Dual fluorescent quantitative PCR (Polymerase Chain Reaction) primer probe group for detecting goose circovirus and duck circovirus type II and application of dual fluorescent quantitative PCR primer probe group
By designing a dual-fluorescent quantitative PCR primer and probe set and real-time fluorescence PCR technology, the problem of simultaneously detecting goose circovirus and duck circovirus type II in existing technologies has been solved, achieving high sensitivity and specificity in detection, and making it suitable for accurate detection in waterfowl farms.
Patent Information
- Application Number
- CN202511061871.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-07-31
- Publication Date
- 2025-11-07
AI Technical Summary
Existing technologies are insufficient for the simultaneous and efficient detection of goose circovirus and duck circovirus type II, and suffer from high false positive rates and insufficient sensitivity, failing to meet the precise testing needs of waterfowl farms.
A dual real-time PCR primer and probe set was designed, including specifically labeled real-time PCR primers and probes, for the simultaneous detection of goose circovirus and duck circovirus type II. Combined with real-time PCR technology, the presence of the virus is determined by the Ct value, and detection reagents and kits are provided.
It achieves highly sensitive and specific detection of goose circovirus and duck circovirus type II, with good repeatability and sensitivity about 100 times higher than ordinary PCR, making it suitable for accurate detection in waterfowl farms.
Smart Images

Figure CN120905446A_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The application belongs to the field of molecular biology, and particularly relates to a double fluorescent quantitative PCR primer probe set for detecting goose circovirus and duck circovirus type II virus and application thereof. BACKGROUND
[0002] As typical representatives of waterfowl circovirus, goose circovirus (GoCV) and duck circovirus type II (DuCV-II) have shown a widespread epidemic trend in the waterfowl breeding industry in recent years. Both of them belong to the Circoviridae family and can infect waterfowl of different breeds and different ages, and spread horizontally and vertically in the breeding farm. Although there is no typical clinical symptom after infection (mostly showing growth retardation and feather disorder), the continuous invasion of the immune system of waterfowl will significantly inhibit the host's resistance, not only easily causing secondary or mixed infection with bacteria and viruses (such as co-infection with duck viral hepatitis virus and Escherichia coli), but also weakening the vaccine immune effect, leading to increased breeding cost and economic loss. It is worth noting that the phenomenon of co-infection of GoCV and DuCV-II in breeding farms is gradually increasing, and the simultaneous detection of the two is increasingly urgent.
[0003] At present, due to the inability to culture waterfowl circovirus in vitro, traditional methods such as virus isolation and identification are difficult to apply, and clinical detection mainly relies on serological and molecular biology techniques. Although the serological method (such as ELISA) is simple to operate, it depends on the specific binding of antigen and antibody, has defects such as high commercial cost and poor stability of reagent preservation, and can only detect a single virus, which cannot meet the simultaneous screening needs of co-infection of GoCV and DuCV-II. In the molecular biology method, although conventional PCR and LAMP (loop-mediated isothermal amplification) can realize single virus detection, there are two major problems: first, both methods are end-point detection methods, which cannot simultaneously monitor multiple viruses; second, the amplification product is easy to form aerosol pollution, resulting in a high false positive rate and limited detection accuracy. In addition, the existing technology lacks systematic optimization of specific primer design for GoCV and DuCV-II, resulting in insufficient detection sensitivity and repeatability, which is difficult to meet the precise detection needs of large-scale breeding farms.
[0004] In view of the above technical blank and limitations of existing methods for co-infection detection, it is an urgent need in the industry to develop a detection technology that can simultaneously detect GoCV and DuCV-II with high specificity, sensitivity and repeatability. SUMMARY
[0005] Based on this, the application provides a fluorescent quantitative PCR primer probe set and a detection reagent and a kit for detecting goose circovirus and duck circovirus type II, which can realize simultaneous detection of GoCV and DuCV-II, has high specificity, high sensitivity and good repeatability.
[0006] In order to achieve the above-mentioned purpose, the application can adopt the following technical solutions.
[0007] The application provides a double fluorescent quantitative PCR primer probe set for detecting goose circovirus and duck circovirus type II.
[0008] The upstream primer of the goose circovirus is GoCV-F, and the sequence of the primer GoCV-F is shown as SEQ ID NO. 1.
[0009] The downstream primer of the goose circovirus is GoCV-R, and the sequence of the primer GoCV-R is shown as SEQ ID NO. 2.
[0010] The probe of the goose circovirus is GoCV-Probe, and the sequence of the probe GoCV-Probe is shown as SEQ ID NO. 3.
[0011] The upstream primer of the duck circovirus type II is DuCV-II-F, and the sequence of the primer DuCV-II-F is shown as SEQ ID NO. 4.
[0012] The downstream primer of the duck circovirus type II is DuCV-II-R, and the sequence of the primer DuCV-II-R is shown as SEQ ID NO. 5.
[0013] The probe of the duck circovirus type II is DuCV-II-Probe, and the sequence of the probe DuCV-II-Probe is shown as SEQ ID NO. 6.
