RNAi-based bio-switchable siRNA delivery composite material and preparation method and application thereof

Abstract

The invention belongs to the technical field of biological medicine, and particularly relates to a biological switchable siRNA delivery composite material based on RNAi and a preparation method and application thereof. The invention designs a novel biological switchable siRNA delivery system (BiRDS) based on RNAi (Ribonucleic Acid Interference) by combining good endocytosis performance and stability of tetrahedral framework nucleic acid and gene targeting specificity of siRNA, the system consists of three siRNAs (three magic birds) and a nucleic acid core (central sun), and by loading small interfering RNA to target casein kinase 2 interacting protein 1 (siCkip-1), the novel biological switchable siRNA delivery system (BiRDS) based on RNAi is obtained. The siRNA is specifically delivered to the bone formation surface, the loading capacity is improved to the maximum extent, the kip gene is efficiently silenced, cell proliferation and migration are promoted, the good osteogenesis induction effect is achieved, and a new thought is provided for treatment of maxillofacial bone defects.

Description

Technical Field

[0001] This invention belongs to the field of biomedical technology, specifically relating to an RNAi-based bio-switchable siRNA delivery composite material, its preparation method, and its applications. Background Technology

[0002] Critical size defects (CSDs) in the maxillofacial region caused by trauma, infection, or tumor resection can have a range of impacts on a patient's function and appearance. CSDs cannot heal completely on their own; therefore, promoting defect repair through external interventions is currently a hot research topic in the field of bone regeneration.

[0003] CKIP-1, also known as Plekho1, is a regulatory protein that has been found in recent years to exhibit various biological functions in cell morphology, cell proliferation, and apoptosis, and plays different regulatory roles in different physiological processes (such as tumorigenesis, osteogenesis, and immune regulation). It can interact with various proteins and signaling pathways through different domains, including PAK1, Arp2 / 3, c-Jun, ATM, Smurf1, and Akt. Currently, only the effect of reducing CKIP-1 on improving primary or secondary osteoporosis and distraction osteogenesis has been confirmed; however, it has not yet been applied to borderline bone defects such as jawbone defects, and the subsequent regulatory mechanisms of CKIP-1 remain unclear.

[0004] Among the many regulatory technologies used to promote bone defect repair, RNA interference (RNAi) is a natural cellular process that regulates gene expression through a highly precise and sequence-targeted gene silencing mechanism. Theoretically, it can be used to target any disease-causing gene. RNAi is highly targeted and efficient; siRNA can efficiently silence specific genes, accurately inhibiting the expression of target genes with high specificity, without affecting other genes, and can rapidly degrade the mRNA of the target gene, resulting in significant therapeutic effects. Therefore, RNAi therapy targeting genes that negatively regulate bone formation may be a very promising research direction for clinical application in treating diseases related to bone defects.

[0005] However, it is well known that siRNAs have a limited half-life in the bloodstream because they are rapidly degraded and cleared, which hinders the widespread application of siRNA-based therapies. Furthermore, achieving optimal bone-stimulating therapeutic effects requires high-dose systemic administration of siRNA, which carries the risk of adverse effects on non-skeletal tissues, posing a significant challenge to this field.

[0006] Tetrahedral nucleic acid frameworks (tFNAs) consist of four independent DNA strands with specific base sequences. Through an annealing process, they self-assemble based on Watson-Crick base pairing to form a tetrahedral DNA nanostructure with excellent stability and cellular uptake capacity. tFNAs also exhibit strong cell proliferation-promoting, anti-inflammatory, and antioxidant properties. Traditional first-generation tetrahedra use pre-designed sticky end sequences to pair with the sticky ends of RNA at the apex for RNA delivery. However, RNA bound to the outside of the tFNA structure still faces challenges during drug delivery. For example, the binding of sticky ends can enlarge the relatively small tetrahedral nanostructure, affecting the optimal efficiency and stability of tFNA delivery to cells. To further improve these issues, our research group designed a third-generation tetrahedron, a novel bio-switchable miR inhibitor delivery system (BiRDS). Inspired by the ancient Chinese myth of the sun and celestial birds, this structure consists of three miR inhibitors (three celestial birds) and a nucleic acid core (the central sun). The fusion of miR inhibitors within the tetrahedral framework significantly enhances its stability and RNA loading capacity without increasing the size of the tetrahedral structure, preserving the excellent tissue penetration and cellular uptake inherent in its extremely small size. Upon entering the cell, it immediately undergoes conformational changes via the RNase H reaction sequence on the "bird's" tail, releasing the carried RNA to exert its function. This greatly enhances the delivery system's protective effect against RNA, which is crucial for bone defect recovery.

[0007] In summary, while RNAi therapy can target and silence specific genes, it suffers from limitations such as poor cell membrane penetration, instability, and short half-life of siRNA. Therefore, there is an urgent need to develop an siRNA delivery system with low toxicity, high stability, and efficient cellular uptake capacity to improve the efficacy and safety of repairing critical-sized bone defects. Summary of the Invention

[0008] To address the problems of existing technologies, this invention provides a bio-switchable siRNA delivery composite material based on RNAi, its preparation method, and its applications.

[0009] A bio-switchable siRNA delivery system based on RNAi, characterized in that: the system consists of siRNA and a nucleic acid core, wherein the nucleotide sequence of the antisense chain of the siRNA is shown in SEQ ID NO.4.

