SNP (Single Nucleotide Polymorphism) site and gene related to fast-growing and high-yield traits of argopecten irradias and application of SNP site and gene

Abstract

The invention discloses an SNP (Single Nucleotide Polymorphism) site related to fast-growing and high-yield traits of argopecten irradias, a gene and application of the SNP site and the gene. The loci are located at the 3rd 885th site and the 288 site (chr10-3885288) of the No.10 chromosome of the argopecten irradians, are located in an intron region of an EPDR1 gene, show T / C base polymorphism, and have significant relevance with the growth traits of the argopecten irradians. Experimental results show that different genotypes of the site are obviously related to shell height characters, and TT and TC genotype individuals show obvious growth advantages. In addition, experiments further prove that the growth of the scallops can be promoted by inhibiting the expression of the bay scallop EPDR1 gene. Based on the discovery, the SNP locus and the EPDR1 gene where the SNP locus is located can serve as key molecular markers, the key genes are used for breeding of fast-growing and high-yield new varieties of the argopecten irradians, the breeding efficiency can be effectively improved, and the breeding process of improved varieties is accelerated.

Description

Technical Field

[0001] This invention belongs to the field of shellfish genetics and molecular breeding in marine agriculture, specifically involving an SNP locus, gene, and its application related to the fast-growing and high-yielding traits of bay scallops. Background Technology

[0002] Shellfish are the dominant economic species in my country's marine aquaculture. According to data from the "2025 China Fisheries Statistical Yearbook," in 2024, my country's shellfish farming area reached 1,398,326 hectares, with a yield of 17,394,861 tons, ranking first among all marine aquaculture species, accounting for 62% and 69% of the total farming area and yield, respectively. Bay scallops ( Argopecten irradians As an important species in my country's marine aquaculture, the scallop (Gulf scallop) has an annual output of approximately 800,000 tons, accounting for 45% of my country's total scallop production. It plays a vital role in ensuring the construction of the "blue granary" (marine resources) and promoting the development of the marine economy. However, with the continuous expansion of the scale of Gulf scallop farming, the problems of slow growth rate and small individual size have become increasingly prominent. Breeding new varieties of fast-growing and high-yielding Gulf scallops has become a research hotspot in the aquaculture field.

[0003] Molecular marker-assisted breeding is a technique that utilizes molecular markers closely related to or associated with target traits for selection and breeding. This technology can significantly shorten breeding time and accelerate the breeding process, and has become an indispensable key technology in modern breeding systems. Single nucleotide polymorphisms (SNPs) are DNA sequence polymorphisms caused by variations in a single nucleotide. They are widely distributed and highly stable, making them ideal molecular markers. Currently, SNP sites related to growth traits have been systematically screened in various marine organisms (such as fish, shrimp, sea cucumbers, and some shellfish) and successfully applied in breeding practices. For example, Chinese patent application No. 201410035028.9 discloses an SNP site related to growth traits in the scallop *Sinocyclocheilus* and its detection and application. Experiments have shown that the site C.1054A>G on the IGFBP gene is significantly associated with important growth traits of *Sinocyclocheilus*, such as shell height, shell length, body weight, soft body weight, and adductor muscle weight. However, research on SNP sites significantly associated with growth traits in bay scallops remains relatively weak, with few related reports. Therefore, systematically screening and identifying SNP sites related to the growth of Gulf scallops and developing molecular markers that can be used for breeding assistance is of great practical significance for cultivating new varieties of fast-growing and high-yielding Gulf scallops. Summary of the Invention

[0004] In view of the shortcomings of existing technologies, this invention proposes an SNP locus, gene and its application related to the fast growth and high yield traits of Gulf scallops, providing effective molecular markers and technical means for the genetic breeding of Gulf scallops.