[0014] Preferably, in the fluorescent quantitative PCR primer probe set, the 5' end of the GoCV-Probe is labeled with a fluorescent gene FAM, and the 3' end is labeled with a quenching gene BHQ1; the 5' end of the DuCV-II-Probe is labeled with a fluorescent gene VIC, and the 3' end is labeled with a quenching gene BHQ1.
[0015] The application provides a detection reagent for detecting goose circovirus and duck circovirus type II.
[0016] Preferably, in the detection reagent, the concentration of each primer is 35-45 pmol / μL, and the concentration of each probe is 15-25 pmol / μL.
[0017] Preferably, the above detection reagent further comprises one or more of a DNA buffer, a DNA enzyme mix, a positive quality control, or a negative quality control.
[0018] More preferably, in the above detection reagent, the preparation method of the positive quality control comprises:
[0019] (1) using a primer pair to perform PCR amplification with GoCV and DuCV-II genes as templates, and purifying to obtain a purified product;
[0020] (2) using pMD18-T to perform vector connection on the purified product to obtain a recombinant plasmid;
[0021] (3) introducing the recombinant plasmid into a recipient bacterial cell, and then performing screening and identification of the recombinant plasmid to obtain the positive quality control.
[0022] In still another aspect of the present application, a detection kit for detecting goose circovirus and duck circovirus type II is provided, and the detection kit comprises the above detection reagent.
[0023] In still another aspect of the present application, the application of the above fluorescent quantitative PCR primer probe set in the preparation of a detection product for detecting goose circovirus and duck circovirus type II is provided.
[0024] In still another aspect of the present application, the application of the above fluorescent quantitative PCR primer probe set in the preparation of a diagnostic product for diagnosing goose circovirus and / or duck circovirus type II infection disease is provided.
[0025] In still another aspect of the present application, a non-therapeutic method for detecting goose circovirus and / or duck circovirus type II is provided, and the method comprises: using the above fluorescent quantitative PCR primer probe set to perform double real-time fluorescent PCR amplification on a nucleic acid of a sample to be detected; judging the goose circovirus and / or duck circovirus type II to be negative or positive according to a Ct value; wherein the sample to be detected is negative when the Ct value of the nucleic acid is greater than 38, and the sample to be detected is positive when the Ct value of the nucleic acid is less than or equal to 38.
[0026] The beneficial effects of the present application include: the fluorescent quantitative PCR primer probe set for detecting goose circovirus and duck circovirus type II provided by the present application has good specificity for goose circovirus and duck circovirus type II, and can simultaneously detect goose circovirus and duck circovirus type II which are widely spread in waterfowl; the kit provided by the present application contains a GoCV / DuCV-II positive plasmid standard, the GoCV / DuCV-II standard is gradient diluted and amplified, and the results show that there is a good linear relationship between different concentrations of the standard, which meets the expected results; the standard is diluted to 10 1 -10 10times, and the minimum detection limit is determined by using the reaction system provided by the application. The minimum detection amount of GoCV is 2.46*10 2 copies / μL, and the minimum detection amount of DuCV-II is 2.5*10 2 copies / μL. Compared with the ordinary PCR detection method, the sensitivity is about 100 times higher; in addition, the real-time fluorescent quantitative PCR amplification of the standard sample is carried out in batches, and it is found that the batch variation coefficient is less than 1%, and the batch variation coefficient is less than 1.6%, so that the primer probe group and the kit provided by the application have high stability and good repeatability. BRIEF DESCRIPTION OF DRAWINGS
[0027] Figure 1 It is a standard curve diagram of the goose circovirus fluorescent quantitative PCR in the embodiment 4 of the application;
[0028] Figure 2 It is a standard curve diagram of the duck circovirus type II fluorescent quantitative PCR in the embodiment 4 of the application;
[0029] Figure 3 It is a goose circovirus fluorescent quantitative PCR sensitivity detection curve diagram in the embodiment 5 of the application; wherein, 1-10 are respectively different concentration goose circovirus plasmid amplification curves, and the concentrations of 1 to 10 are respectively: 2.46*10 11 copies / μL, 2.46*10 10 copies / μL, 2.46*10 9 copies / μL, 2.46*10 8 copies / μL, 2.46*10 7 copies / μL, 2.46*10 6 copies / μL, 2.46*10 5 copies / μL, 2.46*10 4 copies / μL, 2.46*10 3 copies / μL and
[0030] 2.46*10 2 copies / μL;
[0031] Figure 4 It is a duck circovirus type II fluorescent quantitative PCR sensitivity detection curve diagram in the embodiment 5 of the application; wherein, 1-10 are respectively different concentration duck circovirus type II virus plasmid amplification curves, and 1 to 10 are respectively: 2.5*10 11 copies / μL, 2.5*10 10 copies / μL, 2.5*10 9copies / μL, 2.5 x 10 8 copies / μL, 2.5 x 10 7 copies / μL, 2.5 x 10 6 copies / μL, 2.5 x 10 5 copies / μL, 2.5 x 10 4 copies / μL, 2.5 x 10 3 copies / μL, and 2.5 x 10 2 copies / μL.
