Rose thorn control gene and application thereof
By using virus-mediated gene silencing technology to suppress the expression of the rose thorn-regulating gene RcPIP2;1, the problem of rose thorn trait regulation was solved, enabling the breeding of new rose varieties with fewer or no thorns, and improving field management efficiency and quality.
Patent Information
- Application Number
- CN202511630899.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Priority Date
- 2025-04-23
- Filing Date
- 2025-11-10
- Publication Date
- 2026-05-01
- Estimated Expiration
- 2045-11-10
AI Technical Summary
There is a lack of effective methods in the current technology to control the prickly trait of roses without affecting other traits, which makes the field cultivation and management of the plants and the process of flower harvesting inconvenient.
By employing virus-mediated gene silencing (VIGS) technology, new rose varieties with altered prickle traits were obtained by inhibiting the expression of the rose prickle regulating gene RcPIP2;1, transforming Agrobacterium with a viral vector, and then infecting rose seedlings.
It significantly reduced the number of rose thorns, enabling the cultivation of new rose varieties with fewer or no thorns, and improving the efficiency and quality of field management.
Smart Images

Figure CN121109431B_ABST
Abstract
Description
Genes that regulate rose prickles and their applications Technical Field
[0001] This invention belongs to the field of plant genetic engineering, specifically relating to a rose RcPIP2;1 gene and its application in the regulation of prickly traits. Background Technology
[0002] Plants in the genus *Rosa* include roses, hybrid tea roses, and wild roses, many of which have high ornamental value. However, the stems of most *Rosa* plants are covered with thorns, which causes many inconveniences in field cultivation, flower harvesting, and transportation. Therefore, breeding new varieties of *Rosa* plants that are thornless, have few thorns, or have soft thorns can help improve production efficiency, reduce costs, and enhance quality.
[0003] Thorns are widely present in plants, formed by protrusions of epidermal cells and subcutaneous tissue on plant stems and branches. In terms of origin, thorns share some similarities with epidermal hairs, and the hardening of thorns is closely related to lignin accumulation. In recent years, with in-depth research, candidate genes related to thorn development have been isolated and identified, including GRF1 (patent application CN119432900A), bZIP6, CPC, WER, MYB5 (Yuan Xiaoyu, Research on the Discovery and Application of Rose Thorn Formation-Related Genes), and TTG1 (Luan Xiaofang, Cloning and Expression Analysis of Rose Thorn Formation-Related Transcription Factor RrTTG1). Transcriptomic analysis has also identified differentially expressed genes in thorny and thornless stem segments, such as the RmbZIP6 gene, which is specifically and preferentially expressed in thorns. Transformation of this gene into Arabidopsis thaliana results in stunted plant height and reduced lignin content, while transformation into rose reduces thorn hardness. Therefore, the rational use of this gene can regulate lignin content and thorn development in plants. In addition, Chinese patent CN114438097B (Yangzhou University) discloses a rose thorn regulatory gene RrCPC and its application. Using purple-branched rose as material, the RrCPC gene was cloned by RACE technology, and the expression pattern of the RrCPC gene on different levels of lateral branches of rose was detected by real-time fluorescence quantitative PCR. At the same time, an overexpression vector was constructed and transformed into Arabidopsis thaliana, proving that it is a negative regulator of epidermal hair generation, thus clarifying the application value of this gene in breeding new rose germplasm with few thorns or no thorns and improving rose field management.
[0004] To date, there are few reports on the use of transgenic technology to regulate the prickly trait of roses without affecting other traits. Therefore, identifying genes that regulate rose prickles is of great significance for breeding new rose varieties with fewer or no prickles. Summary of the Invention
[0005] The main technical problem solved by this invention is to provide a rose prickle regulatory gene PIP2;1 and its application. Specifically, the rose prickle regulatory gene PIP2;1 (RchChr3g0469531 located in the QTL1 region) differentiates in rose populations with and without prickles and is specifically expressed in prickle tissue, acting as a positive regulator of rose prickle development.
[0006] To solve the above-mentioned technical problems, the present invention provides the following technical solutions:
[0007] Application of inhibiting the expression of the rose thorn regulatory gene RcPIP2;1 in the breeding of new rose varieties with fewer or no thorns, wherein the nucleotide sequence of the rose thorn regulatory gene RcPIP2;1 is shown in SEQ ID NO: 1.
[0008] In a preferred embodiment of the present invention, the expression of the rose prickle-regulating gene RcPIP2;1 is inhibited using virus-mediated gene silencing (VIGS) technology, and the nucleotide sequence of the silenced fragment is shown in SEQ ID NO: 2.
[0009] As a preferred embodiment of the present invention, the application includes the following steps:
[0010] The nucleotide sequence that inhibits the expression of the rose prickle regulatory gene RcPIP2;1 was inserted into the viral vector;
[0011] Transforming Agrobacterium tumefaciens with viral vectors;
[0012] Rose seedlings were infected with Agrobacterium tumefaciens;
[0013] Cultivate rose seedlings to obtain new rose varieties with altered thorn characteristics.
[0014] Specifically, inserting the nucleotide sequence that inhibits the expression of the rose prickle regulatory gene RcPIP2;1 into the viral vector includes: using rose cDNA obtained by reverse transcription as a template, performing PCR amplification using primers FRcPIP2A / RRcPIP2A, and ligating the amplification product into the linearized viral vector.
[0015] The nucleotide sequences of the primer pair FRcPIP2A / RRcPIP2A are shown in SEQ ID NO: 3-4.
[0016] Specifically, the viral vectors include pYL192 (TRV1) and pTRV2, both of which are Kana resistant; the silencing fragment is inserted into pTRV2.
[0017] Specifically, the Agrobacterium strains include, but are not limited to, GV3101.
[0018] A biological material for inhibiting the expression of the rose thorn regulatory gene RcPIP2;1, the biological material containing a nucleotide sequence for inhibiting the expression of the rose thorn regulatory gene RcPIP2;1, the nucleotide sequence of the rose thorn regulatory gene RcPIP2;1 being shown in SEQ ID NO: 1.
[0019] As a preferred embodiment of the present invention, the nucleotide sequence for inhibiting the expression of the rose prickle regulatory gene RcPIP2;1 is a silence fragment designed based on virus-mediated gene silencing, and the nucleotide sequence of the silence fragment is shown in SEQ ID NO: 2.