[0010] Preferably, it consists of 3 siRNAs and 1 nucleic acid core;

[0011] Preferably, the above-mentioned nucleic acid core consists of three DNA single strands, whose nucleotide sequences are shown in SEQ ID NO.1, SEQ ID NO.2, and SEQ ID NO.3, respectively.

[0012] The present invention also provides a method for preparing the above-mentioned RNAi-based bio-switchable siRNA delivery system, comprising the following steps: mixing three DNA single strands with the siRNA and incubating to obtain the product.

[0013] Preferably, the molar ratio of the three DNA single strands is 1:1:1, and the molar ratio of any one DNA single strand to the siRNA is 1:3.

[0014] The present invention also provides the use of the above-described novel bio-switchable siRNA delivery system based on RNAi in the preparation of drugs for treating critical-sized bone defects in the maxillofacial region.

[0015] Preferably, the drug is used to promote the proliferation and / or migration of BMSCs cells;

[0016] Preferably, the drug is used to promote bone formation and / or repair;

[0017] Preferably, the drug promotes the expression of osteogenic-related proteins.

[0018] The present invention also provides a medicament for treating maxillofacial bone defects, which is made by adding pharmaceutically acceptable excipients to the above-mentioned RNAi-based bioswitchable siRNA delivery system as the active ingredient.

[0019] In this invention, the Bioswitchable siRNA System (BiRDS) refers to a bioswitchable miR inhibitor delivery system (BiRDS) designed by the inventors' team to improve the loading efficiency of tFNA. The concept of this system originates from the ancient Chinese legend of the "Sun and Divine Bird Delivery System." It consists of three miRNA inhibitors and a nucleic acid core; the former metaphorically represents the "BiRDS Divine Bird," and the latter symbolizes the "central sun." Unlike traditional tFNA, BiRDS cleverly integrates miRNA inhibitors into a tetrahedral scaffold, significantly improving its structural stability and RNA loading capacity. However, BiRDS has not yet been used to load siRNAs for disease treatment, and its ability to load siRNAs and its subsequent effects in osteogenic biology require further exploration. (Reference: S.Li,Y.Liu,T.Zhang,S.Lin,S.Shi,J.He,Y.Xie,X.Cai,T.Tian,Y.Lin,ATetrahedral Framework DNA-Based Bioswitchable miRNA Inhibitor DeliverySystem:Application to Skin Anti-Aging,Adv Mater,(2022),34,e2204287DOI:10.1002 / adma.202204287.)

[0020] To improve treatment strategies for critical-sized bone defects in the maxillofacial region, this invention designs a novel bio-switchable siRNA system carrying siCkip-1, which specifically targets the bone surface, efficiently silences the ckip gene, maximizes loading capacity, promotes cell proliferation and migration, and has a good osteogenic induction effect, providing new opportunities and methods for the clinical treatment of jawbone defects and critical bone defects in other sites.

[0021] Obviously, based on the above description of the present invention, and according to common technical knowledge and conventional methods in the field, various other modifications, substitutions or alterations can be made without departing from the basic technical concept of the present invention.

[0022] The following detailed embodiments further illustrate the above-described content of the present invention. However, this should not be construed as limiting the scope of the present invention to the following examples. All technologies implemented based on the above-described content of the present invention fall within the scope of the present invention. Attached Figure Description

[0023] Figure 1Synthesis, validation, characterization, and stability of BiRDS. (A) Schematic diagram of BiRDS structure. (B) Agarose gel electrophoresis confirming the successful synthesis of BiRDS. (C, D) Distribution and morphology of tFNA and BiRDS detected by transmission electron microscopy and atomic force microscopy. (E, I) Nanoscale distribution and Zeta potential of tFNA and BiRDS. (F) Stability of BiRDS detected. (G, H) Cell entry efficiency of siRNA, tFNA, and BiRDS detected by confocal microscopy and flow cytometry (Red: Cy5; Blue: Nucleus; Green: Cytoskeleton. Scale bar: 20 μm).

[0024] Figure 2 The effects of siRNA, tFNA, and BiRDS on BMSC cell proliferation were investigated using a scratch assay.

[0025] Figure 3 The effects of siRNA, tFNA, and BiRDS on BMSCs migration were detected using transwell assays.

[0026] Figure 4 The formation of calcium nodules was monitored by alizarin red S staining on day 21.

[0027] Figure 5 Osteogenic differentiation of BMSCs observed by ALP staining on day 14.

[0028] Figure 6 This explains the mechanism of action of BiRDS. Rnase H can recognize the DNA / RNA hybridization region of BiRDS, hydrolyze hydrogen bonds, and change the conformation of BiRDS from a three-dimensional tetrahedral to a two-dimensional dart-shaped conformation. This achieves the separation of the core framework structure and the outer "immortal bird" structure, releasing the "immortal bird" to the target site.

[0029] Figure 7 Protein expression levels and quantification of Ckip-1 and AKT.

[0030] Figure 8 This is a schematic diagram of the BIRDS structure.

[0031] Figure 9 Immunofluorescence images of Ckip-1 and AKT.

[0032] Figure 10 Results of RT-qPCR quantification analysis of Ckip-1 and AKT.