[0032] Figure 5 The electrophoretogram of ordinary PCR of Example 5 of the present application; wherein lane 1 is a negative control; lanes 2-10 are 10 1 , 10 2 , 10 3 , 10 4 , 10 5 , 10 6 , 10 7 , 10 8 , and 10 9 dilution electrophoretograms, respectively.
[0033] Figure 6 The double fluorescent quantitative PCR specificity detection curve chart of Example 6 of the present application; wherein A is the amplification result of goose circovirus; B is the amplification result of duck circovirus type II. DETAILED DESCRIPTION
[0034] The embodiments are provided to better illustrate the present application, but are not intended to limit the present application to only the embodiments. Therefore, the skilled in the art can make non-essential improvements and adjustments to the embodiments according to the above disclosure, which still fall within the protection scope of the present application.
[0035] The terms used herein are used only to describe specific embodiments and are not intended to limit the present disclosure. Unless there is a clear different meaning in the context, the singular form includes the plural form. As used herein, it is understood that terms such as "include", "have", "contain", etc. are intended to indicate the presence of features, numbers, operations, components, parts, elements, materials, or combinations. The terms of the present application are disclosed in the specification, and are not intended to exclude the possibility that one or more other features, numbers, operations, components, parts, elements, materials, or combinations thereof can exist or can be added. As used herein, " / " can be interpreted as "and" or "or" depending on the circumstances.
[0036] In a first aspect, the embodiments of the present application provide a double fluorescent quantitative PCR primer probe set for detecting goose circovirus and duck circovirus type II, the fluorescent quantitative PCR primer probe set comprising the following primer pairs and probes:
[0037] a goose circovirus upstream primer GoCV-F, the sequence of the primer GoCV-F being shown as SEQ ID NO. 1;
[0038] a goose circovirus downstream primer GoCV-R, the sequence of the primer GoCV-R being shown as SEQ ID NO. 2;
[0039] a goose circovirus probe GoCV-Probe, the sequence of the probe GoCV-Probe being shown as SEQ ID NO. 3;
[0040] a duck circovirus type II upstream primer DuCV-II-F, the sequence of the primer DuCV-II-F being shown as SEQ ID NO. 4;
[0041] a duck circovirus type II downstream primer DuCV-II-R, the sequence of the primer DuCV-II-R being shown as SEQ ID NO. 5;
[0042] a duck circovirus type II probe DuCV-II-Probe, the sequence of the probe DuCV-II-Probe being shown as SEQ ID NO. 6.
[0043] It should be noted that the present application selects the domestic epidemic genes in the past five years according to the published GoCV and DuCV-II sequences on NCBI, designs two pairs of primers and two probes respectively, and applies the fluorescent quantitative TaqMan probe PCR to detect the related pathogens, the standard curve equation of GoCV is Y = -3.609X + 46.932, the correlation coefficient R 2 = 1, and the amplification efficiency E = 89.261%; the standard curve equation of DuCV-II is Y = -3.501X + 45.844, the correlation coefficient R 2 = 1, and the amplification efficiency E = 93.041%. The minimum detection amount of GoCV is 2.46 x 10 2 copies / μL, the minimum detection amount of DuCV-II is 2.5 x 10 2 copies / μL, the sensitivity is high, the specificity is good, and the batch and inter-batch variation coefficients are less than 1.6%.
[0044] In some specific examples, in the fluorescent quantitative PCR primer probe set, the 5' end of the GoCV-Probe is labeled with a fluorescent gene FAM, and the 3' end is labeled with a quenching gene BHQ1; the 5' end of the DuCV-II-Probe is labeled with a fluorescent gene VIC, and the 3' end is labeled with a quenching gene BHQ1.
[0045] It should be noted that in the fluorescent quantitative PCR primer probe set in the present application, the 5' end and the 3' end of the probe are labeled with a fluorescent gene and a quencher gene respectively, and the fluorescent gene and the quencher gene are well known in the art, and the above selection is preferred.
[0046] In a second aspect, the embodiments of the present application provide a detection reagent for detecting goose circovirus and duck circovirus type II, and the detection reagent comprises the fluorescent quantitative PCR primer probe set.
[0047] It should be noted that the fluorescent quantitative PCR primer probe set in the present application can be prepared into a detection reagent for detecting goose circovirus and duck circovirus type II.
[0048] In some specific examples, in the detection reagent, the concentration of each primer is 35-45 pmol / μL, and the concentration of each probe is 15-25 pmol / μL.
[0049] It should be noted that in the detection reagent, the concentration of each primer is 35-45 pmol / μL, for example, 37 pmol / μL, 40 pmol / μL or 43 pmol / μL, etc., and the concentration of each probe is 15-25 pmol / μL, for example, 17 pmol / μL, 20 pmol / μL or 23 pmol / μL, etc.
