Sputum sample pretreatment liquid and reagent suitable for POCT (Point of Care Testing) card box as well as preparation method and application of sputum sample pretreatment liquid and reagent
By preparing a sputum sample pretreatment solution containing Tris buffer, guanidine isothiocyanate, EDTA, lithium chloride, and polyethylene glycol, and then adding a stabilizer and lyophilizing it, the problems of long sputum sample pretreatment time, easy oxidation, and incompatibility with POCT cartridges were solved, achieving rapid and stable sputum sample processing.
Patent Information
- Application Number
- CN202511770707.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-11-28
- Publication Date
- 2026-01-16
AI Technical Summary
Existing sputum sample pretreatment methods suffer from problems such as long processing time, complex operation, easy oxidation, and numerous PCR inhibitors that are not easily compatible with POCT cartridges, affecting detection sensitivity and stability.
A sputum sample pretreatment solution suitable for POCT cartridges was prepared by using a combination of 4mM-6mM Tris buffer, 6M-8M guanidine isothiocyanate, 0.5M-1M EDTA, 0.35M-0.45M lithium chloride, and 15%-20% polyethylene glycol, with the addition of hydroxypropyl-β-cyclodextrin, sorbitol, and sucrose, followed by lyophilization.
It achieves short liquefaction time, is not easily oxidized, has few PCR inhibitors, can be lyophilized, is compatible with POCT cartridges, improves the stability and sensitivity of detection, and solves the shortcomings of conventional methods.
Smart Images

Figure FT_1 
Figure FT_2 
Figure FT_3
Abstract
Description
TECHNICAL FIELD
[0001] The present application belongs to the field of biotechnology, and relates to nucleic acid processing reagents, in particular to a freeze-dryable sputum sample pretreatment liquid and reagent suitable for POCT cartridge, and a preparation method and application thereof. BACKGROUND
[0002] Sputum is a respiratory secretion associated with natural and respiratory infections. For example, bacterial pneumonia, tuberculosis, chronic bronchitis, etc. In addition, fungal infections such as aspergillosis, and viral infections such as influenza, COVID-19, can also be detected through sputum. Due to the high viscosity of mucin, cell debris and PCR inhibitors (such as polysaccharides, hemoglobin) in sputum samples, traditional liquefaction methods (such as N-acetylcysteine) have the following defects: low liquefaction efficiency, long processing time (> 30 minutes); excessive digestion leading to nucleic acid degradation; unable to remove PCR inhibitors simultaneously, requiring additional purification steps; poor wall breaking effect on thick-walled pathogens such as mycobacteria / fungi.
[0003] Clinical testing using sputum as a sample plays an important role in medical diagnosis, especially in the diagnosis and monitoring of respiratory diseases. Sputum often contains bacteria, viruses, fungi or protozoa, all of which can cause respiratory infections. In terms of bacteria, common ones include Streptococcus pneumoniae, Haemophilus influenzae, Moraxella catarrhalis, Staphylococcus aureus, especially MRSA, which is common in hospital infections. Gram-negative bacteria such as Klebsiella pneumoniae, Pseudomonas aeruginosa, Escherichia coli, etc. are also important pathogens. Atypical pathogens such as Mycoplasma pneumoniae, Chlamydia pneumoniae and Legionella also need to be mentioned. In terms of viruses, influenza virus, respiratory syncytial virus (RSV), adenovirus, SARS-CoV-2, etc. are common, especially in children and immunosuppressed patients. In terms of fungal infections, Aspergillus, Cryptococcus, Pneumocystis are common in specific populations such as immunosuppressed patients. In addition, Mycobacterium tuberculosis is still an important pathogen in some areas. Parasites such as lung flukes are not common, but need to be considered in specific areas. Mixed infections, such as bacterial and viral co-infection, also need to be mentioned.