[0033] Figure 11 Protein expression levels and quantification of Smad1 / 5, BMP2, β-catenin, and Wnt3a were analyzed.

[0034] Figure 12 Immunofluorescence images and quantitative analysis results of Smad1 / 5, BMP2, β-catenin, RUNX2, COL-1, and OSX.

[0035] Figure 13 This diagram illustrates the role of BiRDS in silencing Ckip-1 and the Smad-BMP, Wnt3α / β-catenin, and AKT signaling pathways.

[0036] Figure 14 The results show the protein expression levels and semi-quantitative analysis of ALP, RUNX2, OPN, COL-1, and OSX.

[0037] Figure 15 The results of RT-qPCR quantification of Smad1 / 5 and β-catenin are shown.

[0038] Figure 16 3D reconstruction of jawbone defect areas in rats after different treatments at 4 and 8 weeks.

[0039] Figure 17 Quantitative analysis of trabecular bone parameters (relative bone volume (BV / TV), trabecular thickness (Tb.Th), trabecular number (Tb.N), and trabecular separation (Tb.Sp)) in the jawbone defect area of ​​rats after different treatments at 4 and 8 weeks.

[0040] Figure 18 This diagram illustrates the in vivo drug loading method and time points.

[0041] Figure 19 To investigate the distribution and metabolism of Cy5-labeled siRNA and BiRDS materials in rat mandibles at 0, 12, 24, 48, 72, 96, and 120 hours using GELMA hydrogel in situ loading.

[0042] Figure 20 HE and Masson staining images of rat mandibles at 4 and 8 weeks after different treatment groups (scale bar: 200 μm and 100 μm).

[0043] Figure 21 Quantitative statistical graphs of new and mature bone in the mandible of rats at 4 and 8 weeks after different treatments.

[0044] Figure 22 Immunohistochemical staining and quantitative analysis of Ckip protein in the mandibles of rats at 4 and 8 weeks after different treatment groups.

[0045] Figure 23Immunofluorescence staining images and quantitative analysis of fluorescence intensity of β-catenin, AKT, and Smad in the mandible (β-catenin, AKT, Smad: red; cell nuclei: blue; Merge plot) (scale bar: 50 μm)

[0046] Figure 24 Immunofluorescence staining images of ALP, OPN, Col-1, and BMP2 in the mandibles of rats at 4 and 8 weeks after different treatment groups (osteogenic proteins: red; cell nuclei: blue; Merge plot) (scale bar: 50 μm)

[0047] Figure 25 To quantify the percentage of ALP, OPN, Col-1, and BMP2 positive cells based on immunofluorescence images at 4 and 8 weeks.

[0048] Data are expressed as mean ± standard deviation (SD) (n = 3). Statistical analysis: one-tailed < 0.05, two-tailed < 0.01, three-tailed < 0.001. * indicates "compared to the target of the control group", # indicates "compared to the target of the BiRDS group". Detailed Implementation

[0049] In the following examples and experimental cases, reagents and raw materials not specifically described are all commercially available products.

[0050] Example 1: BiRDS and its preparation method

[0051] This embodiment provides a siCkip-1-based bio-switchable siRNA delivery composite material (BiRDS), which consists of three siRNAs and a nucleic acid core.

[0052] The nucleic acid core consists of three nucleic acid chains (S1–3-BiRDS), and its nucleotide sequence S1 is shown in SEQ ID NO.1: ggacuuggAGGATGGGCATGCTCTTCCCGACGGTATT GGACCCTCGCATGAgcaaggaaTAAG;

[0053] The nucleotide sequence S2 is shown in SEQ ID NO.2: ggacuuggACATGCGAGGGTCCAA TACCGACGATTACAGCTTGCTACACGAgcaaggaaTAAG;

[0054] The nucleotide sequence S3 is shown in SEQ ID NO.3: ggacuuggACGTGTAGCAAGCTGT AATCGACGGGAAGAGCATGCCCATCCAgcaaggaaTAAG;

[0055] The siRNA nucleotide sequence is shown in SEQ ID NO.4:

[0056] antisense(5'-3')uuccuugcuaccaagucccuua

[0057] The preparation method is as follows: Equimolar concentrations of S1–3-BiRDS were added to TM buffer (10 mm Tris-HCl and 50 mm MgCl2 dissolved in water, pH adjusted to 8.0 with hydrochloric acid), followed by the addition of three times the concentration of siRNA. The complete oligonucleotide chains were then incubated at 95°C for 10 minutes, followed by 4°C for 20 minutes to synthesize BiRDS. Figure 1 A).

[0058] Comparative Example 1

[0059] This comparative example provides the control sample used in the experiment:

[0060] 1. tFNA

[0061] This sample was assembled from four ssDNAs (S1-4-T) based on base complementarity. Its preparation method was the same as in Example 1.

[0062] The nucleotide sequence of the single-stranded DNA S1 is shown in SEQ ID NO.5:

[0063] ATTTATCACCGCCATAGTAGACGTATCACCAGGCAGTTGAGACGAACATTCCTAAGTCTGAA;

[0064] The single-stranded DNA S2 nucleotide sequence is shown in SEQ ID NO.6:

[0065] ACATGCGAGGGTCCAATACCGACGATTACAGCTTGCTACACGA

[0066] TTCAGACTTAGGAATGTTCG;

[0067] The single-stranded DNA S3 nucleotide sequence is shown in SEQ ID NO.7:

[0068] ACTACTATGGCGGGTGATAAAACGTGTAGCAAGCTGTAATCGA

[0069] CGGGAAGAGCATGCCCATCC;

[0070] The single-stranded DNA S4 nucleotide sequence is shown in SEQ ID NO.8:

[0071] ACGGTATTGGACCCTCGCATGACTCAACTGCCTGGTGATACGA

[0072] GGATGGGCATGCTCTTCCCG.