[0050] In some specific examples, the detection reagent further comprises one or more of a DNA buffer, a DNA enzyme mix, a positive quality control or a negative quality control.
[0051] It should be noted that the detection reagent in the present application further comprises conventional reagents for fluorescent quantitative PCR amplification, such as one or more of a DNA enzyme mix, a positive quality control or a negative quality control.
[0052] In some specific examples, in the detection reagent, the preparation method of the positive quality control comprises:
[0053] (1) using a primer pair to perform PCR amplification with GoCV and DuCV-II genes as templates, and purifying to obtain a purified product;
[0054] (2) using pMD18-T to perform vector connection on the purified product to obtain a recombinant plasmid;
[0055] (3) introducing the recombinant plasmid into a recipient bacterial cell, and then performing screening and identification of the recombinant plasmid to obtain a positive quality control.
[0056] It should be noted that in step (1), the reaction procedure of PCR amplification can be: 95℃ pre-denaturation for 5min; the cycle reaction includes 95℃ for 30s, 58℃ for 30s, 72℃ for 30s, and a total of 35 cycles; 72℃ for 10min for sufficient extension.
[0057] In a third aspect, the embodiments of the present application provide a detection kit for detecting goose circovirus and duck circovirus type II, which comprises the detection reagent described above.
[0058] It should be noted that, in order to facilitate transportation and storage, the detection reagent can be prepared in the form of a kit, and the form of the kit is known in the art.
[0059] In a fourth aspect, the embodiments of the present application provide application of the fluorescent quantitative PCR primer probe set described above in preparation of a detection product for detecting goose circovirus and duck circovirus type II.
[0060] In a fifth aspect, the embodiments of the present application provide application of the fluorescent quantitative PCR primer probe set described above in preparation of a diagnostic product for diagnosing goose circovirus and / or duck circovirus type II infection disease.
[0061] In a sixth aspect, the embodiments of the present application provide a method for detecting goose circovirus and / or duck circovirus type II for non-therapeutic purposes, which comprises: using the fluorescent quantitative PCR primer probe set described above to perform double real-time fluorescent PCR amplification on nucleic acid of a sample to be detected; judging the goose circovirus and / or duck circovirus type II to be negative or positive according to the Ct value; wherein the sample to be detected is negative when the Ct value of the nucleic acid is greater than 38, and the sample to be detected is positive when the Ct value of the nucleic acid is less than or equal to 38.
[0062] It should be noted that the fluorescent quantitative PCR primer probe set for detecting goose circovirus and duck circovirus type II provided by the present application has good specificity for goose circovirus and duck circovirus type II, and can simultaneously detect goose circovirus and duck circovirus type II which are widely spread in waterfowl; the kit provided by the present application contains a GoCV / DuCV-Ⅱ positive plasmid standard, the GoCV / DuCV-Ⅱ standard is gradient-diluted and amplified, and the results show that there is a good linear relationship between the standards of different concentrations, which meets the expected results; the standard is diluted to 10 1 -10 10 times, and the reaction system provided by the present application is used to detect it to determine the minimum detection limit, the minimum detection amount of GoCV is 2.46x10 2 copies / μL, and the minimum detection amount of DuCV-Ⅱ is 2.5x10 2The real-time fluorescent quantitative PCR amplification of the standard sample shows that the batch variation coefficient is less than 1%, and the batch variation coefficient is less than 1.6%, so the primer probe group and the kit provided by the application have high stability and good repeatability.
[0063] In order to better understand the application, the application will be further illustrated below in combination with specific examples, but the application is not limited to the following examples.
[0064] Example 1 Synthesis and design of primers
[0065] The synthesis and design process of the primers provided by the application is as follows:
[0066] According to the sequences of goose circovirus and duck circovirus type II virus published on NCBI, the genes of domestic epidemic strains in the past five years are selected, and two pairs of primers and two probes are designed, and the sequences of the two viruses and the designed primer pairs and probe sequences are shown in Table 1, wherein the 5' end of GoCV-Probe is labeled with fluorescent gene FAM, and the 3' end is labeled with quencher gene BHQ1; the 5' end of DuCV-II-Probe is labeled with fluorescent gene 5'VIC, and the 3' end is labeled with quencher gene BHQ1.
