A HPV virus detection kit

By combining LAMP and freeze-drying technologies, a simple and rapid HPV virus detection kit has been developed, which solves the problems of testing equipment and operational complexity in primary healthcare institutions. It achieves high sensitivity and specificity in HPV detection and is suitable for HPV screening and monitoring in primary healthcare institutions and resource-limited areas.

CN120648854BActive Publication Date: 2026-04-14THE FOURTH HOSPITAL OF HEBEI MEDICAL UNIVERSITY (HEBEI CANCER HOSPITAL)
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
CN202511085962.6
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-08-04
Publication Date
2026-04-14
Estimated Expiration
2045-08-04

AI Technical Summary

Technical Problem

Existing HPV testing methods require expensive instruments, complex procedures, and long testing times, which limits their application in primary healthcare institutions and resource-limited areas. Furthermore, their sensitivity and specificity are insufficient, making it difficult to meet clinical needs.

Method used

A novel HPV detection kit was developed using loop-mediated isothermal amplification (LAMP) technology, combined with lyophilization and visualization. The kit includes lyophilized tubes, liquid reaction tubes, and sample lysis tubes. It detects HPV by lysing oral epithelial cell samples and utilizes Bst DNA polymerase and neutral red indicator to achieve a simple and rapid HPV detection.

Benefits of technology

It achieves low-cost, rapid, and portable HPV testing, suitable for use in primary healthcare institutions. The testing time is reduced to 30 minutes, with a sensitivity of 10 copies/μL and high specificity. It is suitable for HPV infection screening and treatment monitoring in oral epithelial cells, and is suitable for community hospitals, remote areas, and home self-testing.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure SMS_1
    Figure SMS_1
  • Figure SMS_2
    Figure SMS_2
  • Figure SMS_3
    Figure SMS_3
Patent Text Reader

Abstract

The application discloses a HPV virus detection kit, which improves the problems of traditional HPV detection, such as the need of expensive instruments, complicated operation and long detection time, by adopting LAMP technology and visual detection design; the kit contains a freeze-drying tube, a liquid reaction tube and a sample lysis tube, LAMP primer groups in the freeze-drying tube are combined with Bst DNA polymerase to realize constant temperature amplification; when the MOPS buffer microspheres in the liquid reaction tube release components to maintain the reaction environment at pH change, the accuracy and stability of the chromogenic accuracy of neutral red are protected, and the neutral red is used as an indicator to intuitively present the result through color (orange yellow negative, red positive); after the sample is mixed with the lysis solution and heated, the reaction system is added at 60 DEG C constant temperature for 30 min, and naked eye judgment can be carried out, without the need of a thermal cycler and other equipment, so that the HPV screening is effectively promoted in the popularization and application of primary medical institutions.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This application relates to the field of biotechnology, specifically to an HPV virus detection kit. Background Technology

[0002] Human papillomavirus (HPV) belongs to the genus Papillomavirus A of the family Papillomaviridae. It can cause various benign papillomas or warts on human skin and mucous membranes, leading to abnormal tissue proliferation. Some subtypes also have potential carcinogenicity. Molecular epidemiological studies have shown that persistent HPV infection is a necessary condition for cervical and oropharyngeal cancer. Currently, more than 200 HPV subtypes have been isolated and sequenced, of which 15 are considered carcinogenic or high-risk. Most oropharyngeal and cervical cancer patients are caused by HPV16 or HPV18 subtypes.