[0005] The technical solution of this invention mainly includes the following: This invention provides a SNP locus (chr10-38857288) associated with the rapid growth and high yield traits of the Gulf scallop, wherein the SNP locus is located in the Gulf scallop. EPDR1 The 116th base of the intron region of the gene (positions 3,885,288 of chromosome 10 of the Gulf scallop) has a base of either T or C, and the base sequence of the intron region is shown in SEQ ID NO:1.

[0006] SEQ ID NO:1: CCACATGACCTTCATACTAGACCAGAATTTGTTAGTTACCTTTTGACTTTTCGTATTAAGGTATAGATGAATTGATATATATAGGCATACAAGAGGTCACTAGTTTAAACGGGGT C TTAACCATTAAGGAAACAGAATAGGCCAGAACATCGAAAACATAATAATATGATATTGTGACTATAAATCATTTTCTCATTGAAATGTTATTTTTACGGTATTTTGTGTAAGCAAATTCTAAATATACAAACTTCCTTAACGATCACCTTTTTATAAATACCAAATGCTGAATAAGACCACTTTTATAGGGTCCCGTATTGATATTTTCCATTATAATTCAAGTTATGTCTGACCGCCCG The present invention also provides primers for amplifying the SNP sites, the nucleotide sequences of which are shown in SEQ ID NO:2 (5'-CCACATGACCTTCATACTAGACCAGAA-3') and SEQ ID NO:3 (5'-CGGGCGGTCAGACATAACTTGA-3').

[0007] The present invention also provides a kit for amplifying the aforementioned SNP sites, the kit containing the primers and PCR amplification reagents. The PCR amplification reagents include 2× Taq PCR Master Mix.

[0008] Furthermore, this invention provides the application of the SNP locus, the primers, or the kit in the breeding of fast-growing and high-yielding bay scallops. Specifically, it involves identifying the genotype of the SNP locus; if the genotype is TT or TC, the tested samples are all large individuals; if the genotype is CC, the tested samples are mostly small individuals.

[0009] Furthermore, the application is as follows: genomic DNA is extracted from the gill tissue of bay scallops as a template, PCR amplification is performed using the primers or the kit, and Sanger sequencing is performed on the PCR amplification products to determine the genotype of the SNP site. If the genotype is TT or TC, the tested samples are all large individuals; if the genotype is CC, the tested samples are mostly small individuals.

[0010] On the other hand, the present invention also provides a method for breeding fast-growing and high-yielding bay scallops, comprising the following (1) and / or (2): (1) Identify the genotype of the SNP locus and select individuals with genotype TT or TC for breeding to obtain fast-growing and high-yielding bay scallops; (2) Suppressing Gulf scallops EPDR1 Gene expression to obtain fast-growing, high-yield bay scallops; the aforementioned EPDR1 The CDS sequence of the gene is shown in SEQ ID NO:4.