[0004] There are great advances in nucleic acid pretreatment based on sputum samples. Sputum samples are complex in composition and high in viscosity, which are prone to form solid blocks. Pathogens are contained in sputum blocks. Zhang Junli et al. compared the effects of different liquefaction methods on sputum DNA extraction and mentioned Saccomanno liquid: 50% ethanol 48 mL, 2% polyethylene glycol 1 mL, 0.3% rifampicin 1 mL in 50 mL fixing liquid; DTT (dithiothreitol) liquid: 0.1 g DTT, 0.78 g sodium chloride, 0.02 g potassium chloride, 0.112 g sodium dihydrogen phosphate, 0.02 g potassium dihydrogen phosphate, add water to 2 L to make the concentration of DTT 0.005%, mix Saccomanno liquid and DTT solution with equal volume, add 1-2 times volume to sputum, shake for 30 min for liquefaction. This method of using Saccomanno liquid and DTT solution at the same time can reduce the transformation of sputum into gel state and achieve better liquefaction effect. Chinese patent application CN202010372894- A sputum metagenome dehosting extraction kit mentioned 10 mM Tris-HCl, 50 mM DTT (dithiothreitol), 15 mM EDTA-Na2, 0.1% SDC (sodium deoxycholate), 1% Triton X-100 (polyethylene glycol octylphenyl ether), 0.25% SDS (sodium dodecyl sulfate), 20 mM HEPES-KOH to prepare liquefaction liquid, add 1-2 times volume of liquefaction reagent to sputum, shake for 30 min for liquefaction, which can well liquefy the sample and exclude the interference of host. Zhang Junli et al. mixed chloroform: isopropyl alcohol (24:1) with sputum to process sputum samples. He Hui et al. mentioned in the comparison of different liquefaction treatment and nucleic acid co-extraction methods on the extraction effect of viral nucleic acid in sputum samples that 1% DTT and 1╳ PBS buffer treatment for 20 min can better process sputum samples. Ndhlovu V et al. 2018 mentioned 0.5% N-acetic acid-L-cysteine, 2% sodium hydroxide, and 1 times volume of liquefaction agent for sputum liquefaction, and shake for 30 min for good treatment of sputum samples. Gomez DI et al. 2011 mentioned NALC 1.45%, NaOH 2%, 0.03M Na2HPO4-0.03M KH2PO4, add 600 μL of freshly prepared NALC-NaOH solution (containing NALC 1.45%, NaOH 2%), vortex and mix, then stand at room temperature for 30 min, then centrifuge at 10,000 r / min for 5 min; wash the precipitate once with 0.03M Na2HPO4-0.03M KH2PO4 buffer, repeat 10,000 r / min centrifugation for 5 min, discard the supernatant, and the precipitate is ready for use.Chinese patent application CN201910795789 – An improved method for pretreatment of sputum samples before PCR detection mentions adding 1-2 volumes of liquefying agent to 1 mL of sputum, along with 0.5% N-acetic acid-L-cysteine, 1.45% sodium citrate, and 2% sodium hydroxide. After vortexing and standing for 30 min, the sputum sample is centrifuged at 10000 rpm for 3 min to process the sample. Chinese patent application CN201710154008 – A high-throughput automated kit for extracting pathogen nucleic acid from sputum samples – adds 1M sodium hydroxide to 3 times the volume of sputum digestion solution and stands at room temperature for 30 min for sputum sample pretreatment. Chinese patent application CN202011071499 – A method and kit for rapid extraction of Mycobacterium tuberculosis nucleic acid from sputum – treats sputum in a buffer solution of 4 mol / L potassium chloride, 4 mol / L guanidine hydrochloride, 1% potassium ethyl xanthate, and 0.2 mol / L potassium phosphate.