[0003] Globally, cervical cancer is the most common gynecological cancer and the fourth leading cause of cancer death. In 2018, an estimated 570,000 cases and 311,000 deaths were reported worldwide. Furthermore, cervical cancer is a leading cause of cancer death in 42 countries. However, the incidence and mortality rates of cervical cancer have declined significantly over the past 80 years, primarily due to effective screening and treatment of precancerous lesions. This highlights the importance of wider adoption of effective screening methods. The incidence of oropharyngeal squamous cell carcinoma (OPSCC) caused by HPV is steadily rising, recently surpassing cervical cancer to become the most common HPV-related cancer in the United States. HPV subtype 16 accounts for approximately 87% of oropharyngeal cancers. Given the importance of HPV in the pathogenesis of these cancers, improving HPV screening is crucial. Accurate testing is crucial for effectively screening individuals at risk of cancer, rapidly diagnosing cancer, and monitoring patients receiving aggressive treatment. Various HPV testing methods have been developed, including nucleic acid hybridization assays, signal amplification assays, nucleic acid amplification-based assays, and fluorescence in situ hybridization. For newly diagnosed oropharyngeal cancer patients, immunohistochemical detection of p16 expression serves as a surrogate marker for HPV infection. However, these methods require significant resources, including testing costs, sophisticated equipment, trained personnel, and specialized reagents, which may hinder their scalability for broader HPV testing, including screening and monitoring treatment response. Cyclic-mediated isothermal amplification (LAMP) is a robust technique capable of rapidly and highly specifically amplifying DNA. LAMP relies on specific primers and a large fragment of Bst DNA polymerase, a self-circulating and displacing DNA polymerase. Utilizing the workflow of LAMP, which is suitable for clinical settings, allows for rapid, simple, and cost-effective detection of HPV DNA, particularly the two most common high-risk subtypes, HPV16.

[0004] Currently, HPV testing methods mainly include: cytological examination, immunological detection, and molecular biological detection. PCR technology requires a thermal cycler, is complex to operate, and is costly, making it unsuitable for applications at the grassroots level. Hybrid capture technology, however, typically requires expensive equipment, complex procedures, and long testing times, limiting its application in primary healthcare institutions and resource-constrained areas. Furthermore, some existing rapid testing methods have shortcomings in sensitivity, specificity, or stability, making it difficult to meet clinical needs. Therefore, developing a simple, rapid, accurate, and on-site HPV virus detection kit is of great significance.

[0005] The prior art CN103898241B discloses a kit for detecting HPV, which is mainly based on NASBA technology (dependent on RNA reverse transcriptase, RNA polymerase, etc.) and microarray capillary electrophoresis. It requires complex instruments to analyze the electrophoresis results, does not provide a visual analysis of the experimental results, and extracts the samples after lysis. Summary of the Invention

[0006] To address the limitations of HPV testing, which requires expensive equipment, complex procedures, and long testing times, restricting its application in primary healthcare institutions and resource-constrained areas, this application provides an HPV virus detection kit. Through the following technological innovations, it achieves low-cost, rapid, portable, and highly sensitive detection. By employing isothermal amplification, visual detection, and an integrated design, it solves the problems of high requirements for equipment, operation, and time in traditional HPV testing, making HPV screening accessible in primary healthcare institutions. As a tool for early detection, monitoring treatment response, and assessing cancer recurrence, loop-mediated isothermal amplification (LAMP) is a simple yet powerful technique that can detect and amplify DNA using Bst chain replacement DNA polymerase in a single test tube. A method using LAMP technology has been developed for detecting oral epithelial cell samples through a lysis-free DNA extraction method.

[0007] This application provides an HPV virus detection kit, which includes lyophilized tubes, liquid reaction tubes, and sample lysis tubes: wherein the lyophilized tubes contain LAMP primers, Bst DNA polymerase, and trehalose-sorbitol complex protectant; the liquid reaction tubes contain MOPS buffer microspheres, dNTPs, and neutral red; and the sample lysis tubes contain sample lysis buffer.

[0008] Preferably, the mass ratio of trehalose-sorbitol composite protectant in the freeze-drying tube is 2-4:1, and the final concentration in the freeze-drying system is 5%-10% w / v.

[0009] Preferably, the Bst DNA polymerase activity unit in the lyophilized tube is 5-10 U / μL, and the HPV16 LAMP primer set includes inner primers (F3, B3), outer primers (FIP, BIP), and loop primers (LF, LB) designed for conserved regions of HPV virus. The molar ratio of the inner primers, outer primers, and loop primers is 1:7.5:1, wherein the HPV16-F3 primer is shown in SEQ ID 1; the HPV16-B3 primer is shown in SEQ ID 2; the HPV16-FIP primer is shown in SEQ ID 3; the HPV16-BIP primer is shown in SEQ ID 4; and the HPV16-LF primer is shown in SEQ ID 5.