[0067] Table 1 Designed primer pairs and probes and primer pairs of goose circovirus and duck circovirus type II virus genes
[0068] Introduction Sequence Number GoCV-fwd 5' CGTCTGTATCGTCGTCTCCG 3' SEQ ID NO. 1 GoCV-rev 5' TGTAACGGTTTCTGTCCCCG 3' SEQ ID NO. 2 GoCV-probe 5' ACAGCGGCATGATGGGCAGT 3' SEQ ID NO. 3 DuCV-II-fwd 5' TCACCGTTGAGCCTTGAGTC 3' SEQ ID NO. 4 DuCV-II-rev 5' GGCTCAACACCGTTCTACC 3' SEQ ID NO. 5 DuCV-II-probe 5' TGCCGGTCTGAGAGTTATGGCT 3' SEQ ID NO. 6 GoCV-fwd 5' TGCCTGCCATTTGTTCTTGT 3' SEQ ID NO. 7 GoCV-rev 5' CATCACAACCACATCCTGCC 3' SEQ ID NO. 8 DuCV-II-fwd 5' ATGGACGACTTTTATGGTTG 3' SEQ ID NO. 9 DuCV-II-rev 5' TAGGAGGAGGAGGCGGAGT 3' SEQ ID NO. 10
[0069] Example 2 Preparation of plasmid standard
[0070] The application provides a plasmid standard, and the preparation method is as follows:
[0071] (1) PCR amplification and purification of the target fragment
[0072] Using Table 1 SEQ ID NO. 7-SEQ ID NO. 10, the concentration of each upstream primer and each downstream primer is 10 muM, and the target fragment is amplified using the GoCV and DuCV-II gene template, and the PCR reaction program is as follows: 95 DEG C pre-denaturation for 5 min; the cycle reaction includes 95 DEG C for 30 s, 58 DEG C for 30 s, 72 DEG C for 30 s, a total of 35 cycles; 72 DEG C for 10 min for sufficient extension; the PCR reaction system is shown in Table 2.
[0073] Table 2 PCR reaction system
[0074] Component Amount (μL) Upstream primer 1 Downstream primer 1 2 × Taq Master Mix 12.5 Sample DNA 2 ddH2O 8.5 Total system 25
[0075] After the PCR procedure, all PCR products were loaded into 2% agarose gels containing Goldview and electrophoresed for 30 min. The bands of interest were excised under UV light and the gel was recovered using a QIAquick Gel Extraction Kit (Binding Buffer and Wash Buffer were from the kit) according to the following steps:
[0076] (1-1) The gel slice containing the DNA fragment was excised with a clean scalpel or razor blade, cutting as close to the DNA as possible to minimize the gel volume. The gel slice was weighed in a pre-weighed 1.5 mL tube and the weight of the gel slice was recorded;
[0077] (1-2) 1:1 volume of Binding Buffer (volume: weight, e.g. 100 μΐ of Binding Buffer per 100 mg of agarose gel) was added to the gel slice;
[0078] (1-3) The gel mixture was incubated at 55°C for 10 min or until the gel slice was completely dissolved. The tube was inverted every few minutes to facilitate the melting process. Make sure the gel is completely dissolved; briefly vortex the gel mixture before loading. Check the color of the solution. Yellow indicates the optimal pH for DNA binding;
[0079] (1-4) Up to 800 μΐ of the dissolved gel solution from the previous step was transferred to a GeneJET Purification Column. Centrifuge for 1 min at 12,000 rpm; discard the flow-through and place the spin column back into the same collection tube;
[0080] (1-5) Add 100 μΐ of Binding Buffer, centrifuge for 1 min, discard the flow-through and place the spin column back into the same collection tube;
[0081] (1-6) Add 700 μΐ of Wash Buffer to the GeneJET Purification Column; centrifuge for 1 min at 12,000 rpm. Discard the flow-through and place the spin column back into the same collection tube;
[0082] (1-7) Centrifuge the empty GeneJET Purification Column for 1 min at 12,000 rpm to completely remove residual wash buffers;
[0083] (1-8) Transfer the GeneJET Purification Column to a clean 1.5 mL microcentrifuge tube; add 40 μΐ of DEPC water to the center of the purification column membrane; centrifuge for 1 min at 12,000 rpm;
[0084] (1-9) Discard the GeneJET Purification Column to obtain the PCR purified product and check its concentration. Store the purified DNA at -20°C.
[0085] (2) Connection of the target fragment
[0086] The PCR product obtained in the above (1) was connected to a vector according to the instruction of pMD18-T Vector of Tarkara Company. The reaction system is shown in Table 3. After mixing the reagents shown in Table 3, the mixture was placed in a PCR instrument at 16°C for 4h and at 4°C overnight, thereby obtaining the connection product.
[0087] Table 3. Reaction system for vector connection
[0088] Component Amount (μL) PCR recovery product 4 pMD18-T vector 1 Ligation solution 5 Total system 10
[0089] (3) Introduction of the recombinant plasmid into the recipient bacterial cell
[0090] (3-1) The connection product obtained in the above step (2) was added into 50 μL top10 competent cells, respectively;
[0091] (3-2) The connection product and the competent cells were mixed gently, and then immediately placed in an ice bath for 30 min, followed by heating at 42°C for 45 s and then immediately placed in an ice bath for 2 min;
[0092] (3-3) 400 μL fresh LB liquid medium was added into each tube, and the mixture was cultured in a 37°C incubator with slow shaking for 1h;
[0093] (3-4) 100 μL bacterial solution was taken and spread on a 1.5% (W / V) LB agar plate containing Amp (100 μg / mL), and then cultured at 37°C for 16h.