[0011] SEQ ID NO:4: ATGATCACTCTAGCTCTGGTCTGTTTTAGTAGCCTCATTGCACTAAGTTCCGGTAAGGGATGTTGTTCACCTCCGCAGTGGGAACGTACCGAGTATATCTCGGGTACAGAAGTGGTCAGCGGAAAGATGATCACTGTCCAGGGAGAAGCACGAACGTCCTATGATGCTAACGCTAGGAAGATAATGAATGAGTTTTCAATCATGCGAGGACAGCAACAGATCGCGCAACTCTCACTTATGGACTACGCAGCCGTAAACTCTGCCCCACCTGCCATCCCTATGTATTTTGGAACAGGTGACAATAAGATAAATGTGATGAATTACGTATTGGCTGACCCCTCTGGGATTATCACCTCTCTGCTTGTGTCAGATGGCTGTCCATATGCTTTGTCACTCGGATATAACGGTACTACAATCGGGATTAAAGATCCTTCGGTCTTCGACGTTCCAGCAGAATGTAAACACGACACAGATCCAGTGAGAGTCGATCCTGTTCAACAGGCTCCACGAAAATGCTGTTTCCCCCAAAAGTTTCAGTCGCCGGGAGGTATGATTGGTCTCGTAGAGACTGGTGGCAAAACGTATTTTCAGTCGACGAACCTGAATATTTCGTATGATGCCACGCTCCAGAAGCAAGCGACTGTATCCCAAACAAGTATAAATGAATCTCCTCCAACAATCGAAATCGAACTGAAAGACTACCGCGTTGGAGTTCAATACAACGTGAGAAATGGAAAATGCTTTAAAAATCCACTGAAGTCTCCCATGCCCAATTGCATACCAGATGATGCCACATACGAGCCGATGGTCATGGGATCTGGCGCTACCAAACTGAAAGGGGGAGTATATACGCCACAGAGGTTGAAAACGCTAGGCTATCTGTTTGGCAAATCTAGTCCTGGTCCCAGGCAAACGTCAACTTAA Furthermore, the (1) includes the following steps: Genomic DNA was extracted from the gill tissue of bay scallops as a template, and PCR amplification was performed using the primers or the kit. The PCR amplification products were then subjected to Sanger sequencing to determine the genotype of the SNP locus. Individuals with the genotype TT or TC were selected for cultivation to obtain fast-growing and high-yielding bay scallops.

[0012] Furthermore, step (2) includes the following steps: 1) Targeting Gulf scallops EPDR1 Design siRNA interference fragments from the CDS sequence of the gene; 2) Construct the L4440 recombinant plasmid containing the interfering fragment; and transform the recombinant plasmid into HT115 Escherichia coli competent cells to obtain Escherichia coli containing the recombinant plasmid; 3) Induction of dsRNA expression via IPTG; 4) Mixing dsRNA-expressing bacteria with Chlorella vulgaris and feeding the mixture to Gulf scallops to inhibit their growth. EPDR1 Gene expression is used to obtain fast-growing and high-yield bay scallops.

[0013] The beneficial effects of this invention are: This invention identifies a major SNP locus (chr10-38857288) that is highly significantly associated with the bay scallop shell. By detecting the genotype of this invention's SNP locus, it is possible to quickly and accurately screen bay scallop individuals with rapid growth and high yield potential. Compared with traditional breeding methods, this can greatly shorten the breeding time and improve breeding efficiency.

[0014] The present invention further analyzes the location of the SNP sites. EPDR1 Genes, experiments show, EPDR1 Gene expression levels have a significant impact on the growth of Gulf scallops; high expression may negatively regulate growth traits in Gulf scallops, while interference... EPDR1 The gene can effectively promote the growth of Gulf scallops. Based on this SNP locus and EPDR1 Genes, as molecular markers and key genes, can be used to cultivate new fast-growing and high-yielding varieties of bay scallops in a targeted manner, accelerate the breeding process of superior varieties, and provide excellent seedlings for the bay scallop farming industry. Attached Figure Description

[0015] Figure 1 Statistics on high-trait characteristics of bay scallop shells in large / small groups.

[0016] Figure 2 Large / small Gulf scallop EPDR1 Statistics on the relative expression levels of genes.

[0017] Figure 3 : 41 days of RNA interference in bay scallopsEPDR1 Gene expression status.

[0018] Figure 4 Statistical analysis of metabolic rate of bay scallops in each group 41 days after RNA interference.

[0019] Figure 5 Images and growth traits of bay scallops in each group 41 days after RNA interference. (A) Bay scallop growth, with the green line representing newly grown parts during the experiment. (B) Statistical results of growth traits of bay scallops in each group. Detailed Implementation

[0020] To facilitate a better understanding of the technical content of this invention by those skilled in the art, the invention will be further described in detail below through specific embodiments and accompanying drawings. Unless otherwise specified, any reagents or pharmaceuticals involved in the following embodiments are commercially available products.