[0010] The HPV16-LB primer is shown in SEQ ID 6:

[0011] SEQ ID 1: ATGCACCAAAAGAGAACTG

[0012] SEQ ID 2: AGCATATGGATTCCCATCTC

[0013] SEQ ID 3: GCAGCTCTGTGCATAACTGTTTTTCAATGTTTCAGGACCCACA

[0014] SEQ ID 4: AGAATGTGTGTACTGCAAGCAATTTTTCCCGAAAAGCAAAGTCAT

[0015] SEQ ID 5: GGTAACTTTCTGGGTCGCTCC

[0016] SEQ ID 6: CAGTTACTGCGACGTGAGGT

[0017] Preferably, the MOPS microsphere buffer system in the liquid reaction tube is composed of PLGA-encapsulated MOPS buffer salt, with microspheres having a particle size of 5-20 μm. The microspheres rupture at pH 6.8 ± 0.2 to release the buffering components, and the surface of the microspheres is coated with a pH-sensitive polymer poly(β-amino ester).

[0018] Preferably, the liquid reaction tube further contains an enzyme reaction solution.

[0019] Preferably, the concentration of the neutral red pH indicator in the liquid reaction tube is 0.05-0.2 mM, which is orange-yellow at pH 8.0-8.5 and red at pH 6.8±0.2.

[0020] Preferably, the final concentration of the trehalose-sorbitol composite protective agent in the reaction system after mixing in the liquid reaction tube and the freeze-drying tube is 3%-8% w / v.

[0021] Preferably, the sample lysis buffer in the sample lysis tube comprises: 0.3%-1% Triton X-100 or SDS, 2%-6% Tween 20, 1-5 mM Tris, and 1-5 mM EDTA, wherein the pH is 8.0-9.0.

[0022] This application also provides an HPV virus detection method, characterized in that the method includes the following steps:

[0023] (1) Use a sterile cotton swab to scrape the oral epithelium back and forth 4-6 times, place the cotton swab containing oral epithelial cells into the lysis buffer, invert and mix for 10-20 seconds, and heat at 65℃ for 5 minutes.

[0024] (2) Take 50 μL of the lysis product and add it to the liquid reaction tube, then add the components of the lyophilized tube, shake gently for 10 seconds, and react at 60℃ for 30-45 min.

[0025] (3) Observe the color chart with the naked eye: orange-yellow indicates HPV negative, and red indicates HPV positive.

[0026] Preferably, during the reaction process of step (2) above, as the LAMP reaction proceeds and the pH drops to 7.0±0.2, the MOPS microspheres in the liquid reaction tube rupture and release buffer components.

[0027] The beneficial effects of the embodiments in this application are as follows:

[0028] (1) Simple operation, no need for complicated equipment: Using LAMP isothermal amplification technology, only 60℃ isothermal reaction for 30 minutes is required. There is no need for expensive instruments such as thermal cycler (PCR instrument) and electrophoresis equipment, which lowers the detection threshold. The results can be visually interpreted (orange-yellow negative / red positive) by neutral red pH indicator. No professional equipment analysis is required, which is suitable for use in primary medical institutions.

[0029] (2) Rapid detection and improved screening efficiency: Traditional HPV testing usually takes 2-4 hours, while this kit can be completed in only 30 minutes, which greatly shortens the detection time and is suitable for large-scale screening. The sample processing is simple, and it only needs to be added directly to the reaction system after lysis, reducing operation steps and increasing detection throughput.

[0030] (3) Low cost and easy to promote: The use of freeze-drying technology (trehalose-sorbitol complex protectant) stabilizes enzymes and primers, extends shelf life, reduces transportation and storage costs, and the integrated design of the kit reduces the use of consumables. The overall cost is only 1 / 3 of that of traditional PCR detection, making it suitable for promotion in areas with limited resources.

[0031] (4) The dynamic pH regulation of MOPS buffer microspheres avoids false positives / false negatives and improves detection accuracy.

[0032] (5) Strong stability and adaptability to different environments: The compound protectant (trehalose-sorbitol) in the lyophilized tube can maintain enzyme activity for a long time. The kit can be stably stored at 4-25℃ for more than 6 months. The lysis buffer (containing Triton X-100 and Tween 20) can effectively release viral DNA and reduce sample processing errors. Amplification is carried out by the DNA lysis method without extraction, which greatly shortens the extraction time and reduces complicated operations.