[0020] In a preferred embodiment of the present invention, the biological material includes, but is not limited to, viral vectors, Agrobacterium, etc.
[0021] A method for inhibiting the expression of the rose prickle regulatory gene RcPIP2;1, comprising the following steps:
[0022] The nucleotide sequence that inhibits the expression of the rose prickle regulatory gene RcPIP2;1 was inserted into the viral vector;
[0023] Transforming Agrobacterium tumefaciens with viral vectors;
[0024] Rose seedlings were infected with Agrobacterium tumefaciens;
[0025] Simply cultivate rose seedlings;
[0026] The nucleotide sequence of the rose prickles regulatory gene RcPIP2;1 is shown in SEQ ID NO: 1.
[0027] As a preferred embodiment of the present invention, the nucleotide sequence for inhibiting the expression of the rose prickle regulatory gene RcPIP2;1 is a silenced fragment designed based on virus-mediated gene silencing, and the nucleotide sequence of the silenced fragment is shown in SEQ ID NO: 2.
[0028] Specifically, inserting the nucleotide sequence that inhibits the expression of the rose prickle regulatory gene RcPIP2;1 into the viral vector includes: using rose cDNA obtained by reverse transcription as a template, performing PCR amplification using primers FRcPIP2A / RRcPIP2A, and ligating the amplification product into the linearized viral vector.
[0029] The nucleotide sequences of the primer pair FRcPIP2A / RRcPIP2A are shown in SEQ ID NO: 3-4.
[0030] Specifically, the viral vectors include pYL192 (TRV1) and pTRV2, both of which are Kana resistant; the silencing fragment is inserted into pTRV2.
[0031] Specifically, the Agrobacterium strains include, but are not limited to, GV3101.
[0032] This invention discovered that RchChr3g0469531 (PIP2;1) located in the QTL1 region exhibits differentiation in both thorny and non-thorny rose populations and is specifically expressed in thorny tissues. Therefore, using the modern rose 'Samantha' (a thorny rose variety R. 'Samantha') as material, a silencing vector was constructed using virus-mediated gene silencing (VIGS) to transform roses. The expression of the RcPIP2;1 gene in the roses was then examined. The results showed that after gene silencing, the expression level of PIP2;1 was significantly reduced to approximately 25%. Combined with the thorn number phenotypic trait, this further clarifies that the RcPIP2;1 gene is a positive regulator of thorn development in roses, and has significant application value in cultivating new thornless or thornless rose germplasm and improving field management of roses. Attached Figure Description
[0033] Figure 1 shows the TRV1 plasmid map in the experimental example.
[0034] Figure 2 shows the TRV2 plasmid map in the experimental example.
[0035] Figure 3 shows the full-length CDS of the RchChr3g0469531 gene and the location of the VIGS silencing fragment in the experimental example.
[0036] In the figure, RchChr3g0469531 at the top is the full-length CDS sequence of the gene, and PIP2-VIGS (Silence) at the bottom is the selected 291 bp silent fragment.
[0037] Figure 4 is a schematic diagram of the line marking treatment of rose seedlings before infection in the experimental example.
[0038] Figure 5 shows the RT-qPCR analysis results in the experimental example.
[0039] Data in the figure are expressed as Mean ± SD, corresponding to the empty vector control group (EV, 8 biological replicates) and the PIP2 gene silencing group (PIP2-VIGS, 4 biological replicates), respectively. Asterisks indicate statistically significant differences (two-tailed t-test, p < 0.0001). The results show that the expression level of RhPIP2;1 in VIGS-treated plants (PIP2-VIGS) was significantly reduced by approximately 25% compared to empty vector-infected plants (EV).
[0040] Figure 6 shows the effect of silencing PIP2;1 expression based on VIGS technology on the development of prickles on rose stems in the experimental case.
[0041] In the figure, A: Representative phenotypes of plants with silenced PIP2;1 gene; PIP2-9, PIP2-14, and PIP2-22 are silent plants, and the empty vector (EV) is the control group. The second internode (Node 2) of PIP2-14 and its control group, counted from below the flowering branch, is magnified. B: Statistical analysis results. The results show that silencing PIP2;1 expression significantly inhibits the development of prickles on rose stems.
[0042] In the figure, a phylogenetic tree was constructed using the protein sequences of eight Rosaceae AQP gene family members: *Rosa wichuraiana* 'Basye's Thornless' (BT), *Rosa chinensis* 'Old blush' (OB), *Rosa rugosa*, *Malus x domestica*, *Prunus armeniaca*, *Pyrusussuriensis x communis Zhongai*, *Fragaria vesca*, and *Rubus occidentalis*, with *Arabidopsis thaliana* and *Tomato* as outgroups. Different colors were used to classify the subfamilies into five subfamilies: PIP, TIP, NIP, SIP, and XIP. PIP was further divided into two groups: PIP1 and PIP2. Gray triangles represent 90-100% support. Different species are distinguished by different shapes and colors, and the legend in the lower right corner indicates the corresponding species.
[0043] Figure 7 shows the protein sequence analysis results of AQP subfamily members of OB and BT in the experimental example.
[0044] In the figure, the circles from the outside in represent: subfamily classification, protein domains, expression heatmaps of AQPs in the apical meristem and leaves of March (SM3) and November (LF3 and LF11, samples collected in March and November, respectively), and a phylogenetic tree. Motifs 1-15 are represented by different colored shapes; * indicates support between 50-90%, and triangles indicate support greater than 90%. Subfamilies are distinguished by different colors: blue indicates PIP2, light blue indicates PIP1, yellow indicates the XIP subfamily, pink indicates the SIP subfamily, light green indicates the TIP subfamily, and green indicates the NIP subfamily. In the expression heatmap, the expression level gradually increases from blue to red, indicating that the protein sequences of AQP subfamily members in OB and BT are relatively conserved.
[0045] Figure 8 shows the chromosomal localization analysis results of the OB and BT AQPs gene family members in the experimental example.
[0046] In the figure, A: the chromosomal distribution of 38 RcAQPs family members in OB; B: the chromosomal distribution of 27 RwAQPs family members in BT. The four AQPs involved in dermal spine density regulation are highlighted in bold blue text. The results indicate that the chromosomal distribution of OB and BTAQPs gene family members is non-uniform.
[0047] Figure 9 shows the collinearity analysis results of AQP genes in OB, BT, and Arabidopsis thaliana (Ath) in the experimental case.