[0094] (4) Screening and identification of the recombinant plasmid
[0095] The well-grown single colony in the above step (3) was picked into 500 μL LB liquid medium containing ampicillin (AMP), and then cultured in a 37°C constant-temperature shaker for 6h. The bacterial solution suspected to be positive was taken as a template for PCR identification. The reaction system for PCR identification is shown in Table 4. The PCR reaction program was as follows: pre-denaturation at 95°C for 5 min; cycle reaction including 95°C for 30 s, 58°C for 30 s, 72°C for 30 s, for a total of 35 cycles; and full extension at 72°C for 10 min. The positive bacterial solution screened was sent to Shengong Bioengineering Co., Ltd. for sequencing.
[0096] Table 4. Reaction system for PCR identification
[0097]
[0098]
[0099] (5) Extraction of the positive plasmid
[0100] The bacterial liquid with correct sequencing results in step (4) above was named 18T-GoCV and 18T-DuCV-II and was cultured in large quantities. The Novozyme plasmid extraction kit was used for plasmid extraction, and the specific steps were as follows:
[0101] (5-1) Cultivation of E. coli: single colonies were selected from the plate medium and inoculated into 5 ml of LB liquid medium containing ampicillin (AMP), and cultured at 37°C overnight (cultured for 16 hours);
[0102] (5-2) 5 ml of the overnight culture was centrifuged at 12000 rpm for 5 minutes, and the supernatant was discarded;
[0103] (5-3) 250 μL Buffer P1 was added to the centrifuge tube containing the bacterial pellet, and mixed well with a pipette or vortex;
[0104] (5-4) 250 μL Buffer P2 was added to step (5-3), and mixed gently for 10 times to fully lyse the bacteria;
[0105] (5-5) 350 μL Buffer P3 was added to step (5-4), and immediately mixed gently for 10 times to completely neutralize Buffer P2; at this time, a white flocculent precipitate should appear. Centrifuge at 13,000 x g for 10 min;
[0106] (5-6) The FastPure DNA Mini Columns adsorption column was placed in a 2 ml collection tube. The supernatant of step (5-5) was carefully transferred to the adsorption column with a pipette, taking care not to suck the precipitate, and centrifuged at 13,000 x g for 1 min. Discard the waste liquid in the collection tube, and place the adsorption column back into the collection tube;
[0107] (5-7) 500 μl Buffer PW1 was added to the adsorption column, and centrifuged at 12000 rpm (13,400 x g) for 60 sec; discard the waste liquid, and place the adsorption column back into the collection tube;
[0108] (5-8) 600 μL Buffer PW2 was added to the adsorption column, and centrifuged at 13000 x g for 1 min; discard the waste liquid, and place the adsorption column back into the collection tube;
[0109] (5-9) Repeat step (5-8);
[0110] (5-10) Place the adsorption column in a new sterile 1.5 ml centrifuge tube. Add 30-100 μL Elution Buffer to the center of the membrane of the adsorption column; stand at room temperature for 2 min, and centrifuge at 13000 g for 1 min to elute the DNA.
[0111] (5-11) Discard the adsorption column, and store the DNA product at -20℃ to prevent DNA degradation.
[0112] The plasmid concentration is measured by using a micro-ultra fluorescence spectrophotometer, and the gene copy number (copies / μL) is calculated according to the formula: gene copy number (copies / μL) = 6.02 x 10 23 x plasmid concentration (ng / μL) x 10 -9 / [plasmid size (bp) x 660].
[0113] Example 3 Construction of a detection method for goose circovirus and duck circovirus type II by using primers and probes of the application
[0114] The application provides a detection method for goose circovirus and duck circovirus type II by using the primers and probes related to Example 1, and the detection method is as follows:
[0115] (1) Nucleic acid extraction
[0116] (1-1) Prepare a DN0623 nucleic acid extraction kit, which is purchased from Guangzhou Dan Gene Biotechnology Co., Ltd.
[0117] (1-2) Take out a pre-packaged 96-deep-well plate from the kit, invert and mix several times, and then gently shake the well plate to make the reagents and magnetic beads concentrate at the bottom of the well plate.
[0118] (1-3) Add 200 μL of samples and 20 μL of proteinase K in the first and seventh columns of the 96-deep-well plate in sequence.
[0119] (1-4) Turn on a Smart32Plus full-automatic nucleic acid extractor.
[0120] (1-5) Perform nucleic acid extraction according to the nucleic acid extraction reaction program in Table 5 below.
[0121] Table 5 Automatic nucleic acid extraction reaction program
[0122]
[0123] (1-6) After the program is run, the liquid in the sixth column and the twelfth column is the nucleic acid solution.
[0124] (1-7) Harvest the nucleic acid and store it at -20℃.
[0125] (2) Double fluorescent real-time PCR for goose circovirus and duck circovirus type II
[0126] The nucleic acid extracted in the above (1) is subjected to fluorescent real-time PCR amplification, and the fluorescent real-time PCR amplification reaction system is shown in Table 6 below, and the reaction program is as follows: 50℃, 2min, 95℃, 15min; 94℃, 15s, 55℃, 45s, 40 cycles.