[0033] (6) It is suitable for oral epithelial cells and can be used for HPV infection screening, efficacy monitoring and epidemiological investigation. It is highly portable and suitable for community hospitals, remote areas and home self-testing scenarios. Attached Figure Description

[0034] Figure 1 These are experimental diagrams for Group 1 and Group 2 of Embodiment 5 of this application;

[0035] Figure 2 These are experimental diagrams for Groups 3 and 4 of Embodiment 5 of this application;

[0036] Figure 3 This is a diagram showing the negative result of Example 7 of this application;

[0037] Figure 4 This is an experimental image showing the HPV16 positive sample from Example 7 of this application;

[0038] Figure 5 This is a schematic diagram of the pH response kinetics test experiment of MOPS buffer microspheres in Example 8 of this application. Detailed Implementation

[0039] The technical solution of the present invention will be clearly and completely described below with reference to the embodiments. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative effort are within the scope of protection of the present invention.

[0040] The reagents and equipment used in the embodiments of this disclosure are all conventional and commercially available.

[0041] Preparation Example

[0042] Preparation of lysis buffer stock solution

[0043] (1) Preparation of 1M Tris-HCl buffer (pH 8.5): Weigh 121.1g Tris (molecular weight 121.14), dissolve in 800mL deionized water, adjust pH to 8.5 with concentrated HCl, bring volume to 1L, autoclave at 126℃ for 15min, and store at room temperature.

[0044] (2) 0.5M EDTA solution (pH: 8.0): Weigh 186.1g of disodium EDTA (molecular weight 372.24), dissolve in 800mL of deionized water, adjust the pH to 8.0 with NaOH (EDTA is difficult to dissolve below pH 8.0), bring the volume to 1L, autoclave, and store at room temperature.

[0045] (3) 50% Triton X-100 stock solution: Measure 50 mL of Triton X-100 stock solution, add 50 mL of deionized water, stir magnetically until completely dissolved, filter through a 0.22 μm filter membrane for sterilization, and store at 4°C in the dark.

[0046] (4) 50% Tween 20 stock solution: Measure 50 mL of Tween 20 stock solution, add 50 mL of deionized water, mix well, filter to sterilize, and store at 4℃.

[0047] (5) Preparation of 10% SDS stock solution: Weigh 10g of SDS powder and slowly add the SDS powder to 80mL of deionized water preheated to 60℃ (heating can accelerate dissolution). Stir magnetically (300rpm) until completely dissolved (15-20min). Avoid vigorous stirring to prevent foaming. After the solution cools to room temperature, add deionized water to 100mL and mix gently.

[0048] (6) Preparation of MOPS buffer microspheres: Weigh 100 mg PLGA and 20 mg MOPS buffer salt, add 2 mL dichloromethane, sonicate at 100 W for 5 min until completely dissolved, slowly add the obtained PLGA-MOPS organic phase dropwise to 100 mL 1% PVA aqueous solution, while simultaneously emulsifying at 1000 rpm for 10 min, and continue magnetic stirring at 300 rpm for 2 h to allow dichloromethane to evaporate and the microspheres to solidify. Centrifuge (3000 rpm, 5 min), discard the supernatant, wash 3 times with 10 mL deionized water, and prepare a 1% poly(β-amino ester) solution: Weigh 10 mg of polymer and dissolve in 1 mL deionized water, resuspend the microspheres in the modification solution, shake gently at 25 °C (50 rpm) for 30 min, and freeze-dry. Pre-freeze: -80 °C for 2 h, freeze-dry: 24 h to obtain a white loose powder. Weigh 100 mg of freeze-dried microspheres and add 10 mL PBS buffer (pH 6.8) was vortexed for 1 min and then briefly sonicated (40 kHz, 10 s) to aid dissolution. The particle size distribution was measured using a laser particle size analyzer: D50: 10 ± 2 μm, PDI < 0.3.

[0049] (7) Preparation of trehalose-sorbitol composite protective agent: Weigh 16g of trehalose and 4g of sorbitol, add 80mL of preheated deionized water at 60℃ to a beaker, add sorbitol first, stir magnetically (300rpm) until completely dissolved (5min), then add trehalose, continue stirring until completely transparent (15min), cool to room temperature, add deionized water to 100mL, mix well, filter through a 0.22μm sterile filter membrane, collect in a sterile container, its pH value is 6.5-7.5, and its osmotic pressure is 1105mOsm / kg.