[0048] In the figure, collinear gene pairs of Arabidopsis thaliana and BT, OB and BT, and Arabidopsis thaliana and OB are connected by red, yellow, and blue lines, respectively. The four gene pairs located in QTL intervals are shown in bold blue. The results show that the AQP genes of OB, BT, and Arabidopsis thaliana (Ath) exhibit good chromosomal collinearity.
[0049] Figure 10 shows the Ka / Ks analysis results of AQP homologous gene pairs in BT and OB in the experimental example.
[0050] In the figure, the inner ring shows the distribution of Ka / Ks ratios in the ranges <0.25, 0.25-0.5, 0.5-0.75, and 0.75-1 as percentages, while the outer ring displays the statistical values of gene numbers in each subfamily. The results show that purifying selection dominated the evolutionary process of AQPs.
[0051] To more clearly illustrate the technical solutions of the embodiments of the present invention, the accompanying drawings obtained in the experimental examples have been briefly described above. It should be understood that the above drawings only show some experimental examples of the present invention and should not be considered as any limitation on the scope of protection of the claims. For those skilled in the art, other related drawings can be obtained based on these drawings without any creative effort. Detailed Implementation
[0052] The technical solution of the present invention will be clearly and completely described below with reference to specific embodiments and experimental examples. However, those skilled in the art should understand that the embodiments are only used to illustrate the technical solution of the present invention and should not be regarded as limiting the scope of protection of the present invention. Based on the following embodiments, all other implementation schemes obtained by those skilled in the art without creative effort, such as implementation schemes obtained by modification, variation or simple substitution, should fall within the scope of protection of the present invention.
[0053] Unless otherwise specified, the experimental methods used in the following embodiments and experimental examples are conventional methods; the raw materials, reagents, instruments, etc. used are all commonly used in the field and are available to the public or can be obtained through commercial means, unless otherwise specified; the terms and abbreviations involved have their conventional meanings in the field.
[0054] Experimental Example 1
[0055] 1. Experimental instruments, reagents and materials
[0056] The main instruments and equipment used in the experiment are shown in Table 1.
[0057] Table 1 Main Instruments and Equipment
[0058] Brand and Product Number: PCR Instruments: Eppendorf Mastercycle Nexus / Eco PCR Centrifuge Mini 6K AS-6K-4939 / 4933; Low-Temperature Refrigerated Centrifuge: Eppendorf Centrifuge 5804R / 5424; Multi-Sample Tissue Grinder: Tissuelyser-24L; Vortex Mixer: Votege X-5; Kylin-Bell Biochemical Incubator: BOXUE SPX-100B-Z; Constant Temperature Shaker: TenSuG TS-2402CL; Electrophoresis System: BIO-RAD Gel Imaging System; Biospectrum 510 Imaging System; Real-Time PCR Instrument: Applied Biosystems QuantStudio 7 Flex Real-Time PCR System; Microplate Reader: TECAN Infinite 200; Constant Temperature Water Bath: HWS24 / CW600; 4℃ Low Temperature Refrigerator: BCD-560EWC-20℃; Low Temperature Refrigerator: DW-25L262-80℃; Low Temperature Refrigerator: Frloilabo Biomemony ESO Clean Bench, ACB-4A1 / AIRTECH Ultrapure Water System (Ultrapure Type 1), Zealway GR60DA Nucleic Acid and Protein Analyzer, Eppendorf Biophotometer D30 Electronic Balance, Ohaus Aoventurer / Sartorious BSA 244S Holistic Plant Imaging System, Lumazone PyloN1300B surface
[0059] The culture medium and reagents are prepared as follows:
[0060] LB medium: 10 g / L tryptone, 5 g / L yeast extract, 10 g / L NaCl, sterilized at 121℃ for 20 min. After the temperature drops below 55℃, add the appropriate antibiotic and store at 4℃. LB solid medium: add 15 g / L agar powder to the above mixture.
[0061] Rose propagation medium: 4.4 g / L MS, 30 g / L sucrose, 1.0 mg / L 6-benzylaminopurine, 0.05 mg / L α-naphthaleneacetic acid, adjust pH to 5.85-5.95, then add 6.8 g / L plant agar. Sterilize at 121℃ for 20 min, and transfer to culture flasks for solidification after the temperature drops below 55℃.
[0062] Rose rooting medium: 2.2 g / L MS, 3 g / L sucrose and 0.1 mg / L α-naphthaleneacetic acid, adjust the pH to 5.85-5.95, then add 7.5 g / L plant agar. Sterilize at 121℃ for 20 min, and transfer to culture flasks to solidify after the temperature drops below 55℃.
[0063] Kanamycin solution (50 mg / L): Weigh 500 mg of kanamycin powder, dissolve it in 10 mL of ddH2O, filter to remove bacteria, dispense 1 mL into 1.5 mL centrifuge tubes, and store at -20℃.
[0064] Rifampicin solution (50 mg / L): Weigh 500 mg of rifampicin powder and dissolve it in 10 mL of methanol solution. Filter to remove bacteria and store at -20°C.
[0065] Gentamicin solution (40 mg / L): Weigh 400 mg of gentamicin powder, dissolve it in 10 mL of ddH2O, filter to remove bacteria, and store at -20℃.
[0066] AS (100 mM): Weigh 0.394 g of acetylsuccione powder and dissolve it in 20 mL of DMSO solution. Filter to remove bacteria and store at -20℃.
[0067] MES solution (0.2 M): Weigh 2.13 g of MES powder and dissolve it in 50 mL of ddH2O. Adjust the pH to 5.7, filter to remove bacteria, and store at 4°C.
[0068] MgCl2 solution (2 M): Weigh 20.3 g of MgCl2·6H2O powder and dissolve it in 50 mL of ddH2O. Filter to remove bacteria and store at 4℃.
[0069] 50×TAE solution: 242 g / L Tris, 37.2 g / L Na2EDTA·2H2O, 57.1 mL / L glacial acetic acid, store at room temperature.
[0070] The strains and vectors used in the experiment are as follows:
[0071] The strain of Escherichia coli was DH5α, and the strain of Agrobacterium was GV3101.
[0072] The vectors used in the virus-mediated gene silencing experiment included pYL192 (TRV1) and pTRV2 (plasmid maps are shown in Figure 1-2), both of which were Kana resistant.