[0127] Table 6 Dual-fluorescence real-time PCR amplification reaction system
[0128]
[0129]
[0130] (3) Result determination
[0131] Negative: A Ct value greater than 38 indicates a negative result.
[0132] Positive: A sample is considered positive if its Ct value is less than or equal to 38.
[0133] Example 4: Construction of Dual-Fluorescence Quantitative PCR Reaction System and Standard Curve
[0134] The GoCV and DuCV-II plasmids prepared in Example 2 were mixed at a 1:1 ratio and serially diluted 10-fold with sterile purified water to obtain 10 11 -10 1 A total of 10 dilutions of the standard were prepared, and GoCV will use 2.46 × 10⁻⁶ samples. 11 copies / μL - 2.46 × 10 2 Copies / μL of this material served as a reaction template; DuCV-II used 2.5 × 10⁻⁶ copies / μL. 11 copies / μL - 2.5 × 10 2 The copies / μL were used as the reaction template, with 3 replicates for each dilution and a negative control established. The reaction system is shown in Table 6 above;
[0135] The constructed GoCV standard curve is as follows Figure 1 As shown, the standard curve equation is Y = -3.609X + 46.932, and the correlation coefficient R0 is... 2 =1, amplification efficiency E = 89.261%; the constructed DuCV-II standard curve is as follows Figure 2 As shown, the standard curve equation is Y = -3.501X + 45.844, and the correlation coefficient R0 is... 2 =1, amplification efficiency E = 93.041%; moreover, the results showed a good linear relationship between different concentrations of standards, where the X-axis is the copy number of the plasmid standard and the Y-axis is the cycle threshold, which is in line with the expected results.
[0136] Example 5 Sensitivity Experiment
[0137] GoCV will convert 2.46×10 11 copies / μL - 2.46 × 10 1 Copies / μL were used as a reaction template, and DuCV-II was used to prepare 2.5 × 10⁻⁶ μL of the product.11 copies / μL-2.5×10 1 copies / μL, and the positive standard sample of DuCV-II was 2.5×10 2 copies / μL. The ordinary PCR amplification system is shown in Table 7, and the ordinary PCR reaction program is as follows: 95°C pre-denaturation for 5 min; the cycle reaction includes 95°C for 30 s, 58°C for 30 s, 72°C for 30 s, and a total of 35 cycles; 72°C for 10 min for sufficient extension.
[0138] Table 7 PCR reaction system
[0139] Component Amount (μL) GoCV upstream primer 1 GoCV downstream primer 1 DuCV upstream primer 1 DuCV downstream primer 1 2 × Taq Master Mix 12.5 Sample DNA 2 ddH2O 6.5 Total system 25
[0140] The results of the double real-time fluorescent quantitative PCR are shown in Figure 3 and Figure 4 The double fluorescent quantitative PCR reaction system constructed in Example 3 can detect the minimum detection amount of the positive standard sample of GoCV as 2.46×10 2 copies / μL, and the minimum detection amount of the positive standard sample of DuCV-II as 2.5×10 2 copies / μL.
[0141] In addition, the results of the ordinary PCR amplification are shown in Figure 5 The M lane in the figure is DL100 DNA Marker; the 4-10 lanes are respectively samples of GoCV (2.46×10 1 copies / μL-2.46×10 9 copies / μL), and samples of DuCV-II (2.5×10 1 copies / μL-2.5×10 9 copies / μL); and the 1 lane is a negative control.
[0142] From the above comparison, it can be known that the minimum detection amount of GoCV ordinary PCR is 2.46×10 4 copies / μL, and the minimum detection amount of DuCV-II ordinary PCR is 2.5×10 4 copies / μL. Compared with the ordinary PCR detection method, the double real-time fluorescent quantitative PCR detection method established in Example 3 is about 100 times higher in sensitivity.
[0143] Example 6 Specificity experiment
[0144] The double real-time fluorescent quantitative PCR method constructed in Example 3 was used to amplify egg drop syndrome virus (EDSV), duck Tembusu virus (DTMUV), avian adenovirus (FAdV 4-sh, FAdV 8a-nt, FAdV 8b-dl17, FAdV 11-hn), avian reovirus (ARV), duck new reovirus (NDRV), goose astrovirus (GAstV), avian encephalomyelitis virus (AEV), duck hepatitis A virus type III (DHAV-III), and mandarin duck reovirus (MDRV), to verify the specificity of the double fluorescent quantitative PCR reaction system provided in Example 3.
[0145] The results are shown in Table 7. Figure 6 As shown in Table 7, the results show that the double fluorescent quantitative PCR reaction system provided in Example 3 has specific amplification for goose circovirus and duck circovirus type II, and has no fluorescent signal for EDSV, DTMUV, FAdV4-sh, FAdV 8a-nt, FAdV 8b-dl17, FAdV 11-hn, ARV, NDRV, GAstV, AEV, DHAV-III, and MDRV. However, the Ct values of EDSV are all after 38, so the method is positive when the Ct value is less than or equal to 38, and is negative when the Ct value is greater than 38.
