRISPRyl-ΔAXP plasmid has been successfully eliminated) and inoculate it onto YPD liquid medium.
[0204] 6) Linearize the pUC19-ΔMHY1::ERG12(SKL)+ERG8(SKL)+ERG19(SKL) plasmid and co-transform it with pCRISPRyl-ΔMHY1 into the competent cell prepared by constructing the strain in step (5), integrate the ERG12(SKL)+ERG8(SKL)+ERG19(SKL) gene expression cassette at the genomic MHY1 locus, culture the strain according to the above-mentioned culture method, complete the verification, and prepare competent cells.
[0205] 7) Combine pUC19-ΔGUT2::IDI(SKL)+ERG20 F87S (SKL) plasmid was linearized and co-transformed with pCRISPRyl-ΔGUT2. In the competent state prepared by constructing the strain in step (6), the genomic GUT2 site IDI (SKL) + ERG20 was performed. F87S Integration of the (SKL) gene expression cassette was performed, and the strain was cultured and verified according to the above-mentioned culture method and competent cells were prepared.
[0206] 8) pUC19-ΔD17::GGPPs7(SKL)+CarRP Y27R (SKL) + CarB (SKL) plasmid was linearized and co-transformed with pCRISPRyl-ΔD17. In the competent state prepared by constructing the strain in step (7), the genomic D17 site GGPPs7 (SKL) + CarRP was transformed. Y27R The (SKL)+CarB(SKL) gene expression cassette was integrated, the strain was cultured and verified according to the above-mentioned culture method, and the strain with positive verification was constructed as strain PO1f0004.
[0207] 2. Construction of PO1f0005 strain
[0208] 1) Streak a YPD plate with glycerol stock of strain PO1f0004 and incubate at 30°C for 24-48 hours to activate the strain.
[0209] 2) After a single colony has grown, inoculate it into YPD liquid medium and culture at 30°C for 16-24 hours to prepare the competent culture.
[0210] 3) Transformation plasmids pCRISPRyl-ΔintC-2 and pUC19-ΔintC-2::CarRPY27R +CarB linearized fragment.
[0211] 4) Spread the plate onto SD-Ura auxotrophic plates and incubate at 30°C for 24-48 hours to screen for positive clones.
[0212] 5) Yeast colony PCR was performed using KOD FX Neo (TOYOBO) according to the positive clone verification method described in the construction process of PO1f0004.
[0213] 6) Select the successful integration of "CarRP" at the intC-2 site of the genome Y27R A single colony of "+CarB" was inoculated into YPD liquid medium and the pCRISPRyl-△intC-2 plasmid was eliminated.
[0214] 7) A single colony from which the plasmid was successfully eliminated was inoculated into YPD liquid medium, cultured at 30°C for 16-24 hours, and stored in glycerol to obtain the PO1f0005 strain.
[0215] 3. Construction of PO1f0006 strain
[0216] 1) Streak a YPD plate with glycerol stock of strain PO1f0005 and incubate at 30°C for 24-48 hours to activate the strain.
[0217] 2) After a single colony has grown, inoculate it into YPD liquid medium and culture at 30°C for 16-24 hours to prepare the competent culture.
[0218] 3) Transformation plasmid pCRISPRyl-ΔintC-1 and pUC19-ΔintC-1::GGPPs7 linearized fragment.
[0219] 4) Spread the plate onto SD-Ura auxotrophic plates and incubate at 30°C for 24-48 hours to screen for positive clones.
[0220] 5) Yeast colony PCR was performed using KOD FX Neo (TOYOBO) according to the positive clone verification method described in the construction process of PO1f0004.
[0221] 6) A single colony that successfully integrated "GGPPs7" at the intC-1 site of the genome was selected and inoculated into YPD liquid medium to eliminate the pCRISPRyl-△intC-1 plasmid.
[0222] 7) A single colony from which the plasmid had been successfully eliminated was inoculated into YPD liquid medium, cultured at 30°C for 16-24 hours, and stored in glycerol to obtain the PO1f0006 strain.
[0223] 4. Construction of PO1f0007 strain
[0224] 1) Streak a YPD plate with glycerol stock of strain PO1f0006 and incubate at 30°C for 24-48 hours to activate the strain.
[0225] 2) After a single colony has grown, inoculate it into YPD liquid medium and culture at 30°C for 16-24 hours to prepare the competent culture.
[0226] 3) Transformation plasmid pCRISPRyl-ΔintE-1 and pUC19-ΔintE-1::ERG20F87S linearized fragment.
[0227] 4) Spread the plate onto SD-Ura auxotrophic plates and incubate at 30°C for 24-48 hours to screen for positive clones.
[0228] 5) Yeast colony PCR was performed using KOD FX Neo (TOYOBO) according to the positive clone verification method described in the construction process of PO1f0004.
[0229] 6) Select the ERG20 that has been successfully integrated into the intE-1 site of the genome F87S A single colony of " was inoculated into YPD liquid medium and the pCRISPRyl-△intE-1 plasmid was eliminated.
[0230] 7) A single colony from which the plasmid had been successfully eliminated was inoculated into YPD liquid medium, cultured at 30°C for 16-24 hours, and stored in glycerol to obtain the PO1f0007 strain.
[0231] The basic information of strain construction in this example is shown in Table 6.