[0073] 2. siRNA

[0074] This sample contains siRNA that silences the Ckip-1 gene.

[0075] The siCkip-1 nucleotide sequence is shown in SEQ ID NO.4:

[0076] antisense(5'-3')uuccuugcuaccaagucccuua

[0077] The technical solution of the present invention will be further explained through experiments below.

[0078] Experiment 1: Design and Characterization of BiRDS

[0079] This experimental example characterizes the BiRDS system prepared in Example 1.

[0080] I. Experimental Methods

[0081] The assembled tFNA and BiRDS were analyzed and verified by gel-red stained agarose gel electrophoresis (AGE) (120V, 30min) to verify the tetrahedral nanostructure of the materials. The morphology of tFNA and BiRDS was observed using TEM and AFM. The particle size distribution and zeta potential of the two nanoparticles were measured using a Zetasizer Nano ZS90 system (Malvin, UK).

[0082] The stability of BiRDS and tFNA under serum conditions was assessed by mixing nanomaterials with 1–10% fetal bovine serum and incubating at 37°C for 1 hour. The nanomaterials were stored at room temperature (22°C) and 4°C for 1–7 days to evaluate changes in the storage stability of BiRDS and tFNA.

[0083] Cell uptake: BMSCs were seeded onto confocal plates for adhesion and then exposed to appropriate treatment conditions for 12 hours. Subsequently, cells were labeled with DAPI (4,6-diamino-2-benzyl dole) and FITC, and then fixed in 4% paraformaldehyde for 30 minutes. For qualitative observation, fluorescence staining combined with laser confocal microscopy (FV3000, Olympus) was used; for quantitative detection of fluorescence intensity, flow cytometry (FC500, BECKMAN) was employed. All data were analyzed using FLOW JOX software.

[0084] II. Experimental Results

[0085] To demonstrate the efficient synthesis of BiRDS, the 5' end of the siRNA was modified with a sulfocyano5 (Cy5) residue, exhibiting fluorescence. Agarose gel electrophoresis showed that the band size gradually increased with the stepwise assembly and synthesis of the material. Finally, Cy5 fluorescence was observed in lane 8, confirming the successful loading of the siRNA into the BiRDS structure. Figure 1 B).

[0086] Dynamic light scattering (DLS) revealed that the diameters of tFNA and BiRDS were 7.31±0.72 nm and 13.43±0.72 nm, respectively, and their potentials were -6.91±2.97 Mv and -11.84±0.51 Mv, respectively. Figure 1 E, I). The size of BiRDS is only slightly increased compared to tFNA, still maintaining a small nanostructure. Transmission electron microscopy (TEM) and atomic force microscopy (AFM) show that BiRDS is uniformly distributed in solution, exhibiting a stable triangular structure. Figure 1 C, D).

[0087] First, a drug-serum stability experiment was performed. 2% fetal bovine serum (FBS) was added to BiRDS to simulate the serum environment during subsequent use. The mixture was incubated at 37°C, and the results were verified using agarose gel electrophoresis (AGE). The study found that BiRDS maintained excellent stability in the 2% FBS environment; its structure remained intact, and its fluorescence intensity persisted for 24 hours. This provides a solid foundation for the continued function of the siRNA. In 10% serum, BiRDS still showed weak fluorescence after 24 hours. Enzyme stability experiments demonstrated that BiRDS could retain siRNA activity for at least 24 hours in lysis buffer at 37°C. Furthermore, BiRDS could be stored for at least 7 days in TM buffer at 4°C, exhibiting good storage stability.

[0088] To verify the cellular uptake of the prepared BiRDS, BMSCs were incubated with Cy5-labeled siRNA alone, Cy5-labeled tFNAs, or Cy5-labeled BiRDS for 12 and 24 hours (the concentrations of siRNA, tFNAs, and BiRDS were all 250 nM), and the results were analyzed by immunofluorescence and flow cytometry. Based on the flow cytometry results (…), Figure 1After 12 hours, 41.8% of tFNA and 40.7% of BiRDS particles penetrated the cell membrane, while only a small amount of siRNA was absorbed by BMSCs. After 24 hours, siRNA uptake remained low, while the cell entry efficiency of tFNA and BiRDS was significantly enhanced. Immunofluorescence results further confirmed the successful infiltration of BiRDS particles. Figure 1 G).

[0089] The above experimental results show that siRNA was successfully loaded into the BiRDS structure and BiRDS exhibited good storage stability and ultra-high cellular uptake efficiency, which will significantly enhance the osteogenic promoting effect of siRNA.

[0090] Experiment 2 investigated the therapeutic effect and regulatory mechanism of the BiRDS system on maxillofacial bone defects in vitro.

[0091] The siRNA, tFNA, and BiRDS samples used in this experiment were prepared according to the methods of Comparative Example 1 and Example 1.