[0005] While the methods mentioned above can process sputum samples, they all have certain drawbacks. For example, the method mentioned by Zhang Junli, which involves simultaneous processing with Saccomanno solution and DTT solution, although it eliminates the risk of sputum turning into a gel, has an excessively long processing time, making it unsuitable for POC instrument development. Furthermore, DTT is easily oxidized and pH sensitive, making it unsuitable for long-term room temperature storage within POCT cartridges. The NALC-NaOH method mentioned by Zhang Junli and Ndhlovu V also suffers from excessively long processing times, and the high alkaline concentration easily leads to residual alkaline solution in the POC microfluidic channel, ultimately inhibiting the PCR reaction and affecting detection sensitivity. Gomez DI also has excessively long processing times and requires a secondary treatment of sputum with Na2HPO4-0.03M KH2PO4, which is detrimental to the microfluidic channel design and instrument control of POCT cartridges. Although adding guanidine hydrochloride in patent CN202011071499 lowers the pH, guanidine hydrochloride can corrode the reagent sealing film of POCT cartridges, such as the common aluminum film. The aqueous solution of guanidine hydrochloride is acidic, and the hydrogen ions in the solution will react with the film on the aluminum surface to cause oxidation and corrode the aluminum film, resulting in a reduction in the reagent sealing effect and affecting the long-term storage of the reagent. Summary of the Invention
[0006] Based on this, the purpose of this invention is to provide a sputum sample pretreatment solution suitable for POCT cartridges, as well as the lyophilized reagent, its preparation method, and its application.
[0007] In a first aspect, the present invention provides a sputum sample pretreatment solution, which is composed of the following components: 4 mM-6 mM Tris buffer, 6 M-8 M guanidine isothiocyanate, 0.5 M-2 M EDTA, 0.35 M-0.45 M lithium chloride, and 15%-20% polyethylene glycol (PEG).
[0008] In some embodiments, the sputum sample pretreatment solution consists of the following components: 4 mM-6 mM Tris buffer, 8 M guanidine isothiocyanate, 0.5 M-1 M EDTA, 0.35 M-0.45 M lithium chloride, and 15%-20% polyethylene glycol (PEG).
[0009] In some embodiments, the sputum sample pretreatment solution consists of the following components: 6 mM Tris buffer, 8 M guanidine isothiocyanate, 1 M EDTA, 0.4 M lithium chloride, and 20% polyethylene glycol (PEG).
[0010] In some embodiments, the sputum sample pretreatment solution consists of the following components: 4 mM Tris buffer, 8 M guanidine isothiocyanate, 0.5 M EDTA, 0.4 M lithium chloride, and 20% polyethylene glycol (PEG).
[0011] In some embodiments, the sputum sample pretreatment solution consists of the following components: 4 mM Tris buffer, 8 M guanidine isothiocyanate, 0.5 M EDTA, 0.4 M lithium chloride, and 15% polyethylene glycol (PEG).
[0012] In some preferred embodiments, the average molecular weight of the polyethylene glycol is 4,000 to 8,000, more preferably 6,000.
[0013] Secondly, the present invention provides a sputum sample pretreatment reagent, which includes any of the above-mentioned sputum sample pretreatment solutions, and a reagent obtained by freeze-drying the pretreatment reagent after adding 6wt%-8wt% of hydroxypropyl-β-cyclodextrin, 2wt%-3wt% of sorbitol, and 1wt%-2wt% of sucrose to the pretreatment reagent.
[0014] In some embodiments, the pretreatment reagent contains 8 wt% hydroxypropyl-β-cyclodextrin, 3 wt% sorbitol, and 2 wt% sucrose.
[0015] In some embodiments, the pretreatment reagent contains 6 wt% hydroxypropyl-β-cyclodextrin, 2 wt% sorbitol, and 1 wt% sucrose.
[0016] In some embodiments, the pretreatment reagent comprises: a sputum sample pretreatment solution consisting of 6 mM Tris buffer, 8 M guanidine isothiocyanate, 1 M EDTA, 0.4 M lithium chloride, and 20% polyethylene glycol, to which 8 wt% hydroxypropyl-β-cyclodextrin, 3 wt% sorbitol, and 2 wt% sucrose are added, followed by lyophilization. This reagent is not only well-suited for POCT cartridges but also exhibits good stability.
[0017] Thirdly, the present invention provides the application of the above-mentioned sputum sample pretreatment solution in the preparation of respiratory pathogen detection kits.
[0018] Fourthly, the present invention provides the application of the above-mentioned sputum sample pretreatment reagent in the preparation of respiratory pathogen detection kits.
[0019] In some implementations, the respiratory pathogens are respiratory viruses and / or bacteria.