[0021] Example 1 In July 2025, 30 bay scallops of different growth stages (maximum and small shell height, total population N>1,000) were selected from the sea area of ​​west coast of Qingdao for the detection and application of SNP loci associated with high shell trait. The specific steps are as follows: 1. Statistical analysis of high-quality scallop shell traits The shell height of the 60 bay scallops was measured using vernier calipers, and the phenotypic differences between the large and small individual groups were assessed. The results showed that the shell height of the large individual group was 44.53 ± 1.91 mm, and the shell height of the small individual group was 24.57 ± 1.63 mm, with the difference between the two groups reaching a highly significant level. Figure 1 ; P = 5.49×10 -46 ).

[0022] 2. SNP typing (1) DNA extraction and PCR Two gill filaments were gently picked up with tweezers, and genomic DNA was extracted from the bay scallop using the phenol-chloroform extraction method. Using the genomic DNA as a template, PCR amplification was performed using the typing primers SEQ ID NO:2 and SEQ ID NO:3. The PCR reaction system (Table 1) and reaction procedure (Table 2) are as follows: Table 1. PCR reaction system

[0023] Table 2. PCR reaction procedure

[0024] (2) Sanger sequencing of PCR products The PCR products were quality-assessed using 1.5% agarose gel electrophoresis, and the results showed that the target band was clear and free of impurities. Products meeting the quality requirements were sent to Shanghai Sangon Biotech Co., Ltd. for Sanger sequencing.

[0025] (3) Genotype analysis Genotypes at the target SNP locus (chr10-38857288) for each bay scallop individual were interpreted based on sequencing peak patterns: single peaks represented homozygous genotypes (TT or CC); overlapping double peaks represented heterozygous genotypes (TC). The genotype statistics are shown in Table 3: individuals with genotypes of TT or TC at this SNP locus belonged to the large individual group, while individuals with genotype CC mostly belonged to the small individual group. Specifically, among the 30 individuals in the large individual group, 20 had the TT genotype, 4 had the TC genotype, and 6 had the CC genotype; while all individuals in the small individual group had the CC genotype. Fisher's exact test analysis showed a highly significant difference in genotype between the large and small individual groups of bay scallops at this SNP locus (…). P = 2.06×10 -09 ).

[0026] Table 3. Genotypic composition of the chr10-38857288 locus in large and small bay scallops.

[0027] Example 2 To verify the location of SNP chr10-38857288 EPDR1 To investigate the relationship between gene expression and the growth of bay scallops, the following experiment was conducted.

[0028] 1. EPDR1 Differential expression analysis (1) Experimental materials: The data on the individual bay scallops and their shell height were the same as in Example 1.

[0029] (2) Tissue dissection: Tissue samples were obtained from the bay scallops, quickly frozen in liquid nitrogen, and then transferred to... Store in a refrigerator at 80°C.

[0030] (3) RNA extraction and reverse transcription: 0.20 g of skeletal muscle tissue from bay scallops was weighed, and total RNA was extracted from the tissue using the TRIzol method. The RNA concentration was determined using Nanodrop, and RNA integrity was assessed by 1.5% agarose gel electrophoresis (RNA loading amount was 300 ng).

[0031] Take 500 ng of total RNA, add 1 μL of oligo d(T) primer, and make up to 12.5 μL with DEPC water. Mix well and incubate in a 65℃ metal bath for 5 min. Then add to the reverse transcription reaction system (Table 4), and perform reverse transcription to synthesize cDNA in a PCR instrument according to the procedure shown in Table 5.

[0032] Table 4. Reverse transcription reaction system

[0033] Table 5. Reverse transcription procedure

[0034] (4) EPDR1 Gene relative expression level determination: Gulf scallop internal reference gene EF1A The primer sequences are as follows: the upstream primer is 5'-ACTGGAACCTCCCAAGCCGAT-3' (SEQ ID NO:5); the downstream primer is 5'-TTTACACCAAGCGTGTAGGCGAG-3' (SEQ ID NO:6).