[0092] I. Experimental Methods

[0093] 1. Extraction, culture, and processing of primary rat BMSCs

[0094] Primary rat bone marrow-derived mesenchymal stem cells (MSCs) were isolated and cultured. Briefly, male Sprague-Dawley rats were sacrificed and sterilized in 75% ethanol for 15 minutes. Femurs were isolated, and bone marrow-derived MSCs were collected by aseptically flushing with α-MEM using a syringe. The aspirate was centrifuged at 800 rpm for 5 minutes, resuspended, and maintained in α-MEM supplemented with 10% fetal bovine serum containing 100 U / mL penicillin and 100 μg / mL streptomycin. The medium was changed twice weekly, and passages were performed from the 3rd to the 5th week for further cell seeding.

[0095] 2. Cell proliferation assay

[0096] BMSCs (5000 cells / well) were seeded into 96-well plates. Cells were treated for 24 hours with siRNA (Si group), tFNA (T group), or BiRDS (B group) at a concentration of 250 nM each. CCK-8 (10 μL) was then added, and the cells were incubated at 37°C for 4 hours. After incubation, the absorbance at 450 nm for each cell was measured using a Tecan microplate reader.

[0097] 3. CCK8

[0098] CCK-8 assays were performed using the CCK-8 kit according to the manufacturer's instructions. In short, rBMSCs were cultured in 24-well plates at a density of 5 × 10⁶ cells per well on different scaffolds. After 1, 3, and 5 days of culture, the medium was replaced with 10% CCK-8 solution, followed by incubation at 37°C for another 30 minutes.

[0099] 4. Migration test

[0100] To assess the migration ability of BMSCs under various conditions, a scratch assay was performed. Each well in a 6-well plate was seeded with 5 × 10⁶ cells. 5 Cells were collected. Using a sterile pipette tip, a cross-shaped scratch was made on the bottom of each plate. The cells were then treated for 12 hours in serum-free TM buffer, siRNA, tFNA, or BiRDS (250 nM). The cells were then washed with PBS. Cell migration was measured using an Olympus microscope at 0, 6, 12, and 24 hours.

[0101] 5. ALP staining and ALP quantification

[0102] For ALP staining analysis, rBMSCs were incubated for 7 and 14 days, then fixed with 4% paraformaldehyde for 15 minutes, followed by gentle washing. ALP staining was then performed using the NBT / BCIP staining kit according to the manufacturer's instructions. Photographs were taken for further analysis. For quantitative ALP assays, rBMSCs were lysed with RIPA buffer after 7 and 14 days of incubation. ALP levels were then determined using an ALP detection kit. Quantitative analysis was performed based on the production of p-nitrophenol, which reflects ALP content. To standardize ALP activity levels, protein levels were measured using a BCA detection kit.

[0103] 6. Alizarin Red Staining and Semi-Quantitative Analysis

[0104] For Alizarin Red staining, rBMSCs were fixed with 4% paraformaldehyde for 15 minutes after incubation periods of 14 and 21 days, respectively. After gentle rinsing, cells were stained with ARS solution. Images were then captured for detailed analysis. For semi-quantitative assessment, 10% hexadecylpyridine chloride was added to the staining wells for 20 minutes, and the OD reading of the supernatant was recorded at a wavelength of 562 nm.

[0105] 7. Transell assays were used to analyze the migration and invasion capabilities of cells.

[0106] 8. Immunofluorescence staining.

[0107] 9. Western blot assay to detect protein expression levels.

[0108] 10. qPCR detection of mRNA expression levels.

[0109] II. Experimental Results

[0110] 1. BiRDS promotes cell proliferation, migration, and osteogenic differentiation through the AKT signaling pathway.

[0111] The scratch closure assay results showed that the number of BMSCs cells closing in the BIRDS group was higher than that in the siRNA-only group at 6h, 12h, and 24h after scratching, while there was no significant difference between the siRNA-only group and the control group. Figure 2 The crystal violet intensity in the Transell experiment further demonstrated the superior effect of BiRDS on BMSC migration compared to siRNA alone. Figure 3 ).

[0112] ALP staining results showed ( Figure 5 After 14 days of osteogenic induction, all groups showed purple staining. The BiRDS group had significantly higher staining depth and density than the positive control group induced by osteogenic medium alone, indicating the strongest osteogenic ability, while the siRNA-only group had the weakest osteogenic ability. After 21 days of incubation, the same trend was observed in the ARS staining results, showing that the BiRDS group had significantly higher calcium nodule staining depth and density than the positive control group. Figure 4 ), quantitative analysis of ALP and ARS content ( Figure 4 , Figure 5 This further confirms these conclusions.

[0113] qPCR results showed that treatment of BMSCs cells with BiRDS upregulated AKT ( Figure 10 AKT protein expression levels were also measured by WB ( Figure 7 ) and immunofluorescence staining ( Figure 9 Further evidence showed that, compared with other groups, BiRDS significantly promoted AKT expression, thereby promoting cell migration and proliferation.

[0114] The structure of BiRDS is as follows: Figure 8 As shown, its working principle is as follows Figure 6 RNase H can recognize the DNA / RNA hybridization region of BiRDS, hydrolyze hydrogen bonds, and change the conformation of BiRDS from a three-dimensional tetrahedral to a two-dimensional dart configuration, thereby separating the core framework structure from the external "immortal bird" structure and releasing the "immortal bird" to the target site.