[0050] Example 1

[0051] Low concentration lysis buffer formulation

[0052] The formulation composition is shown in Table 1:

[0053] Table 1. Low-concentration lysis buffer formulation (for 1 mL)

[0054] Final concentration Use concentration Volume (μL) EDTA 1mM 0.5M 2 Tris 1mM 1M 1 Twain 20 2% 50% 40 Triton X-100 0.3% 50% 6 Deionized water / / 951

[0055] Example 2

[0056] intermediate concentration lysis buffer formulation

[0057] The formula composition is shown in Table 2:

[0058] Table 2. Formulation of intermediate concentration lysis buffer (for 1 mL)

[0059] Final concentration Use concentration Volume (μL) EDTA 3mM 0.5M 6 Tris 3mM 1M 3 Twain 20 4% 50% 80 Triton X-100 0.5% 50% 10 Deionized water / / 901

[0060] Example 3

[0061] High-concentration pyrolysis solution formulation

[0062] The formula composition is shown in Table 3:

[0063] Table 3. High-concentration lysis buffer formulation (for 1 mL)

[0064] Final concentration Use concentration Volume (μL) EDTA 5mM 0.5M 10 Tris 5mM 1M 5 Twain 20 6% 50% 120 Triton X-100 1% 50% 20 Deionized water / / 845

[0065] Example 4

[0066] SDS Alternative to Triton X-100 Lysis Fluid Formulation

[0067] The formula composition is shown in Table 4:

[0068] Table 4. SDS alternative to Triton X-100 lysis buffer formulation (for 1 mL)

[0069] Final concentration Use concentration Volume (μL) EDTA 3mM 0.5M 6 Tris 3mM 1M 3 Twain 20 4% 50% 80 SDS 0.5% 10% 50 Deionized water / / 861

[0070] Example 5

[0071] lysis buffer verification experiment

[0072] (1) Experimental materials:

[0073] 1) β-actin was used as an internal reference gene and amplified using the primer sequences shown in Table 5 (Sequence source: [Facile and direct detection of hμMan papillomavirus (HPV) DNA in cells using loop-mediated isothermal amplification (LAMP)]). The primers were synthesized by Shanghai Sangon Biotech to verify the effectiveness of the cell lysate.

[0074] Table 5. Sequences of β-actin internal reference primers

[0075] name Primer sequence ACTB-F3 GCTCAGGGCTTCTTGTCC ACTB-B3 TCGGGAGCCACACGCA ACTB-FIP TTGCTCTGGGCCTCGTCGCTTTTTTTCCTTCCCAGGGCGT ACTB-BIP AGAGGCATCCTCACCCTGAAGTTTTTTGTGGTGCCAGATTTTCTCCA ACTB-LF TGACCCATGCCCACCATC ACTB-LB CCATCGAGCACGGCATCGT

[0076] 2) Lysis solution prepared in Examples 1-4, sterile oral sampling swabs, and 5 healthy volunteers (who have signed informed consent).

[0077] (2) Experimental Methods: The buccal mucosa of volunteers was scraped 4-6 times with a sterile cotton swab, and the swab was immediately immersed in 1 mL of lysis buffer at different concentrations: Group 1: Low-concentration lysis buffer from Example 1; Group 2: Intermediate-concentration lysis buffer from Example 2; Group 3: High-concentration lysis buffer from Example 3; Group 4: SDS lysis buffer from Example 4; The mixture was heated at 65℃ for 5 min, vortexed twice during the heating process. Bst II DNA Polymerase Large Fragment (Novozymes, P702) was used for detection, and the detection amplification system is shown in Table 6.

[0078] Table 6 Amplification system (20 μL)

[0079]

[0080]

[0081] Bath in a constant temperature water bath at 60℃ for 30 minutes.

[0082] (3) Experimental results: After amplification, all observed colors were red, as shown in Group 1 and Group 2. Figure 1 As shown (left: group 1, right: group 2), groups 3 and 4 are as follows. Figure 2 As shown (left: group 3, right: group 4); the amplification primers are internal control, indicating that all samples released DNA and bound to DNA. The results verify that the lysis buffer is effective and samples can be detected without extracting DNA.