[0232] Table 6
[0233]
[0234] Example 3 Application of recombinant strains
[0235] The recombinant strain was fermented in shake flasks for 144 hours, and the target product, β-carotene, was extracted using DMSO / acetone. Liquid chromatography analysis (Table 7) showed that, after the MVA pathway and β-carotene biosynthesis pathway were introduced into the peroxisome, the β-carotene titer of strain PO1f0004 reached 249 mg / L. Furthermore, by further enhancing the expression of key genes in the β-carotene biosynthesis pathway in the cytoplasm, the β-carotene biosynthesis capacity of strain PO1f0007 was further enhanced, reaching 649 mg / L.
[0236] Table 7
[0237]
[0238] It should be understood that the above embodiments are exemplary and are not intended to encompass all possible implementations of the claims. Various modifications and variations may be made to the above embodiments without departing from the scope of this disclosure. Similarly, the various technical features of the above embodiments may be arbitrarily combined to form additional embodiments of the present invention that may not be explicitly described. Therefore, the above embodiments merely illustrate several implementations of the present invention and do not limit the scope of protection of the patent of this invention.
Claims
1. A genetically engineered bacterium for producing β-carotene, characterized in that: The Yarrowia lipolytica strain was used as the starting strain, and genes related to the β-carotene biosynthesis pathway were integrated into its genome; Among them, genes related to the β-carotene biosynthesis pathway include MvaS, MvaE, ERG12, ERG8, ERG19, IDI, ERG20, GGPPs7, CarRP, and CarB; The beta-carotene synthesis pathway related gene is expressed in the peroxisome through the peroxisome localization signal peptide.
2. The genetically engineered bacterium according to claim 1, characterized in that The MvaS and MvaE genes are derived from Enterococcus faecalis; the ERG12 gene is derived from Saccharomyces cerevisiae; Preferably, the MvaS gene is a mutant gene, wherein the 110th alanine encoded by the wild-type MvaS gene is mutated to glycine, and the nucleotide sequence of the MvaS gene is shown in SEQ ID NO. 45, or a degenerate sequence thereof; Preferably, the nucleotide sequence of the MvaE gene is as shown in SEQ ID NO. 46, or a degenerate sequence thereof; Preferably, the nucleotide sequence of the ERG12 gene is as shown in SEQ ID NO. 44, or a degenerate sequence thereof.
3. The genetically engineered bacterium according to claim 1, characterized in that The MvaS and / or MvaE gene insertion site is the AXP site of the Yarrowia lipolytica genome; The GGPPs7, CarRP and / or CarB gene insertion site is the D17 site of the Yarrowia lipolytica strain Yarrowia lipolytica genome; The IDI and ERG20 gene insertion sites are the GUT2 sites of the Yarrowia lipolytica genome; The ERG12, ERG8 and ERG19 gene insertion sites are the MYH1 sites of the Yarrowia lipolytica genome.
4. The genetically engineered bacterium according to claim 1, characterized in that The localization signal peptide is fused to the C-terminus of the gene expression product related to the β-carotene synthesis pathway; Preferably, the localization signal peptide is selected from SKL or CRMVGKSKL.
5. The genetically engineered bacterium according to claim 1, characterized in that The key genes ERG20, GGPPs7, CarRP and CarB for synthesizing β-carotene in the cytoplasm are also integrated into its genome.
6. The genetically engineered bacterium according to claim 1 or 5, characterized in that The GGPPs7 gene is derived from Synechococcus sp.; the CarRP and CarB genes are derived from Mucor circinelloides; Preferably, the ERG20 gene is a mutant gene, wherein the phenylalanine at position 87 encoded by the wild-type ERG20 gene is mutated to serine, and the nucleotide sequence of the ERG20 gene is shown in SEQ ID NO. 50, or a degenerate sequence thereof; Preferably, the CarRP gene is a mutant gene, wherein the tyrosine at position 27 encoded by the wild-type CarRP gene is mutated to arginine, and the nucleotide sequence of the CarRP gene is shown in SEQ ID NO. 48, or a degenerate sequence thereof; Preferably, the nucleotide sequence of the GGPPs7 gene is as shown in SEQ ID NO.47, or a degenerate sequence thereof; Preferably, the nucleotide sequence of the CarB gene is as shown in SEQ ID NO. 49, or a degenerate sequence thereof.
7. The genetically engineered bacterium according to claim 5, characterized in that The insertion site of GGPPs7, a key gene for β-carotene synthesis in the cytoplasm, is the intC-1 site of the genome of the yeast strain Yarrowia lipolytica. The insertion site of ERG20, a key gene for β-carotene synthesis in the cytoplasm, is the intE-1 site of the Yarrowia lipolytica genome. The insertion site of the key genes CarRP and / or CarB for synthesizing β-carotene in the cytoplasm is the intC-2 site of the genome of the Yarrowia lipolytica strain.
8. The genetically engineered bacterium according to claim 1, characterized in that The starting strain is Yarrowia lipolytica PO1fΔKU70-ΔKU80::CrtE+CarB+CarRP Y27R +LEU2-ΔA08::RAD52.
9. Use of the genetically engineered bacterium according to any one of claims 1 to 8 in producing β-carotene.
10. A method for producing β-carotene, characterized in that: The method comprises: (1) fermenting the genetically engineered bacteria according to any one of claims 1 to 8 to obtain a fermentation product; (2) extracting the fermentation product with an organic solvent to collect β-carotene.
Citation Information
Cited By
Recombinant beta-carotene ketolase as well as mutant and application thereof
CN121427854A