[0115] The above experimental results indicate that the BiRDS system has a good target gene silencing effect and promotes cell proliferation, migration and osteogenic differentiation through the AKT signaling pathway, thus playing a role in the treatment of maxillofacial bone defects.

[0116] 2. BiRDS promotes osteogenic formation by activating the BMP-Smad signaling pathway.

[0117] Confocal microscopy and Western blotting results showed that the BiRDS group exhibited a significant therapeutic effect in increasing Smad protein expression, raising its level to more than twice that of the control group. Figure 11 ,12). Gene expression levels were more pronounced than those observed by immunofluorescence and Western blotting. Figure 15 It was found that the siRNA group increased the Smad1 / 5 gene level by nearly 4-fold, while the BiRDS group increased it by nearly 10-fold. The promoting effect of Smad was more significant at the gene level than at the protein level.

[0118] The above experimental results confirm that the CKIP protein may interact with the Smad protein in the BMP (Bone Morphogenetic Protein) signaling pathway, affecting the proliferation and differentiation of jaw cells. BiRDS can carry siRNA to efficiently activate the BMP-Smad signaling pathway, playing a key role in bone formation and repair.

[0119] 3. BiRDS promotes osteogenic formation by regulating the Wnt3α / β-catenin pathway.

[0120] Western blot (WB) results showed that Wnt3a expression was significantly upregulated in the BiRDS group compared to the other two groups. Expression levels in the siRNA group and the control group were not high, and there was no statistically significant difference between them. Figure 11 Regarding β-catenin, the expression level in the BiRDS group was more than twice that of the control group. Immunofluorescence results showed that the protein expression intensity of β-catenin increased by more than 10-fold in the BiRDS group compared to the control group, while it only increased by 2-fold in the siRNA-only group. Figure 12 BIRDS has a good effect on promoting the Wnt3a / β-catenin pathway.

[0121] WB results indicate that ( Figure 14 Compared with the control group and the tFNA group, the BiRDS group showed upregulation of ALP, RUNX2, OPN, COL-1, and OSX protein expression, with significant statistical differences. The immunofluorescence results were consistent with the Western blot results, especially COL-1 and RUNX2, which showed a significant improvement in the immunofluorescence experiment.

[0122] The above experimental results demonstrate that BiRDS, as an excellent siR delivery system, treats bone defects through the AKT, BMP-Smad signaling pathway, and Wnt3a / β-catenin pathway. Figure 13 ).

[0123] Experiment 3 investigated the repair effect and regulatory mechanism of the BiRDS system on mandibular bone defects in rats at the in vivo level.

[0124] The siRNA, tFNA, and BiRDS samples used in this experiment were prepared according to the methods of Comparative Example 1 and Example 1.

[0125] I. Experimental Methods

[0126] 1. Laboratory animals

[0127] Fifty-five 6-week-old SPF-grade male SD rats (Chengdu Dashuo Experimental Animal Co., Ltd., China) were selected. The rats were randomly divided into four groups: GelMA, siRNA / GelMA, tFNA / GelMA, and BIRDS / GelMA, with 13 rats in each group. They were fed SPF-grade rat maintenance diet, and their sterile drinking water and bedding were changed 2-3 times per week.

[0128] 2. Establishment of a mandibular bone defect model

[0129] Rats were first anesthetized with isoflurane inhalation. The left mandibular surgical area was prepared and disinfected. A 6mm incision was made at the projection of the mandibular ramus onto the body surface. After blunt dissection of the soft tissue, the mandible was exposed. A 3mm full-thickness bone defect was created in the mandibular body using a trephine drill as a critical bone defect model. Bone fragments were thoroughly rinsed away with saline. GelMA (Control), siRNA / GelMA (siRNA), tFNA / GelMA (tFNA), and BIRDS / GelMA (BIRDS) groups were pre-cured for 10 seconds and injected into the bone defect, followed by an additional 6 seconds of light curing. Finally, the incision was sutured with 5-0 sutures and disinfected again. In the GelMA group, GELMA (10% w / v) filled the circular defect area. GELMA and nanoparticles were mixed at a volume ratio of 3:1 to ensure that the concentration of siRNA, tFNA, or BIRDS in the mixed solution was 250 nM. Rats were euthanized by cervical dislocation at 4 and 8 weeks post-surgery, and the mandibles were removed after soft tissue dissection. After washing with 1×PBS, the mandibles were fixed in 4% paraformaldehyde solution for 48 hours for subsequent histological experiments. Figure 18 An experimental procedure was demonstrated to assess the repair of mandibular bone defects through observations at different time points (4 weeks and 8 weeks).

[0130] 3. Micro-CT scan

[0131] The sample was scanned using a micro-CT scanner (Scanco, Switzerland). Scanning parameters were: 10 μm resolution, 70 kVp voltage, and 200 μA current. Three-dimensional reconstruction and bone parameter analysis were performed using Scanco's accompanying analysis software. The region of interest (ROI) was defined as a full-thickness circular bone defect of the mandible with a diameter of 2.3 mm. Bone parameter analysis included bone volume over total volume (BV / TV), trabecular thickness (Tb·Th, mm), trabecular separation (Tb·Sp, mm), and trabecular number (Tb·N, mm).