[0146] Example 7 Reproducibility test
[0147] The GoCV plasmid and DuCV-II plasmid obtained in Example 2 were prepared into two different batches of plasmids, respectively, and five dilution degrees were selected for real-time fluorescent quantitative PCR amplification of intra-batch and inter-batch repeats, to compare the changes of Ct values and verify the stability of the method. The intra-batch and inter-batch coefficients of variation were used to evaluate the stability of the method. As shown in Tables 8 and 9, the intra-batch coefficient of variation was less than 1%, and the inter-batch coefficient of variation was less than 1.6%, indicating good reproducibility.
[0148] Table 8 Results of fluorescent quantitative PCR reproducibility test of DuCV-II
[0149]
[0150] Table 9 Results of fluorescent quantitative PCR reproducibility test of GoCV
[0151]
[0152] Finally, it should be pointed out that the above examples are only used to illustrate the technical solutions of the present application and are not limiting. Although the present application has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that the technical solutions of the present application can be modified or replaced equivalently without departing from the purpose and scope of the technical solutions of the present application, and they should all be covered in the scope of the claims of the present application.
Claims
1. A fluorescent quantitative PCR primer probe set for detecting goose circovirus and duck circovirus type II, characterized in that, The double fluorescent quantitative PCR primer probe set comprises the following primer pairs and probes: An upstream primer of goose circovirus, GoCV-F, wherein the sequence of the primer GoCV-F is shown as SEQ ID NO. 1; A downstream primer of goose circovirus, GoCV-R, wherein the sequence of the primer GoCV-R is shown as SEQ ID NO. 2; A goose circovirus probe, GoCV-Probe, wherein the sequence of the GoCV-Probe is shown as SEQ ID NO. 3; An upstream primer of duck circovirus type II, DuCV-II-F, wherein the sequence of the primer DuCV-II-F is shown as SEQ ID NO. 4; A downstream primer of duck circovirus type II, DuCV-II-R, wherein the sequence of the primer DuCV-II-R is shown as SEQ ID NO. 5; A duck circovirus type II probe, DuCV-II-Probe, wherein the sequence of the DuCV-II-Probe is shown as SEQ ID NO.
6.
2. The quantitative PCR primer probe set according to claim 1, characterized in that, The 5' end of the GoCV-Probe is labeled with a fluorescent gene FAM, and the 3' end is labeled with a quencher gene BHQ1; the 5' end of the DuCV-II-Probe is labeled with a fluorescent gene VIC, and the 3' end is labeled with a quencher gene BHQ1.
3. A detection reagent for detecting goose circovirus and duck circovirus type II, characterized in that, The detection reagent comprises the fluorescent quantitative PCR primer probe set of claim 1 or 2.
4. The detection reagent according to claim 3, characterized in that, In the detection reagent, the concentration of each primer is 35-45 pmol / μL, and the concentration of each probe is 15-25 pmol / μL.
5. The detection reagent according to claim 3 or 4, characterized in that, The detection reagent further comprises one or more of a DNA buffer, a DNA enzyme mix, a positive quality control, or a negative quality control.
6. The detection reagent according to claim 5, characterized in that The preparation method of the positive quality control comprises: (1) using the primer pair to perform PCR amplification with GoCV and DuCV-II genes as templates, and purifying to obtain a purified product; (2) using pMD18-T to perform vector connection on the purified product to obtain a recombinant plasmid; (3) introducing the recombinant plasmid into a recipient bacterial cell, and then performing screening and identification of the recombinant plasmid to obtain the positive quality control.
7. A detection kit for detecting goose circovirus and duck circovirus type II, characterized in that, The detection kit comprises the detection reagent of any one of claims 3 to 6.
8. Use of the fluorescent quantitative PCR primer probe set of claim 1 or 2 in the preparation of a detection product for detecting goose circovirus and duck circovirus type II.
9. Use of the fluorescent quantitative PCR primer probe set of claim 1 or 2 in the preparation of a diagnostic product for diagnosing goose circovirus and / or duck circovirus type II infection disease.
10. A method for detecting goose circovirus and / or duck circovirus type II for non-therapeutic purposes, characterized in that, The method comprises: using the fluorescent quantitative PCR primer probe set of claim 1 or 2 to perform double real-time fluorescent PCR amplification on nucleic acids of a sample to be detected; and judging the goose circovirus and / or duck circovirus type II to be negative or positive according to the Ct value; wherein the sample to be detected is negative when the Ct value of the nucleic acids is > 38, and the sample to be detected is positive when the Ct value of the nucleic acids is ≤ 38.
Citation Information
Patent Citations
Kit for visually detecting goose circovirus based on LAMP-CRISPR / Cas12a and application
CN119979768A
Simple nucleic acid extraction device
CN221501050U
Cyclovirus and methods of use
US20120100168A1
Cited By
Reagent combination for detecting DuCV and GoCV based on dual ERA-LFA and application thereof
CN121575163A