[0083] Example 6

[0084] Reagent kit preparation method

[0085] (1) Preparation of lyophilized tubes (10 μL / tube):

[0086] 1) Prepare the LAMP primer mixture by mixing primers in a molar ratio of 1:7.5:1 (inner primer (F3 / B3):outer primer (FIP / BIP):loop primer (LF / LB)) with HPV16 primers (F3 (SEQ ID 1), B3 (SEQ ID 2), FIP (SEQ ID 3), BIP (SEQ ID 4), LF (SEQ ID 5), LB (SEQ ID 6). The primers were synthesized by Shanghai Sangon Biotech, and the sequences are as follows (Sequence source: [Facile and direct detection of hμMan papillomavirus (HPV) DNA in cells using loop-mediated isothermal amplification (LAMP)]):

[0087] SEQ ID 1: ATGCACCAAAAGAGAACTG

[0088] SEQ ID 2: AGCATATGGATTCCCATCTC

[0089] SEQ ID 3: GCAGCTCTGTGCATAACTGTTTTTCAATGTTTCAGGACCCACA

[0090] SEQ ID 4: AGAATGTGTGTACTGCAAGCAATTTTTCCCGAAAAGCAAAGTCAT

[0091] SEQ ID 5: GGTAACTTTCTGGGTCGCTCC

[0092] SEQ ID 6: CAGTTACTGCGACGTGAGGT;

[0093] 2) Preparation of premixed solution (taking 1 mL as an example, it can be dispensed into 100 tubes), the formula is shown in Table 7:

[0094] Table 7 Preparation of premixed solution for 1mL lyophilized tubes

[0095]

[0096] 3) Dispensing and lyophilization: Dispense 10 μL / tube into 0.5 mL lyophilization tubes. Lyophilization program: Pre-freeze: -80℃ for 2 h, primary drying: -40℃, 0.1 mbar, 24 h, secondary drying: 25℃, 0.01 mbar, 6 h.

[0097] (2) Preparation of liquid reaction tubes (9 μL / tube): Taking a total volume of 1 mL as an example, 100 tubes can be dispensed. The formula is shown in Table 8:

[0098] Table 8 Preparation of 1mL Liquid Reaction Tubes

[0099] Element Storage liquid concentration Added volume (μL) Final concentration of liquid reaction tube MOPS microsphere suspension 10mg / mL 190 1.9 mg / mL dNTP 10mM 190 1.9mM Neutral Red 1mM 190 0.19mM 10×Isothermal buffer 10× 90 0.9× Deionized water / 240 /

[0100] Dispense 9 μL into each 0.2 mL centrifuge tube using a pipette.

[0101] (3) Preparation of sample lysis tube: 1 mL of the formulation in Example 2.

[0102] Example 7

[0103] Reagent kit performance verification experiment

[0104] (1) Experimental materials: Components of the Implementation 6 kit (lyophilized tubes, liquid reaction tubes, sample lysis tubes), HPV16 positive samples, known concentration gradient: 10 1 10 2 10 3 10 4 copies / μL; HPV16 positive samples were purchased from Jingliang Technology (GW-IPF030); oral samples from HPV negative healthy volunteers (5 cases); control reagent: commercial HPV PCR detection kit.

[0105] (2) Sample processing: Use sterile cotton swabs to scrape oral epithelial cells from healthy volunteers (4-6 times), immerse in 1 mL of the lysis buffer from Example 2, heat at 65°C for 5 min, vortexing twice during the process; LAMP reaction: Add 1 μL of lysis product to a 9 μL liquid reaction tube, add 10 μL of the lyophilized tube components, gently shake to mix, incubate at 60°C for 30 min, observe the color change, and interpret the results: Orange-yellow: Negative (oral sample from healthy volunteers). Figure 3 As shown; Red: Positive (HPV16 positive sample) Figure 4 As shown.

[0106] (3) Sensitivity test: The HPV16 positive standard (quantitatively analyzed by digital PCR) was serially diluted to 10-1. 1 10 2 10 3 10 4 copies / μL, each concentration was measured 5 times, and the results showed: 101 All five replicates of copies / μL showed positive results (showing red color), with a detection rate of 100%. 0 copies / μL: No detection was detected in 5 replicates (orange-yellow color). The limit of detection of this kit is 10 copies / μL, which is similar to that of commercial HPV qPCR (Qiagen). The LOD (10 copies / μL) of the HPV16RG PCR Kit was consistent, and there was no significant difference in sensitivity between the two.

[0107] (4) Specificity test: The experimental design is shown in Table 9:

[0108] Table 9 Specificity Experiments

[0109]

[0110]

[0111] Experimental results: Only the HPV16 sample turned red and showed no cross-reaction. Primer pairs for HPV18, HPV31, HPV33, HPV45, HPV52, HPV58, HPV6, and HPV11 showed no amplification and turned orange-yellow.