[0132] 4. Histological staining

[0133] Decalcification was performed using 10% EDTA (pH 7.2-7.5), with the decalcification solution changed every 2 days. Decalcification was completed in approximately 4 weeks. Residual decalcification solution was rinsed overnight under running water. Paraffin-embedded sections were dewaxed and rehydrated, followed by Masson staining according to the instructions of the Masson staining kit (Seville Biosciences, China). Paraffin sections were dewaxed and rehydrated, and antigen retrieval was performed using 1× sodium citrate antigen retrieval solution (Beyotime, China). The sections were washed twice with 1× PBS, 5 minutes each time. Blocking with normal sheep serum (Zhongshan Jinqiao, China) was performed at room temperature for 30 minutes. After draining, primary antibody diluted with antibody diluent (COL1A1: 1:200, ALP: 1:200) was added, and incubated overnight at 4°C. After PBST washing, iFluor 488-labeled goat anti-rabbit secondary antibody (1:1000) diluted with antibody diluent was added, and the sections were incubated for 1 hour in the dark on a shaker at room temperature. The sections were then washed three times with PBST, 5 minutes each time. After staining with DAPI for 10 minutes, the slide was washed once with PBST. Autofluorescence was reduced using an autofluorescence quenching kit (VectorLabs, USA), and the slide was mounted and scanned using a full-slide scanning system (Olympus, Japan). H&E staining was then performed.

[0134] 5. Use an in vivo fluorescence imaging system (IVIS) to verify the biodistribution and retention time of the drug.

[0135] 6. Statistical Analysis

[0136] All biological tests were performed at least three times, and results were reported as mean ± standard deviation. Data analysis was performed using GraphPad Prism 9.0 software (GraphPad Software, CA, USA). One-tailed t-tests were used to determine statistical significance when comparing two groups, and one-way ANOVA with Bonferroni post-hoc correction was applied to compare the means of more than two groups. P < 0.05 was considered significant, and P < 0.01 or < 0.001 was considered highly statistically significant.

[0137] II. Experimental Results

[0138] 1. Pharmacokinetics of BiRDS and its repair effect on mandibular bone defects in rats

[0139] Micro-CT scans and 3D reconstruction images showed that at 4 weeks, the control group and siRNA group showed poor repair effects on the mandibular bone defect, with new bone formation covering only about 10% of the defect area. BiRDS, on the other hand, showed good repair effects, with new bone covering 40% of the entire defect area, demonstrating the good osteogenic efficacy of BiRDS in silencing ckip in the early stages. At 8 weeks, I observed that the BiRDS group showed more significant healing, reaching 70%, while the siRNA group and the control group still had large defects showing no signs of repair. Figure 16 ).

[0140] Bone parameter analysis of the defect area showed that ( Figure 17 At weeks 4 and 8, the bone volume fraction (BV / TV) in the BiRDS and TFNA groups was higher than that in the siRNA and control groups, with the BiRDS group showing the highest value. There was no significant difference in the mean density of BV in the defect areas among the four groups. The Ckip siRNA group showed increased BV / TV and Tb.Th at week 4 post-treatment compared to the control group (P<0.05), but the increase in these bone volume parameters was not significant at week 8. In contrast, the BiRDS group maintained a stable and long-term osteogenic effect throughout both weeks 4 and 8.

[0141] In vivo fluorescence imaging (IVIS) was used to verify the biodistribution and retention time of the drug. For example... Figure 19As shown, the fluorescence intensity of Cy5-labeled siRNA (at a concentration of 250 nM in a mixture with GelMA) in the jawbone decreased slowly in the first 24 hours, then rapidly decreased from 24 to 48 hours, and almost completely disappeared in the jawbone after only 120 hours. In contrast, the fluorescence intensity of Cy5-labeled BIRDS (at a concentration of 250 nM in a mixture with GelMA) in the jawbone remained essentially unchanged in the first 24 hours, then decreased significantly from 24 to 72 hours, but remained higher than the siRNA-only group at all time points. After 72 hours, it decreased slowly, maintaining a high fluorescence intensity until 120 hours. These results indicate that BIRDS persists longer in jawbone defects, which is related to the good tissue retention and permeability of BIRDS.

[0142] H&E shows ( Figure 20 , 21 The yellow dashed line represents the boundary between old and new bone. We can see that at 4 weeks, the bone defect areas in the control group and the siRNA group showed little healing. However, in the BiRDS group, approximately half of the defect area showed new bone formation, gradually expanding from the periphery towards the center. Masson staining results showed ( Figure 20 At 4 weeks, the blue area in the BiRDS group was prominent, showing numerous newly formed bone trabeculae. Magnified images revealed a large number of large, highly active osteocytes within the new bone. By week 8, the newly formed bone trabeculae in the BiRDS group transitioned from blue to red (mature bone), indicating active bone repair and a gradual transition from trabeculae to lamellar bone. At different stages of bone regeneration, the BiRDS group exhibited larger areas of both newly formed and mature bone in the defect region compared to other groups, demonstrating superior therapeutic efficacy at various stages.

[0143] The above experimental results show that BIRDS has a good repair effect on mandibular bone defects and can promote new bone formation.