[0035] EPDR1 The primer sequences are as follows: the upstream primer is 5'-CTCCAGAAGCAAGCGACTGTATCC-3' (SEQ ID NO:7); the downstream primer is 5'-CATCGGCTCGTATGTGGCATCAT-3' (SEQ ID NO:8).

[0036] The qRT-PCR reaction system was prepared under light-protected conditions on ice (Table 6) and aliquoted into 384-well plates, with three technical replicates for each target gene per sample. After centrifugation at 1,800 rpm for 2 minutes, the plates were amplified using a real-time quantitative PCR instrument according to the preset program (Table 7). Two... -△△Ct The method calculates the values ​​in the large and small individual groups separately. EPDR1 The relative expression level of genes.

[0037] Table 6. qRT-PCR reaction system

[0038] Table 7. qRT-PCR reaction procedure

[0039] Between large and small individual groups EPDR1 Gene expression showed highly significant differences. Figure 2 ; P = 0.000113), large individual group of bay scallops EPDR1The relative expression level (19.29 ± 11.30) was significantly lower than that of the small individual group (40.76 ± 24.13). The results indicate that the expression level at the chr10-38857288 locus... EPDR1 Gene expression levels have a significant impact on the growth of bay scallops, and high expression of these genes may negatively regulate the growth traits of bay scallops.

[0040] 2. RNAi verification EPDR1 Function (1) Experimental animals: In September 2025, 80 bay scallops (total population N>1,000) from the same population with no significant differences in body size and weight were collected from the sea area of ​​the west coast of Qingdao. Their initial body size / weight traits were measured: shell height (39.58 ± 0.75 mm), shell length (40.86 ± 1.04 mm), shell width (16.03 ± 1.22 mm), and body weight (12.56 ± 1.36 mm). The 80 bay scallop individuals were randomly divided into 4 groups (20 individuals in each group): control group, L4440 group, ds group, and ds group. EGFP Groups and ds EPDR1 Group. All scallops were temporarily held in aerated seawater at 22°C.

[0041] (2) Construction of L4440 interference plasmid: Bay scallops EPDR1 and EGFP The CDS fragment (negative control) was submitted to the siDirect website (https: / / sidirect2.rnai.jp / ) to predict high-efficiency siRNA fragments, and interference targets were screened. The interference fragment was aligned to the Gulf scallop CDS file using BLAST to confirm its specificity. The designed interference fragment sequence and the L4440 blank vector were sent to Shanghai Sangon Biotech Co., Ltd. to construct the interference recombinant plasmid. The synthesized plasmid was transformed into HT115 E. coli competent cells and evenly spread on a substrate containing ampicillin (Amp... + ) and tetracycline (Tetracycline) + After incubating the culture on LB solid medium with resistant bacteria at 37°C for 12 h with the medium inverted, single colonies were picked and inoculated into 500 μL of medium containing Amp. + and Tet + In resistant LB medium, shake gently for 6-8 hours, add an equal volume of 60% glycerol, and store in a -80℃ refrigerator for bacterial preservation.

[0042] Bay scallops EPDR1 The gene interference fragment is located at 174-669 bp of SEQ ID NO:4; EGFP Interference fragment sequence (SEQ ID NO:9): ATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGA CCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACCTACGGCGTGCAGTGCTTCAGCCGCTACCCGACCACATGAAGCAGCACGACTTCTTCAAGTC CGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGAC TTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAGAACGGCATCAAGGTGAACTTCAAGATCCGCCACAACATCGAGG.