[0020] In some implementations, the respiratory pathogens are influenza virus, respiratory syncytial virus (RSV), adenovirus, Aspergillus, Cryptococcus, Pneumocystis, and Mycobacterium tuberculosis.
[0021] Fifthly, the present invention provides a method for preparing the sputum sample pretreatment reagent, which includes the following steps:
[0022] S1. Add guanidine isothiocyanate, EDTA, PEG6000 and lithium chloride to the Tris buffer solution to the final concentration, vortex mix well to obtain sputum sample processing solution;
[0023] S2. Add hydroxypropyl-β-cyclodextrin, sorbitol, and sucrose to the sputum sample processing solution to the final concentration, and freeze-dry to obtain the sputum sample pretreatment reagent.
[0024] In some embodiments, the freeze-drying includes: pre-freezing at -18°C to -22°C for 1.8-2.2 hours, followed by heating to -38°C to -42°C for 0.9-1.1 hours, primary drying at -28°C to -32°C and 0.133 mbar for 7.5-8.5 hours, and final drying at 23-27°C and 0.133 mbar for 6.5-7.5 hours.
[0025] This invention has the following beneficial effects: it provides a pretreatment reagent with short liquefaction time, low oxidation, few PCR inhibitors, lyophilization capability, strong compatibility with POCT cartridges, high stability, and good liquefaction effect, which solves the problems of long processing time, poor reagent stability, and poor compatibility with POCT cartridges in conventional sputum liquefaction solutions on the market. Attached Figure Description
[0026] The accompanying drawings illustrate specific examples of the technical solutions described in this invention and, together with the detailed embodiments, form part of the specification, serving to explain the technical solutions, principles, and effects of this invention.
[0027] Figures 1 to 6 These are the amplified Ct values of different sputum liquefaction schemes in Example 1 of the present invention.
[0028] Figures 7 to 18This is a schematic diagram of the sputum sample processing solution entering the Mycobacterium tuberculosis complex POCT cartridge in Embodiment 2 of the present invention.
[0029] Figure 19 The lyophilized reagent form is obtained by lyophilizing the sputum sample nucleic acid pretreatment solution according to liquefaction schemes 21, 26, 34, 48, 51, 53, 57 and 60 of Embodiment 3 of the present invention.
[0030] Figures 20 to 28 These are the amplification results of Ct values for liquefaction scheme 60, control group 1, and control group 2 in Example 4 of the present invention. Detailed Implementation
[0031] To facilitate understanding of the present invention, a more complete description will be provided below. The present invention can be implemented in many different forms and is not limited to the embodiments described herein. Rather, these embodiments are provided to provide a thorough and complete understanding of the disclosure of the present invention.
[0032] Unless otherwise specified, experimental methods in the following examples were performed under standard conditions, such as those described in the fourth edition of *Molecular Cloning: A Laboratory Manual*, edited by Green and Sambrook, published in 2013, or according to the manufacturer's recommendations. All commonly used chemical reagents used in the examples are commercially available products.
[0033] Unless otherwise specified, experimental methods in the following examples are generally performed under standard conditions or as recommended by the manufacturer. All commonly used chemical reagents used in the examples are commercially available products.
[0034] Unless otherwise defined, all technical and scientific terms used in this invention have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. The terminology used in this specification is for the purpose of describing particular embodiments only and is not intended to limit the invention. The term "and / or" as used in this invention includes any and all combinations of one or more of the associated listed items.
[0035] This invention addresses the shortcomings of existing technologies, such as long pretreatment time, complex operation, easy oxidation, and the presence of many PCR inhibitors that are difficult to match with POCT cartridges. It develops a pretreatment reagent and method that features short liquefaction time, is not easily oxidized, contains few PCR inhibitors, has strong compatibility with POCT cartridges for freeze-dried components, and exhibits high stability.
[0036] To verify the effectiveness of the present invention, the purity of the purified nucleic acid was tested using an ultraviolet spectrophotometer, and its performance was compared using fluorescent PCR reagents.