[0073] 2. Rose RNA extraction
[0074] RNA was extracted using the Kangwei Century CW2598S All-Purpose Plant RNA Extraction Kit, as follows:
[0075] (1) Approximately 70 mg of young rose thorns or leaves were placed in liquid nitrogen and quickly frozen, then ground into powder. 500 μL of Buffer RLS was added, the mixture was vortexed and mixed, and centrifuged at 4℃ and 12,000 rpm for 2 min.
[0076] (2) Transfer the supernatant to the filter column and then centrifuge at 4°C and 12,000 rpm for 1 min.
[0077] (3) Carefully aspirate the supernatant from the collection tube and transfer it to a new centrifuge tube. Add 0.5 times the volume of the supernatant in anhydrous ethanol and mix well. Then transfer it to the adsorption column and centrifuge at 4°C and 12,000 rpm for 1 min. Discard the waste liquid and put the adsorption column back into the collection tube.
[0078] (4) Add 350 μL of Buffer RW1 to the adsorption column, centrifuge at 4℃ and 12,000 rpm for 1 min, discard the waste liquid, and put the adsorption column back into the collection tube.
[0079] (5) Prepare DNase I mixture (add 8 μL of 10×ReactionBuffer and 20 μL of DNase I to 52 μL of RNase-Free water to prepare a reaction solution with a final volume of 80 μL. Then add 80 μL of DNase I mixture to the adsorption column and incubate at 25℃ for 15 min.
[0080] (6) Add 350 μL of Buffer RW1 to the adsorption column RM, centrifuge at 4℃ and 12,000 rpm for 1 min, discard the waste liquid, and put the adsorption column back into the collection tube.
[0081] (7) Add 500 μL of Buffer RW2 to the adsorption column RM (check that anhydrous ethanol has been added before use), centrifuge at 4°C and 12,000 rpm for 1 min, discard the waste liquid, and put the adsorption column back into the collection tube. Repeat the operation once, and then centrifuge at 4°C and 12,000 rpm for 2 min to remove residual ethanol.
[0082] (8) Place the adsorption column in a new centrifuge tube, add 40 μL of RNase-Free water to the middle of the adsorption membrane, let it stand at room temperature for 2 min, and centrifuge at 4℃ and 12,000 rpm for 1 min. Store the obtained RNA solution in a -80℃ refrigerator for later use.
[0083] 3. gDNA removal and cDNA first-strand synthesis
[0084] cDNA first-strand synthesis and gDNA removal were performed using the Nearshore Protein Reverse Transcription Kit E047, as follows:
[0085] After the reagents are melted, mix all components thoroughly, centrifuge briefly, and place on ice. Add 10 μL of 2×NovoScript® Plus 1st Strand cDNA Synthesis SuperMix, 1 μL of gDNA Purge, and 1 μg of RNA to a 20 μL reaction mixture. Make up the volume with RNase-free water, gently mix with a pipette, and centrifuge briefly to the bottom of the tube. Incubate the reaction at 50°C for 15 min, and terminate the reaction at 85°C for 5 s. Store the reaction product at -80°C for later use.
[0086] 4. Silent fragment amplification
[0087] A specific fragment of approximately 300 bp in length from the CDS sequence of the target gene was selected (as shown in Figure 3). 20 bp primers were designed from both ends of this specific fragment, and 15 bp bases from both ends of the digested vector sequence were added to each primer to form homologous recombination primers. Using the reverse transcription product cDNA as a template, the target fragment containing homologous arms flanking the vector restriction enzyme sites was amplified. Novizan high-fidelity enzyme was used for the PCR reaction. The PCR reaction system is shown in Table 2, the amplification program in Table 3, and the primer pair FRcPIP2A / RRcPIP2A in Table 9.
[0088] The genome sequence of RcHm_v2.0_Chr3g0469531_855bp is shown below (SEQ ID NO: 1, see also NCBI Accession: XM_024335286.2).
[0089] ATGGGCCGCGATATTGAAGTTGGAGGCTTTGCTGCCAAGGACTACCATGACCCACCGCCAACACCATTGATCGATCCGGAGGAGTTCGGAAAATGGTCCTTTT ACAGAGCCATCATTGCAGAA TTCATCGCTACACTTTTGTTCCTGTATATCAGTGTGCTCACTGTGATTGGATACAAGAGCCAGAGTGACACTCTCAAAGGTGGAGACCAATGTGGTGGTGTTGGCATTCTTGGCATTGCTTGGGCCTTTGGTGGCATGATCTTTGTCCTTGTTTACTGCACTGCTGGAATCTCTGGAGGGCACATAAACCCTGCTGTGACATTTGGGCTGTTTTTGGCTAGGAAGGTGTCATTACCCAGAGCTGTATTGTA TATTGTGGCTCAATCCTTGG GAGCAATATGTGGGTGTGGGCTTGTGAAATCATTCCAGAGTGCTTTGTACACCAACTATGGTGGTGGAGCTAATGGGCTAGCTGATGGGTACAGCAAAGGCACTGGATTGGCTGCTGAGATTATTGGCACCTTTGTTCTTGTCTACACTGTCTTCTCTGCCACTGATCCCAAGAGAAATGCAAGGGATTCCCATGTCCCAGTATTGGCACCACTACCAATTGGGTTTGCTGTGTTCATGGTTCACCTTGCCACAATCCCAATCACTGGCACAGGGATCAACCCGGCTCGAAGTTTCGGAGCTGCAGTGATATACAACAATGAGAAGGCTTGGGATGACCATTGGATCTTCTGGGTTGGACCCTTCATTGGTGCAGCCATTGCCGCTTTGTATCACCAAAAGATATTGAGAGCAGGAGCTGCTAAGGCTTCGGGTTCTTTTAGGAGCTCTTCCAACATATAA。
[0090] The sequence of the PIP2-OB-VIGS_291bp silencing fragment is shown below (SEQ ID NO: 2):
[0091] ACAGAGCCATCATTGCAGAA TTCATCGCTACACTTTTGTTTCCTGTATATCAGTGTGCTCACTGTGATTGGATACAAGAGCCAGAGTGACACTCTCAAAGGTGGAGACCAATGTGGTGGTGTTGGCATTCTTGGCATTGCTTGGGC CTTTGGTGGCATGATCTTTGTCCTTGTTACTGCACTGCTGGAATCTCTGGAGGGCACATAAACCCTGCTGTGACATTTGGGCTGTTTTTGGCTAGGAAGGTGTCATTACCCAGAGCTGTATTGTA TATTGTGGCTCAATCCTTGG .