[0043] (3) dsRNA preparation: Take 10-30 μL of glycerol bacteria and inoculate it into 5 mL of Amp + and Tet + In resistant LB medium, the culture was incubated at 37°C and 220 rpm with gentle shaking for 12-16 hours, then transferred to 50 mL of fresh medium for further expansion. The culture was continued until the exponential growth phase (OD500) was reached. 600 = 0.4-0.6), add isopropyl-β-D-thiogalactoside (IPTG) to a final concentration of 0.5 mmol / L to induce high-efficiency expression of dsRNA. After culturing for 4 hours, centrifuge at 8,000 rpm for 5 min and collect the cell pellet.

[0044] (4) Algae-bacteria mixed feeding: During the interference period, the water was changed twice daily (8:30 and 20:30), with half the water volume changed each time; feeding was done three times daily, with 2 mL of Chlorella concentrate (approximately 100 million cells / mL) given at 8:30 and 14:30, and 2 mL of algae-bacteria mixture given after the water change at 20:30. Specifically: the control group was fed 2 mL of Chlorella concentrate, and the L4440 group was fed 2 mL of Chlorella concentrate mixed with algae-bacteria mixture containing L4440 empty vector plasmid cells, ds EGFPThe group was fed 2 mL of Chlorella concentrate and a bacterial-algal mixture containing EGFP-L4440 recombinant plasmid cells, ds EPDR1 The group was fed 2 mL of Chlorella concentrate and a bacterial-algal mixture containing EPDR1-L4440 recombinant plasmid.

[0045] (5) EPDR1 Determination of relative gene expression levels: Method is the same as " EPDR1 "Differential expression analysis". control group, L4440 group, ds EGFP The relative expression levels in the groups were 1.07 ± 0.48, 0.92 ± 0.51, and 1.06 ± 0.56, respectively, while ds EPDR1 Group of scallops EPDR1 The relative expression level of the gene was significantly lower than that of the other three groups (0.15 ± 0.19, P <0.05), indicating that feeding scallops with recombinant plasmids containing EPDR1-L4440 can effectively reduce the risk of infection. EPDR1 Gene expression levels.

[0046] (6) Metabolic rate determination: Three scallops were randomly selected from each group and placed in a sealed wide-mouthed bottle filled with filtered seawater. The dissolved oxygen concentration (DO; mg / L) and ammonia nitrogen (AN; mg / L) of the seawater were measured at the beginning of the experiment and 2 hours later. After the experiment, the soft parts were dissected and dried in a 60℃ oven to constant weight. The oxygen consumption rate (OR; mg·g) of each group was calculated accordingly. -1 ·h -1 Ammonia excretion rate (NR; mg·g) -1 ·h -1 The oxygen-to-nitrogen ratio (O / N) is calculated using the following formula:

[0047]

[0048]

[0049] Among them, DO0 and DO t AN0 and AN1 represent the dissolved oxygen concentration of seawater measured before and after the experiment, in mg / L; V represents the volume of seawater sealed in the wide-mouthed bottle, in L; W represents the soft-body dry weight of the scallop, in g; t represents the experimental time, in h; AN0 and AN1 represent the total dissolved oxygen concentration of the seawater measured before and after the experiment. t The values ​​represent the ammonia nitrogen concentrations in seawater measured before and after the start of the experiment, in mg / L.

[0050] ds EPDR1 The oxygen consumption rate of the control group was significantly higher than that of the other three groups, increasing by 71.52% compared to the control group. Figure 4 ; P<0.05). The ammonia excretion rate and oxygen-to-nitrogen ratio showed no significant differences compared to the other three groups. These results indicate that feeding bacteria containing the EPDR1-L4440 recombinant plasmid with RNAi via a bacterial-algae co-feeding method can enhance the respiratory metabolic level of bay scallops.