[0037] Most molecular POCT cartridges on the market currently use magnetic beads for nucleic acid extraction. The POCT cartridge has a single sample processing chamber for sample lysis, binding, washing and elution. The sample processing chamber is connected to the nucleic acid extraction reagent via a microfluidic channel. The nucleic acid extraction reagent is driven into the sample processing chamber to extract nucleic acid from the sample through a valve or air pump or other means.
[0038] After research, we found that the sputum sample nucleic acid pretreatment solution adapted for use with POCT cartridges needs to meet certain conditions: 1. The sputum pretreatment solution should be mild, as its alkalinity should not be too strong, as this would be detrimental to subsequent pH balancing and nucleic acid washing. 2. The POCT cartridges need to be stored at room temperature. If the sputum sample pretreatment solution contains common sputum reducing agents, such as N-acetyl-L-cysteine or dithiothreitol, it would be detrimental to the long-term preservation of the cartridges. 3. The POCT cartridge sample processing time is relatively short, and the amount of nucleic acid released from the sputum sample is limited, requiring rapid nucleic acid extraction. 4. The liquid nucleic acid extraction reagent for the POCT cartridge is not easy to encapsulate and is easily corroded by the sealing film. 5. Because the POCT cartridge sample processing chamber is shared by one unit, a small amount of sputum sample pretreatment solution will remain during the washing process and eventually enter the PCR chamber. If there are too many PCR inhibitors, such as 4% sodium hydroxide solution, the pH is difficult to neutralize completely in a short time, and the final nucleic acid extraction reagent will be alkaline, affecting the PCR amplification efficiency. Therefore, the components of the sputum sample pretreatment solution should contain as few PCR inhibitors as possible.
[0039] To meet the above requirements for POCT cartridge applications, we have made new configurations and optimizations for the sputum liquefaction solution.
[0040] This invention addresses the shortcomings of existing sputum sample nucleic acid pretreatment methods, such as long processing time, complex operation, easy oxidation, short shelf life, and strong alkalinity making them incompatible with POCT cartridges. It develops a solution with a short liquefaction time (10 minutes), low oxidation resistance, low PCR inhibitor content, and lyophilizable components. This solution is compatible with POCT cartridges for room temperature storage and transportation, and maintains good processing efficacy even when used with different pathogens. Its composition contains few PCR inhibitors, allowing for long-term storage after lyophilization. It solves the problems of difficult encapsulation and easy corrosion of sealing films in POCT cartridge liquid nucleic acid extraction reagents, and offers high nucleic acid extraction yield, suitable for the detection of various pathogens.
[0041] Example 1: Screening of different sputum liquefaction schemes
[0042] To screen for a better sputum liquefaction protocol, nucleic acid extraction was performed on sputum samples after nucleic acid processing. After extraction, nucleic acid purity analysis was conducted. The merits of the sputum liquefaction protocol were then determined by comparing the Ct values of human internal standard and IS6110 target in tuberculosis sputum samples. Human internal standards were selected based on the conserved sequence of the RNaseP internal standard gene. Sequence information: Forward primer sequence: ATGGCGGTGTTTGCAGATTT (SEQ ID NO:1), Reverse primer sequence: GAGCGGCTGTCTCCACAAGT (SEQ ID NO:2), Probe sequence: TTCTGACCTGAAGGCTCTGCGCG (SEQ ID NO:3); IS6110 sequence information: Forward primer sequence: GCAGGGTTCGCCTACGTG (SEQ ID NO:4), Reverse primer sequence: GCCATCGTGGAAGCGAC (SEQ ID NO:5), Probe sequence: TCACCGACGCCTACGCTCGCA (SEQ ID NO:6). Primers and probes were purchased from Sangon Biotech. An ABI QuantStudio Q5 real-time PCR instrument was used. PCR reaction buffer was purchased from Zhuhai Baorui Biotechnology. Experimental results were determined by amplification curves or CT values.
[0043] After initial screening (for example, it was found that 10M guanidine isothiocyanate is complicated to prepare, prone to crystal precipitation, and difficult to preserve due to its solubility), the sputum sample pretreatment solution formulas in Table 1 were obtained.