[0112] (5) Repeatability test (10 3 copies / μL sample): the same HPV16 positive sample (10 copies / μL sample): 3 The results of the color development and reaction time were recorded 10 times consecutively (copies / μL). Number of tests: 1-10 times; display result: red; reaction time: 30±1 min; color consistency: all 10 / 10 tests are red (100% consistent); time consistency: CV (coefficient of variation) = 1.2% < 5% (compliant with industry standards).

[0113] Example 8

[0114] pH response kinetics test of MOPS buffer microspheres

[0115] (1) Experimental materials: MOPS buffer microsphere suspension (1 mg / mL) (coated with polyβ-amino ester with pKa = 6.8 and particle size 5-20 μm), pH adjusters: 0.1 M HCl and 0.1 M NaOH, real-time pH monitor, laser confocal microscope.

[0116] (2) Experimental method: The microsphere suspension was placed in a constant temperature bath at 37℃, and the pH was slowly adjusted to 6.8±0.2 with HCl. The pH change time and microsphere rupture rate were recorded. The microsphere morphology was observed through a microscope every 10s, and the rupture rate (number of ruptured microspheres / total number of microspheres × 100%) was calculated.

[0117] (3) Experimental Results: As shown in Table 10, the pH response kinetics test results of MOPS buffer microspheres are as follows. Figure 5 As shown:

[0118] Table 10 pH Response Kinetics Test of MOPS Buffer Microspheres

[0119] pH value Time (s) Fracturing rate pH changes in the system 6.8±0.2 10 60% Begin releasing buffer salts 6.8±0.2 30 More than 95% Pullback to 7.0±0.1 6.8±0.2 60 100% completely broken Stable at 7.0±0.1

[0120] The microspheres rupture rapidly at an acidic pH of 6.8±0.2 (rupture rate >95% within 30s), releasing buffer salts and restoring the system pH to 7.0±0.1. This maintains the optimal activity environment for Bst enzyme (pH 7.0-7.5) while ensuring that neutral red is within the red color development range (pH 6.8±0.2), thus avoiding false negative results due to pH rise.

[0121] Example 9

[0122] Stability tests under different storage conditions

[0123] (1) Experimental materials: Kit components (lyophilized tubes, liquid reaction tubes, which were divided into 4 groups after batch preparation); Storage conditions: Group A: Store at 4℃ protected from light; Group B: Store at room temperature of 25℃; Group C: Store at constant temperature of 37℃; Group D: Repeated freeze-thaw cycles from 4℃ to 25℃ (once a day for 30 days).

[0124] (2) Experimental method: HPV16 positive samples were tested at 0, 7, 14, 30, 60 and 90 days after storage using the kits. 3 The reaction was repeated 3 times per group (copies / μL), and the color change was observed. The positive detection rate was calculated.

[0125] (3) Experimental results: as shown in Table 11:

[0126] Table 11 Stability Test Experiment

[0127] Storage conditions Storage time Positive detection rate (mean) Color change stability Group A (4℃) 90 days 100% Orange-yellow / red colors are clearly visible. Group B (25℃) 90 days 98.3% Slight fading (positive sample shows a lighter red color) Group C (37℃) 30 days 85% The detection rate dropped to 50% after 60 days. Group D (Freeze-Thaw) 30 days 92% Color contrast slightly reduced

[0128] The kit can be stably stored for more than 6 months at 4℃~25℃, and still maintains a high detection rate after repeated freeze-thaw cycles for 30 days. It is suitable for room temperature transportation and home testing storage in primary healthcare institutions.

[0129] In summary, the HPV virus detection kit disclosed in this application, utilizing LAMP technology and a visual detection design, effectively overcomes the problems of traditional detection methods, such as the need for expensive instruments, complex operations, and long processing times. It comprises lyophilized tubes, liquid reaction tubes, and sample lysis tubes. The LAMP primer set and Bst DNA polymerase in the lyophilized tubes enable isothermal amplification, while the MOPS buffer microspheres in the liquid reaction tubes maintain the reaction environment despite pH changes, ensuring the accuracy and stability of neutral red color development. Results can be intuitively determined through color changes (orange-yellow for negative, red for positive). During detection, the sample and lysis buffer are mixed and heated before being added to the reaction system and kept at 60℃ for 30 minutes. No thermal cycler or other equipment is required, making it low-cost and highly portable. Performance verification shows that the kit has a sensitivity of 10 copies / μL and high specificity, consistent with commercial HPV qPCR kits. It can be stably stored for more than 6 months at 4-25℃ and is suitable for oral epithelial cells, which is of great significance for promoting the widespread application of HPV screening in primary healthcare institutions.