[0144] 2. The knockdown efficiency of BiRDS on Ckip and its promoting effect on osteogenic pathways in rat mandibular defect repair.

[0145] Immunohistochemical staining directly analyzed the expression of Ckip protein in mandibular tissue. After administration of siRNA delivered by BIRDS, virtually no Ckip-positive cells were observed at weeks 4 and 8. Ckip expression remained completely unchanged in the tFNA group. In the siRNA-only group, we found that Ckip gene knockdown in the bone also had some effect, but the efficiency was far less than that in the BIRDS group. In the later stage of treatment (week 8), the number of Ckip-positive cells in the siRNA-only group was significantly increased compared to week 4 (P>0.05). Figure 22This indicates that the duration of CKIP silence cannot reach 8 weeks, and it only has a limited therapeutic effect in the short term.

[0146] To further verify the effective regulation of target genes by BiRDS, we examined the expression levels of osteogenic pathway-related positive regulatory signaling proteins and cell proliferation-related proteins. During the 4-week observation period, we found that the expression of Smad and β-catnin proteins was significantly increased in the BiRDS group; AKT phosphorylation was promoted, and cell proliferation activity was enhanced; these factors promoted rapid healing of bone tissue in bone defects. Figure 23 In contrast, the expression of these proteins in the siRNA group alone reached only a low level. The tFNA group also promoted the expression of Smad, β-catnin, and AKT in jawbone defects, indicating that tFNA, as a vector, has high potential.

[0147] The above experimental results indicate that the BiRDS system can more efficiently silence the Ckip gene and promote the expression levels of osteogenic pathway-related proteins or cell proliferation-related proteins, thereby improving the therapeutic effect.

[0148] 3. The promoting effect of BiRDS on osteogenic-related proteins in the repair of mandibular bone defects in rats.

[0149] To further confirm the potential mechanism by which BIRDS promotes osteogenic formation in rat jaws, immunofluorescence staining was used to assess the activity of osteogenic markers. The expression levels of OPN, Col-1, BMP2, and ALP in the jawbone defect area were measured by calculating relative fluorescence intensity. Quantitative analysis of immunofluorescence sections showed that the expression of OPN and BMP2 was upregulated in the BIRDS group, and the overall fluorescence intensity of related proteins also increased accordingly. Similarly, the immunofluorescence results of ALP in each group showed that the expression level of ALP in the periosteum of the BiRDS group was higher, suggesting that osteogenic formation may be active, while the ALP-positive areas were less obvious in the other three groups than in the BIRDS group. Immunofluorescence results of COL1 showed that the content of type I collagen in the bone of the BiRDS group was higher, suggesting that bone regeneration was more active than in the control group and the siRNA-only group, with an increase of nearly 2 times compared to the siRNA-only group. Figure 24 ,25).

[0150] The above experimental results indicate that BiRDS comprehensively enhances the expression level of osteogenic-related proteins in rat jawbone defects, promoting osteoogenesis in the rat jawbone.

[0151] In summary, BiRDS exhibits excellent storage stability and extremely high cellular uptake efficiency, effectively silencing the Ckip gene and promoting cell proliferation, migration, and osteogenic differentiation. It demonstrates strong osteogenic induction and bone repair effects, and its regulatory mechanisms are related to the AKT, Wnt / β-catnin, and Smad-BMP2 pathways, making it a promising targeted delivery system. Therefore, constructing a BiRDS delivery system carrying siRNA offers new opportunities and methods for the clinical treatment of jaw defects and other borderline bone defects, possessing significant clinical potential.

Claims

1. A bio-switchable siRNA delivery system based on RNAi, characterized in that: The system consists of siRNA and a nucleic acid core, and the nucleotide sequence of the antisense chain of the siRNA is shown in SEQ ID NO.

4.

2. The RNAi-based bioswitchable siRNA delivery system according to claim 1, characterized in that: It consists of 3 siRNAs and 1 nucleic acid core.

3. The RNAi-based bioswitchable siRNA delivery system according to claim 2, characterized in that: The nucleic acid core consists of three DNA single strands, the nucleotide sequences of which are shown in SEQ ID NO.1, SEQ ID NO.2, and SEQ ID NO.3, respectively.

4. The method for preparing the RNAi-based bioswitchable siRNA delivery system according to any one of claims 1-3, characterized in that, The process includes the following steps: mixing three single-stranded DNA molecules with the siRNA and incubating the mixture to obtain the final product.

5. The RNAi-based bioswitchable siRNA delivery system according to claim 4, characterized in that: The molar ratio of the three DNA single strands is 1:1:1, and the molar ratio of any one DNA single strand to the siRNA is 1:

3.

6. Use of the novel bio-switchable siRNA delivery system based on RNAi according to any one of claims 1-3 in the preparation of a medicament for treating critical-sized bone defects in the maxillofacial region.

7. The use according to claim 6, characterized in that: The drug is used to promote the proliferation and / or migration of BMSCs cells.

8. The use according to claim 6, characterized in that: The drug is used to promote bone formation and / or repair.

9. The use according to claim 6, characterized in that: The drug promotes the expression of osteogenic-related proteins.

10. A drug for treating maxillofacial bone defects, characterized in that: It is made by adding pharmaceutically acceptable excipients to the RNAi-based bioswitchable siRNA delivery system as the active ingredient, as described in any one of claims 1-3.

Images