[0044] Thirty-six positive sputum samples from tuberculosis were mixed evenly and then divided into 36 equal portions, each containing 2-4 mL. The corresponding substances were added to the Tris buffer solution to the final concentration according to the sputum sample pretreatment solution formula in Table 1. The mixture was vortexed and allowed to stand (liquefy) at room temperature for 10 min. Nucleic acid was then extracted using conventional nucleic acid extraction reagents, and nucleic acid purity and qPCR analysis were performed (see Tables 2 and 3). The results are shown in Table 4.
[0045] Table 1 shows the different liquefaction schemes:
[0046]
[0047]
[0048]
[0049]
[0050]
[0051] Table 2 shows the preparation parameters for the PCR amplification system:
[0052] Table 2 Preparation of PCR amplification system
[0053]
[0054] Table 3 shows the PCR amplification procedure:
[0055]
[0056] The purity of nucleic acids after sputum liquefaction was compared between different groups of sputum sample pretreatment solutions (i.e., liquefaction protocols). The results are shown in Table 4 below:
[0057] Table 4 Comparison of nucleic acid purity after liquefaction of different sputum samples.
[0058]
[0059]
[0060]
[0061]
[0062] Comparison of Ct values for different sputum liquefaction protocols in corresponding groups; amplification results are shown in [link to data]. Figures 1 to 6 The results are shown in Table 5 below:
[0063] Table 5 Comparison of Ct values for different sputum liquefaction protocols
[0064]
[0065]
[0066]
[0067]
[0068] Based on the results in Table 4 above, and referring to the "General Rules for Evaluation of Nucleic Acid Extraction and Purification Methods" (GB / T 37874-2019), the A260 / A280 ratio is between 1.7 and 1.9, and the A260 / A230 ratio is greater than 2, indicating that the nucleic acid DNA meets the requirements of general molecular biology experiments. Among these, liquefaction schemes 3, 15, 21, 29, 39, 44, 48, 51, 53, 57, and 60 showed very high nucleic acid purity, while the purity of other liquefaction schemes was relatively poor.
[0069] The results in Table 5 show that liquefaction schemes 3, 15, 21, 29, 39, 44, 48, 51, 53, 57, and 60 all showed detectable results for both the liquefaction scheme and the internal standard, with IS6100 target Ct values less than 32 and internal standard Ct values less than 30. Liquefaction schemes 1, 5, 9, 14, 23, 27, 31, and 35 all showed missed detections in IS6110. Other schemes showed higher IS6110 target and internal standard Ct values, which warrants further analysis of nucleic acid purity and Ct values.
[0070] Liquefaction schemes 3, 15, 21, 29, 39, 44, 48, 51, 53, 57, and 60 are all relatively good.
[0071] Example 2: Compatibility Verification of Liquefaction Scheme and POCT Cartridge
[0072] To test the effectiveness of the sputum sample nucleic acid pretreatment of the present invention, liquefaction schemes 3, 15, 21, 29, 39, 44, 48, 51, 53, 57, and 60, which were verified as effective in Example 1, were selected. Sputum samples were selected that were positive for Mycobacterium tuberculosis complex. The sputum samples and the sputum sample pretreatment solution were mixed separately at a 1:2 ratio and liquefied for 10 minutes. Then, 300 μL of the sputum sample treatment solution was added to the Mycobacterium tuberculosis complex POCT cartridge (see image of POCT cartridge). Figure 7 The amplification effect was tested using a fully automated nucleic acid detection and analysis instrument from Wondfo Biotech. Amplification results are shown below. Figures 8 to 18 The results are summarized in Table 6 below:
[0073] Table 6. Effects of nucleic acid pretreatment on sputum samples
[0074]
[0075] According to the data statistics in Table 6 above, although the internal standard RnaseP gene was detected in liquefaction schemes 3, 11, and 16, IS6110 was missed. It is speculated that this was due to sodium hydroxide residue in the sample processing chamber and microchannel of the POCT cartridge, as well as the mixing effect, indicating that the sputum sample processing formula is not suitable for use in POCT cartridges. In contrast, the internal standard RnaseP gene and the target IS6110 were detected normally in liquefaction schemes 21, 26, 34, 48, 51, 53, 57, and 60, making them suitable for use in POCT cartridges.