[0092] Table 2 High-fidelity PCR reaction system
[0093] Component dosage: 2×Phanta Max Buffer 25 μL, dNTP Mix 1 μL, Phanta Max Super-Fidelity DNA Polymerase 1 μL, FRcPIP2A2 μL, RRcPIP2A2 μL, L, Template 1 μL, ddH2O 18 μL surface
[0094] Table 3 High-fidelity PCR amplification program
[0095]
[0096] 5. Target fragment retrieval
[0097] The target fragment was recovered using the commercially available BioFlux Biospin gel recovery kit, as follows:
[0098] (1) After amplification, perform gel electrophoresis, cut the agarose gel containing the target fragment into a 1.5 mL centrifuge tube, add 800 μL of Extraction Buffer, and incubate at 55℃ for 10 min until the gel melts.
[0099] (2) Transfer the mixture to a centrifuge column and centrifuge at 6,000 rpm for 1 min, then discard the waste liquid. Then add 500 μL of Extraction Buffer to the centrifuge column and centrifuge at 12,000 rpm for 1 min, then discard the waste liquid.
[0100] (3) Add 650 μL of Wash Buffer to the centrifuge column, centrifuge at 12,000 rpm for 1 min, and discard the waste liquid. Repeat the above operation once.
[0101] (4) Centrifuge at 12,000 rpm for 2 min to remove residual liquid. Then transfer the centrifuge column to a sterile 1.5 mL centrifuge tube, add 30 μL of Elution Buffer to the centrifuge column, let it stand at room temperature for 2 min, centrifuge at 12,000 rpm for 1 min to obtain the gel recovery product, and store it at -20℃ for later use.
[0102] 6. TRV2 vector single enzyme digestion
[0103] The TRV2 vector was digested using KpnⅠ (catalog number: FD0524) FastDigest restriction endonuclease from Thermo Fisher Scientific.
[0104] The enzyme digestion reaction system is shown in Table 4. The reaction was carried out at 37℃ for 2 h. The enzyme digestion products were subjected to agarose gel electrophoresis, and the linear vector was recovered from the gel according to the corresponding band size.
[0105] Table 4 Plasmid Enzymatic Digestion System
[0106] Component dosage: 10× Fast Digest buffer 4 μL, nzyme 2 μL, lasmid 2 μg, ddH2O 0p to 40 μL surface
[0107] 7. Ligation of the amplified fragment with the linearized vector
[0108] The fragment and vector were ligated using the Novitane recombinase CEⅡ kit (catalog number: C112-02). The reaction system was prepared according to the instructions. The ligation reaction system is shown in Table 5. The reaction was carried out at 37℃ for 30 min.
[0109] Table 5 CEⅡ Connection System
[0110] Component dosage: 5×CEⅡ Buffer 4 μL, Lexinase Ⅱ 1 μL, L-gestated plasmid 50 ng, Insert fragment 100 ng, ddH2O UP to 20 μL surface
[0111] 8. Escherichia coli transformation
[0112] The recombinant vector was transformed using DH5α competent cells (catalog number: B528413-0100) from Shanghai Sangon Biotech Co., Ltd. The transformation procedure is as follows:
[0113] (1) Take 100 μL of competent Escherichia coli DH5α cells from the -80℃ freezer and thaw them on ice.
[0114] (2) Add 10 μL of the ligation product, mix gently, and incubate on ice for 30 min.
[0115] (3) Heat shock conversion at 42℃ for 90 s, then place on ice for 2 min.
[0116] (4) Add 800 μL of antibiotic-free LB liquid medium and incubate at 37°C and 220 rpm for 1 h with shaking.
[0117] (5) Centrifuge at 5,000 rpm for 1 min and discard 700 μL of supernatant.
[0118] (6) After resuspending the bacterial cells with a pipette, spread them evenly on LB solid medium containing the corresponding antibiotics and incubate them upside down in an incubator at 37°C overnight.
[0119] 9. Identification of positive transforming bacteria
[0120] The following day, single colonies were picked from the transformation plate and streaked onto the corresponding antibiotic LB solid medium for activation. The PCR reaction system was prepared (see Table 6), and the single colonies were amplified by PCR using the identification primer pair JC-F / JC-R. The amplification program is shown in Table 7, and the primer sequences are shown in Table 9.
[0121] Table 6 Identification PCR Reaction System
[0122] Component dosage: 2×Master Mix (Novazia) 5 μL, JC-F 0.2 μL, JC-R 0.2 μL, Template tip dipped in ddH2O 4.8 μL surface
[0123] Table 7 Identification PCR Reaction Procedure
[0124]
[0125] After the reaction, electrophoresis was performed on a 1% agarose gel. Based on the DNA marker, bacterial cultures with the correct band size were selected for sequencing. Positive clones were then cultured overnight at 37°C in 50 mL of LB broth containing the appropriate antibiotic.
[0126] 10. Plasmid extraction
[0127] Plasmids were extracted using the TIANGEN Plasmid Mini-Prep Kit DP103, as follows:
[0128] (1) Take 50 mL of Escherichia coli culture that has been cultured overnight, centrifuge at 5,000 rpm for 7 min at room temperature to collect the bacteria, and discard the supernatant.
[0129] (2) Add 250 μL of solution P1 and vortex to resuspend the bacterial cells. Transfer the resuspended solution to a 2 mL centrifuge tube, add 250 μL of solution P2, and gently vortex 6 times until the bacterial solution becomes clear. Then add 350 μL of solution P3 and immediately gently vortex 6 times until a white flocculent precipitate appears. Centrifuge at 12,000 rpm for 10 min at room temperature.
[0130] (3) Perform column equilibration. Add 500 μL of equilibration solution to the adsorption column containing the collection tube, centrifuge at 12,000 rpm for 1 min at room temperature, discard the waste liquid, and put the adsorption column back into the collection tube. Carefully transfer the supernatant collected in (2) into the adsorption column using a pipette, centrifuge at 12,000 rpm for 1 min at room temperature, discard the waste liquid, and put the adsorption column back into the collection tube.
[0131] (4) Add 600 μL of washing solution to the adsorption column, centrifuge at 12,000 rpm for 1 min at room temperature, discard the waste liquid, and put the adsorption column back into the collection tube. Repeat this step.