[0051] (7) Growth trait determination: After 41 days of disturbance, significant differentiation in the growth of scallops in each group was observed. EPDR1 The shell height, shell length, shell width, body weight, and meat weight of the control group were 43.23 ± 0.31 mm, 43.20 ± 0.98 mm, 15.98 ± 0.73 mm, 12.87 ± 1.05 g, and 0.53 ± 0.14 g, respectively. Compared with the control group, the shell height, shell length, and meat weight were significantly increased by 9.54%, 5.97%, and 58.42%, respectively. P <0.05), shell width and weight also increased by 1.37% and 12.87%, respectively. Figure 5 The result indicates that interference EPDR1 The gene can effectively promote the growth of bay scallops, further verifying that the locus (chr10-38857288) of this invention is significantly associated with the growth of bay scallops.

[0052] In summary, the SNP locus (chr10-38857288) EPDR1 Gene expression levels are closely related to the growth of Gulf scallops. Feeding bacterial cells containing the EPDR1-L4440 recombinant plasmid can effectively inhibit [gene expression]. EPDR1 Gene expression enhances the body's respiratory metabolism, ultimately promoting scallop growth.

[0053] The embodiments described above are only some embodiments of the present invention and are not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention shall fall within the protection scope of the present invention.

Claims

1. A SNP locus associated with the fast-growing and high-yielding trait of bay scallops, characterized in that, The SNP site is located in the bay scallop. EPDR1 The 116th base of the intron region of the gene, the base at this site is T or C, and the base sequence of the intron region is shown in SEQ ID NO:

1.

2. A primer for amplifying the SNP site of claim 1, characterized in that, The nucleotide sequences of the primers are shown in SEQ ID NO:2 and SEQ ID NO:

3.

3. A kit for amplifying the SNP site of claim 1, characterized in that, The kit contains the primers and PCR amplification reagents as described in claim 2.

4. The reagent kit according to claim 3, characterized in that, The PCR amplification reagents include 2× Taq PCRMaster Mix.

5. The application of the SNP site of claim 1, the primer of claim 2, or the kit of claim 3 in the breeding of fast-growing and high-yielding bay scallops.

6. The application according to claim 5, characterized in that, The genotype of the SNP locus is identified. If the genotype is TT or TC, the tested samples are all large individuals. If the genotype is CC, the tested samples are mostly small individuals.

7. The application according to claim 5, characterized in that, The SNP site described in claim 1 is amplified by PCR using the primers described in claim 2 or the kit described in claim 3. The PCR amplification products are then subjected to Sanger sequencing to determine the genotype of the SNP site. If the genotype is TT or TC, the tested samples are all large individuals. If the genotype is CC, the tested samples are mostly small individuals.

8. A method for breeding a fast-growing, high-yield bay scallop, characterized in that, Including the following (1) and / or (2): (1) Identify the genotype of the SNP locus described in claim 1, and select individuals with the genotype TT or TC for breeding to obtain fast-growing and high-yielding bay scallops; (2) Suppressing Gulf scallops EPDR1 Gene expression to obtain fast-growing, high-yield bay scallops; the aforementioned EPDR1 The CDS sequence of the gene is shown in SEQ ID NO:

4.

9. The method according to claim 8, characterized in that, The above (1) Includes the following steps: The SNP site described in claim 1 is amplified by PCR using the primers described in claim 2 or the kit described in claim 3. The PCR amplification products are then subjected to Sanger sequencing to determine the genotype of the SNP site. Individuals with the genotype TT or TC are selected for cultivation to obtain fast-growing and high-yielding bay scallops.

10. The method according to claim 8, characterized in that, The (2) includes the following steps: 1) Targeting Gulf scallops EPDR1 Design siRNA interference fragments from the CDS sequence of the gene; 2) Construct the L4440 recombinant plasmid containing the interfering fragment; and transform the recombinant plasmid into HT115 Escherichia coli competent cells to obtain Escherichia coli containing the recombinant plasmid; 3) Induction of dsRNA expression via IPTG; 4) Mixing dsRNA-expressing bacteria with Chlorella vulgaris and feeding the mixture to Gulf scallops to inhibit their growth. EPDR1 Gene expression is used to obtain fast-growing and high-yield bay scallops.

Images