[0130] Although embodiments of the present invention have been shown and described, it will be understood by those skilled in the art that various changes, modifications, substitutions and variations can be made to these embodiments without departing from the principles and spirit of the present invention. All equivalent changes and improvements made within the scope of the present invention should still fall within the patent coverage of the present invention.

Claims

1. An HPV virus detection kit, characterized in that, The kit includes lyophilized tubes, liquid reaction tubes, and sample lysis tubes. The lyophilized tubes contain LAMP primers, Bst DNA polymerase, and a trehalose-sorbitol complex protectant. The liquid reaction tubes contain MOPS buffer microspheres, dNTPs, and neutral red. The sample lysis tubes contain sample lysis buffer. The MOPS microsphere buffer system in the liquid reaction tubes consists of PLGA-encapsulated MOPS buffer salts. The microspheres have a particle size of 5-20 μm and rupture at pH 6.8 ± 0.2 to release the buffering components. The surface of the microspheres is coated with a pH-sensitive polymer, poly(β-amino ester) with pKa = 6.

8. The MOPS buffer microspheres are prepared as follows: 100 mg of PLGA and 20 mg of MOPS buffer salts are weighed, 2 mL of dichloromethane is added, and the mixture is sonicated at 100 W for 5 min until completely dissolved. The resulting PLGA-MOPS organic phase is then slowly added dropwise to 100 mL of the solution. In a 1% PVA aqueous solution, emulsify the microspheres by stirring at 1000 rpm for 10 min, then continue stirring magnetically at 300 rpm for 2 h to allow dichloromethane to evaporate and the microspheres to solidify. Centrifuge at 3000 rpm for 5 min, discard the supernatant, and wash three times with 10 mL of deionized water. Prepare a 1% poly(β-amino ester) solution: weigh 10 mg of polymer and dissolve it in 1 mL of deionized water. Resuspend the microspheres in the modification solution at 25 °C and gently shake at 50 rpm for 30 min. Perform freeze-drying: pre-freeze at -80 °C for 2 h, freeze-dry for 24 h to obtain a white loose powder.

2. The HPV virus detection kit according to claim 1, characterized in that, The mass ratio of trehalose-sorbitol composite protectant in the freeze-drying tube is 2-4:1, and the final concentration in the freeze-drying system is 5%-10% w / v.

3. The HPV virus detection kit according to claim 1, characterized in that, The Bst DNA polymerase activity units in the lyophilized tubes are 5-10 U / μL. The HPV16 LAMP primer set contains inner primers F3 and B3, outer primers FIP and BIP, and loop primers LF and LB designed for conserved regions of HPV virus. The molar ratio of the inner primers, outer primers, and loop primers is 1:7.5:

1.

4. The HPV virus detection kit according to claim 1, characterized in that, The liquid reaction tube also contains an enzyme reaction solution.

5. The HPV virus detection kit according to claim 1, characterized in that, The neutral red pH indicator in the liquid reaction tube has a concentration of 0.05-0.2 mM, and is orange-yellow at pH 8.0-8.5 and red at pH 6.8±0.

2.

6. The HPV virus detection kit according to claim 1, characterized in that, After the trehalose-sorbitol composite protective agent is mixed in the liquid reaction tube and the lyophilization tube, the final concentration in the reaction system is 3%-8% w / v.

7. The HPV virus detection kit according to claim 1, characterized in that, The sample lysis buffer in the sample lysis tube contains: 0.3%-1% Triton X-100 or SDS, 2%-6% Tween 20, 1-5mM Tris, and 1-5mM EDTA, with a pH of 8.0-9.0.

Citation Information

Patent Citations

  • A kit for detecting HPV

    CN103898241B

  • Anti-tumour pH sensitive slow release implant and preparation method thereof

    CN102225204A

  • Isothermal amplification of pathogens

    CN117321221A