[0132] (5) Place the adsorption column back into the collection tube, centrifuge at 12,000 rpm for 2 min at room temperature, and let stand at room temperature for several minutes to completely remove residual liquid. Then place the adsorption column into a new 1.5 mL centrifuge tube, add 50 μL of elution buffer to the center of the adsorption membrane, let stand at room temperature for 2 min, centrifuge at 12,000 rpm for 2 min at room temperature, and collect the plasmid into the centrifuge tube. Store at -20℃ for later use.
[0133] 11. Agrobacterium-mediated transformation
[0134] The vector was transformed using GV3101 (catalog number: B528430-0100) from Shanghai Sangon Biotech Co., Ltd. The transformation procedure is as follows:
[0135] (1) Take the competent Agrobacterium cells stored at -80℃ and let them partially melt at room temperature or in the palm of your hand. When they are in an ice-water mixture, insert them into ice.
[0136] (2) Add 0.5 μg plasmid DNA to each 100 μL competent cells, gently stir the bottom of the tube to mix, and then incubate on ice for 5 min, in liquid nitrogen for 5 min, in a 37℃ water bath for 5 min, and in an ice bath for 5 min.
[0137] (3) Add 700 μL of antibiotic-free LB liquid medium and incubate at 28°C with shaking for 2.5 h.
[0138] (4) Centrifuge at 6000 rpm for 1 min to collect bacteria. Take about 100 μL of supernatant, gently pipette and resuspend the bacterial block, spread it on LB agar containing the corresponding antibiotic, and invert it in an incubator at 28℃ for 2 days.
[0139] 12. Identification of positive transforming bacteria
[0140] Several single colonies were picked from the transformation plate and added to 500 μL of Kana.+Rif. double-antibiotic LB medium. The culture was incubated at 28℃ with shaking at 220 rpm for 12 h until the bacterial culture became turbid, and then subjected to PCR identification. The PCR reaction system and amplification procedure were the same as those in Tables 6 and 7, using the primer pair CXTRV2F / CXTRV2R (see Table 9).
[0141] After PCR amplification, agarose gel electrophoresis (1%) was performed for detection. According to the DNA marker, the bacterial solution with the correct size of the electrophoretic band is the positive clone.
[0142] 13. Preparation of Agrobacterium infection solution
[0143] (1) The Agrobacterium positive transformation clones identified above were inoculated into 2 mL of Kana.+Rif. double-antibiotic LB liquid medium for activation culture. The culture was carried out at 28℃ with shaking at 220 rpm for 12 h until the bacterial culture became turbid.
[0144] (2) Take 500 μL of activated bacterial culture and inoculate it into 50 mL of Kana.+Rif. double-antibiotic LB liquid medium for expansion culture. Incubate overnight at 220 rpm in a shaker at 28℃.
[0145] (3) Transfer all the overnight cultured bacterial solution to a 50 mL centrifuge tube, centrifuge at 5000 rpm for 8 min, discard the supernatant and collect the bacterial cells.
[0146] (4) The bacterial cells were resuspended in sterile resuspension (4.4 g / L MS, 30 g / L glucose, 200 μmol / L acetylsuccine), and the OD of the resuspension was measured using a spectrophotometer. 600 The value was adjusted to approximately 1.0. The resuspensions containing TRV1 and TRV2 (control group) or constructed TRV2-derived vectors (treatment group) were mixed at a 1:1 (volume ratio) and placed in a 300 mL volumetric flask. The mixture was then incubated at room temperature in the dark for at least 1 h to obtain the infection solution.
[0147] 14. Rose infection
[0148] (1) Take the rooted seedlings out of the tissue culture bottle, rinse the root culture medium with clean water, and put them into a foam box filled with water for later use. Use the needle of a 1 mL syringe to gently draw lines on the back of the rose seedling leaves, with the direction of the lines perpendicular to the leaf veins, being careful not to cut through the leaves (as shown in Figure 4).
[0149] (2) Place the rose seedlings after marking them upside down in the invasive dye solution, cover the bottle mouth with a perforated plastic film, put the volumetric flask into a vacuum chamber, evacuate to a negative pressure of 0.06 kPa, continue for 15 min, and start slowly releasing the gas when counting down 30 s.
[0150] (3) After the seedlings have been infected, place them in a piece of kitchen paper with appropriate moisture, fold the four corners to cover the seedlings, wrap them with a dry paper towel, and then put them into a sealed bag. The sealed bag should be expanded to avoid compression. Incubate in the dark at 20°C for 24 hours.
[0151] (4) The next day, take out the seedlings, rinse them with clean water, dip them in rooting powder, and transplant them into the soil. Cover them with a film for 5 days, then remove the film. During this period, observe the growth of the seedlings frequently and adjust the humidity accordingly.
[0152] (5) DNA was extracted about 2 weeks after transplantation to detect VIGS virus activity.
[0153] 15. Quantitative detection of silencing efficiency
[0154] RNA was extracted from leaves of infected plants and control groups and reverse transcribed, as described above. The reverse-transcribed cDNA was diluted 10-fold and used as a template for quantitative real-time PCR detection using the Nearshore Protein PCR Kit E096. Using RcUBC as the reference gene, qRT-PCR was performed on an AppliedBiosystems QuantStudio 7 Flex Real-Time PCR System using primer pairs qPCR-PIP2-F / qPCR-PIP2-R and qPCR-UBC-F / qPCR-UBC-R (see Table 9). Each sample was tested in triplicate. Samples were added rapidly and accurately on ice. The reaction system is shown in Table 8. Reaction program: Pre-denaturation: 95℃, 1 min; Cycling reaction: 95℃, 20 s, 60℃, 1 min (40 cycles); Melting curve: 95℃, 15 s; 60℃, 1 min; 95℃, 15 s.
[0155] Table 8 Real-time quantitative fluorescence PCR reaction system
[0156] Component dosage: 2×NovoStart® SYBR qPCR SuperMix Plus 5 μL cDNA 4.4 μL LOX II 0.2 μL Forward Primer 0.2 μL Reverse Primer 0.2 μL surface
[0157] After the reaction, the melting curve was examined to rule out the influence of primer dimer structure on the experiment, ensuring the specificity of the reaction. The relative expression level of the gene was determined by 2... -ΔΔCT Relative quantification was performed, and a t-test was used to analyze the significance of relative transcription levels between the control group and the control group. The results are shown in Figures 5-6.
[0158] As shown in Figure 5, virus-induced gene silencing (VIGS) experiments were conducted on the thorny rose variety R. 'Samantha'. The results showed that the expression level of PIP2;1 was significantly reduced to approximately 25%. Compared with plants infected with the empty vector (EV), all VIGS-treated plants showed a reduction in the number of thorns in the second (P = 0.0012) and third (P = 0.01) nodes below the flower stalk (Figure 6B), and the number of thorns in the first node immediately adjacent to the flower stalk was also reduced, but the difference was not significant (P = 0.39). The silencing effect may weaken with prolonged infection time. No other significant phenotypic changes were observed. Combined with the thorn-specific expression pattern of this gene, it suggests that PIP2;1 regulates rose growth in a thorn-specific manner.
[0159] Table 9 Primer information used in the experiment (SEQ ID NO: 3-12)
[0160] Primer name sequence information (5'-3') FRcPIP2ACTCCATGGGGATCCG ACAGAGCCATCATTGCAGAA RRcPIP2AAGACGCGTGAGCTCG CCAAGGATTGAGCCACAATA JC-FTGGGAGATGATACGCTGTTJC-RCCTAAAACTTCAGACACGCXTRV2FGTTACTCAAGGAAGCACGCXTRV2RACCGTAGTTTAATGTCTTCGqPCR-PIP2-FGAA GTTTCGGAGCTGCAGTGqPCR-PIP2-RAAAGAACCCGAAGCCTTAGCAqPCR-UBC-FGCCAGAGATTGCCCATATGTAqPCR-UBC-RTCACAGAGTCCTAGCAGCACA surface
[0161] Experiment Example 2
[0162] 1. Genome identification of eight Rosaceae species belonging to the AQP family
[0163] The genome sequences and gff3 files of eight Rosaceae species were obtained from GDR (https: / / www.rosaceae.org / ) and PlantGIR, including *Rosa wichuraiana 'Basye's Thornless' (BT, 'thornless glossy-leaved rose'), *Rosa chinensis 'Old blush' (OB, 'monthly pink'), *Rosa rugosa*, *Fragaria vesca*, *Malus x domestica*, *Prunus armeniaca*, *Pyrus ussuriensis x communisZhongai*, and *Rubus occidentalis*. Using the protein sequences of Arabidopsis AQP gene family members as reference sequences, the AQP gene family members of the eight Rosaceae species were obtained through alignment using the BLAST Wrapper function of TBtools-II (v2.152). Simultaneously, seed file PF00230 was downloaded from the Pfam database, and the Simple HMM search function of TBtools was used to obtain genes containing conserved MIP protein domains from eight Rosaceae species. The union of AQP members identified by the two methods was used as candidate members. Then, all candidate AQP protein sequences were submitted to the Interpro database and the CDD database of the National Center for Biotechnology Information (NCBI) for verification. Redundant and mismatched amino acid sequences were removed, and finally, the AQP gene family members of eight Rosaceae species were obtained. Arabidopsis thaliana and tomato were used as outgroups, and a maximum likelihood tree was constructed using IQ-TREE with the eight Rosaceae AQP protein sequences to analyze the phylogenetic relationships of Rosaceae AQP proteins.
[0164] Based on protein sequence alignment, a total of 325 AQPs were identified in eight Rosaceae species. These were divided into five subfamilies according to phylogenetic relationships: PIP, TIP, NIP, SIP, and XIP. The number of AQPs varied among species, specifically: 'Bare-leaved Rosa 'Spindle-free' (BT) 37, 'Monthly Pink' (OB) 38, rose 37, strawberry 40, apple 49, apricot 51, pear 42, and Rubus 31. Rubus had the fewest AQPs, while apricot had the most. The PIP subfamily of apricot had the most members, twice that of Rubus. Apple had 13 TIPs, 1.6 times that of Rubus; strawberry had the most NIPs, approximately 1.8 times that of Rubus. The SIP subfamily showed the least variation. The XIP subfamily exhibited considerable variation, with OB containing six XIPs and Rubus containing only one. These findings highlight the significant interspecific variation among Rosaceae AQPs. In summary, while the protein sequences of Rosaceae AQPs are highly conserved, gene copy numbers vary among species.
[0165] 2. Phylogenetic relationships and motif analysis of RwAQP and RcAQP family members
[0166] The AQP family members of *R. chinensis* (OB), *R. wichuraiana* (BT), and the model plant *Arabidopsis thaliana* were compared using MEGA's Muscle algorithm. Maximum likelihood (ML) was employed, with the bootstrap coefficient set to 1000 iterations, and repeated experiments were performed to construct phylogenetic trees. Conserved motifs of the RwAQP and RcAQP family proteins were analyzed using the MEME online tool, with a limit value of 15. The phylogenetic trees were beautified and motif analysis results were performed using the iTOL website. The results are shown in Figure 7.
[0167] To investigate the diversity of AQPs in gene expression and structure, a systematic comparative analysis of AQP family members in OB and BT was conducted. The results showed that AQP proteins in both species could be classified into five subfamilies, with PIP further divided into PIP1 and PIP2 subgroups. MEME analysis identified 15 conserved motifs, most of which were conserved within their respective subfamilies. MEME analysis also identified 15 conserved motifs, with motif 1 being prevalent in most AQP protein sequences, but not detected in only one RwNIP (Rw7G039920.1) and two RcNIPs (RchChr7g0238841 and RchChr2g0168391) protein sequences (Figure 7).
[0168] 3. Basic properties, subcellular localization prediction, and phosphorylation site analysis of RwAQP and RcAQP family members.
[0169] The amino acid number, molecular weight (MW), and theoretical isoelectric point (pI) of RwAQP and RcAQP proteins were predicted online using ExPASy. Subcellular localization of RwAQP and RcAQP proteins was predicted using WoLF PSORT. Phosphorylation sites of RwAQP and RcAQP proteins were predicted using NetPhos 3.1.
[0170] The analysis revealed differences in protein length, molecular weight, and isoelectric point among the aforementioned AQPs. Phosphorylation site prediction showed that, except for one XIP and one NIP, serine (Ser), threonine (Thr), and tyrosine (Tyr) phosphorylation sites were detected in the sequences of the remaining RcAQPs and RwAQPs proteins. Subcellular localization prediction indicated that most AQPs proteins were located on the plasma membrane, with a small number located in vacuoles, chloroplasts, and cytoplasm. Overall, these results demonstrate a high degree of conservation of protein characteristics between RcAQPs and RwAQPs.
[0171] 4. Chromosomal localization, collinearity analysis, and gene structure analysis of AQP family members.
[0172] The sequence information of the selected RwAQP and RcAQP genes was used to locate them on chromosomes using the Gene LocationViaualize function of TBtools. Collinearity of the AQP gene family in the BT and OB genomes was analyzed using the MCscan module of the JCVI toolkit, and finally visualized using TBtools. The intron-exon distribution of RwAQP and RcAQP gene family members was visualized using GSDS 2.0. The results are shown in Figures 8-10.
[0173] Chromosomal mapping analysis showed that the 38 RcAQPs and 37 RwAQPs genes were unevenly distributed across chromosomes. The highest number of AQPs members (11) were located on chromosome 6 of OB; the highest gene density (8 AQPs) was found on chromosome 2 of BT; and the lowest gene density (only two AQPs) was found on chromosome 4 of both OB and BT. Furthermore, BT had 3 AQPs genes that were not mapped to any of the 7 chromosomes (Figure 8).
[0174] Collinearity analysis of the OB and BT genomes revealed a strong collinearity between RcAQPs and RwAQPs (Figure 9), and identified 35 orthologous gene pairs. Overall, chromosomes 2 and 4 of both BT and OB contained the largest number of collinear genes, with 7 pairs in each chromosome.
[0175] Based on the high conservation of protein structure, the analysis of the nonsynonymous to synonymous mutation ratio (Ka / Ks) of 35 orthologous gene pairs showed that the Ka / Ks values of all orthologous gene pairs were less than 1 (Figure 10), especially in the PIP and TIP subfamilies, indicating that purification selection dominated the evolutionary process of AQP genes.
[0176] Gene structure analysis revealed significant intron-exon differences among AQP subfamilies. RwAQPs had gene lengths ranging from 708 to 5856 bp, with the number of introns varying from 0 to 6; RcAQPs had gene lengths ranging from 545 to 5856 bp, with the number of introns varying from 0 to 7. Except for Rw0G004180.1 in BT and RchChr6g0303511 and RchChr6g0303531 in OB, which have four introns, all PIPs primarily had three introns. Most TIPs, SIPs, and XIPs contained two introns. RwNIPs typically had four introns, while RcNIPs varied considerably, ranging from 1 to 7 introns. Although the number of introns in the AQP gene structure differed significantly, a clear subfamily-specific pattern still existed.
[0177] The results in summary indicate that RcAQPs and RwAQPs have good collinearity and variable gene structures.
[0178] Although the technical solution of the present invention has been described in detail above with general descriptions, specific embodiments, and experimental examples, it should be noted that the embodiments and experimental examples are only used to illustrate the technical solution and technical effects of the present invention, and should not be regarded as any limitation on the scope of protection of the present invention. Simple modifications, alterations, or improvements made based on the technical concept of the present invention are all within the scope of protection claimed by the present invention.
Claims
1. The application of inhibiting the expression of the rose thorn regulatory gene RcPIP2;1 in the cultivation of thornless or thornless roses, characterized by: The nucleotide sequence of the rose prickles regulatory gene RcPIP2;1 is shown in SEQ ID NO:
1.
2. The application according to claim 1, characterized in that: The expression of the rose prickle-regulating gene RcPIP2;1 was inhibited using virus-mediated gene silencing technology, and the nucleotide sequence of the silenced fragment is shown in SEQ ID NO:
2.
3. The application according to claim 2, characterized in that: The application includes the following steps: inserting a nucleotide sequence that inhibits the expression of the rose thorn regulatory gene RcPIP2;1 into a viral vector; transforming Agrobacterium with the viral vector; infecting rose seedlings with Agrobacterium; culturing the rose seedlings to obtain roses with altered thorn traits.
4. The application according to claim 3, characterized in that: The insertion of the nucleotide sequence for inhibiting the expression of the rose prickle regulatory gene RcPIP2;1 into a viral vector includes: using rose cDNA obtained by reverse transcription as a template, performing PCR amplification using primer pair FRcPIP2A / RRcPIP2A, and ligating the amplification product into a linearized viral vector; the nucleotide sequence of primer pair FRcPIP2A / RRcPIP2A is shown in SEQ ID NO: 3-4; and / or, the viral vector includes pYL192 (TRV1) and pTRV2, both of which are Kana resistant; the silencing fragment is inserted into pTRV2; and / or, the Agrobacterium strain is GV3101.
5. A method for inhibiting the expression of the rose thorn regulatory gene RcPIP2;1 to cultivate thornless or thornless roses, characterized in that: Includes the following steps: The nucleotide sequence that inhibits the expression of the rose thorn regulatory gene RcPIP2;1 is inserted into a viral vector; Agrobacterium is transformed with the viral vector; rose seedlings are infected with Agrobacterium; and the rose seedlings are cultured. The nucleotide sequence of the rose thorn regulatory gene RcPIP2;1 is shown in SEQ ID NO:
1.
6. The method according to claim 5, characterized in that: The nucleotide sequence for inhibiting the expression of the rose prickle regulatory gene RcPIP2;1 is a silenced fragment designed based on virus-mediated gene silencing technology, and the nucleotide sequence of the silenced fragment is shown in SEQ ID NO:
2.
7. The method according to claim 6, characterized in that: The insertion of the nucleotide sequence for inhibiting the expression of the rose prickle regulatory gene RcPIP2;1 into a viral vector includes: using rose cDNA obtained by reverse transcription as a template, performing PCR amplification using primer pair FRcPIP2A / RRcPIP2A, and ligating the amplification product into a linearized viral vector; the nucleotide sequence of primer pair FRcPIP2A / RRcPIP2A is shown in SEQ ID NO: 3-4; and / or, the viral vector includes pYL192 (TRV1) and pTRV2, both of which are Kana resistant; the silencing fragment is inserted into pTRV2; and / or, the Agrobacterium strain is GV3101.
Citation Information
Patent Citations
A rose thorn regulatory gene RrCPC and its application
CN114438097B
GRF1 gene and application thereof in skin thorn character regulation and control
CN119432900A
Rose skin thorn regulation gene RrCPC and application thereof
CN114438097A
Specific expression promoter proRcLAC15 for barks and thorns of Chinese roses and application of specific expression promoter proRcLAC15
CN115927310A