[0076] Example 3: Lyophilization Test of Sputum Sample Nucleic Acid Pretreatment Solution
[0077] To adapt to the characteristics of the POCT cartridge, the liquefaction schemes 21, 26, 34, 48, 51, 53, 57, and 60, which showed good results in Example 2, were selected. During reagent preparation, the lyophilized formulations listed in the table below were added to achieve a final volume of 4 mL. Formulas 1-3 were used to achieve a final sucrose concentration of 6wt%-10wt%, mannitol concentration of 2wt%-4wt%, and PEG8000 concentration of 1wt%-3wt% in the sputum sample processing solution. Formulas 4-6 were used to achieve a final hydroxypropyl-β-cyclodextrin concentration of 6wt%-8wt%, sorbitol concentration of 2wt%-4wt%, and sucrose concentration of 1wt%-3wt% in the sputum sample processing solution. These were then dispensed into the pre-filled nucleic acid extraction reagent compartment of the POCT cartridge. The lyophilized formulations are shown in Table 7 below.
[0078] Table 7. Lyophilization Test of Nucleic Acid Pretreatment Reagents for Sputum Samples
[0079]
[0080] Pre-freeze at -20°C for 2 hours, then raise the temperature to -40°C and hold for 1 hour. Main dry at -30°C and 0.133 mbar for 8 hours. Final dry at 25°C and 0.133 mbar for 7 hours. After freeze-drying, tighten the glass bottle cap with a rubber stopper, seal, and store at room temperature.
[0081] Table 8 Freeze-drying process
[0082]
[0083] After lyophilizing the nucleic acid pretreatment reagent for sputum samples, observe the morphology of the liquefied reagent (see...). Figure 19 The lyophilized forms of liquefaction schemes 21, 26, 34, 51, and 53 were poor, indicating that the lyophilization of these sputum nucleic acid sample processing formulas failed and was not suitable for lyophilization. Liquefaction schemes 48, 57, and 60 showed normal morphology. Liquefaction schemes 48, 57, and 60 were reconstituted with 4 mL of water. After mixing the nine positive tuberculosis sputum samples, they were evenly divided into nine aliquots. The sputum samples were then mixed with the lyophilized and reconstituted sputum sample pretreatment reagent at a ratio of 1:2, vortexed, and allowed to stand at room temperature for 10 minutes. Nucleic acid extraction was then performed using conventional nucleic acid extraction reagents, and the nucleic acid purity was tested according to the method described in Example 1. The results are shown in Table 9 below.
[0084] Table 9 Liquefaction Scheme
[0085]
[0086] According to the results in Table 9 above, the nucleic acid purity was evaluated in accordance with the "GB / T 37874-2019 General Rules for Evaluation of Nucleic Acid Extraction and Purification Methods". The liquefaction scheme 60 combined with the freeze-drying formula 5 had the highest nucleic acid purity, followed by the liquefaction scheme 57.
[0087] The optimal nucleic acid purity scheme (liquefaction scheme 60 + lyophilization formula 5) was used, and the sample was reconstituted with 4 mL of water. A positive tuberculosis sputum sample (different from the above positive samples) was mixed thoroughly. The sputum was then mixed with the sputum sample pretreatment solution at a 1:2 ratio, vortexed, and allowed to stand at room temperature for 10 minutes. The sputum liquefaction effect was then tested using a fully automated nucleic acid detection and analysis instrument from Wondfo Biotech. Amplification results are shown below. Figure 20 The results are summarized in Table 10 below:
[0088] Table 10. Effects of nucleic acid pretreatment on sputum samples
[0089]
[0090] The internal standard RnaseP gene and target IS6110 of the liquefaction regimen 60 + lyophilized formulation 5 (hereinafter referred to as reagent 60) can be detected normally, making it suitable for use in POCT cartridges.
[0091] Example 4: Performance Verification of Nucleic Acid Pretreatment Solution for Lyophilized Sputum Samples
[0092] To test the performance of the POCT cartridge adapted to this invention, Reagent 60 was used as the experimental group, 4% sodium hydroxide solution as control group 1, and 2% sodium hydroxide + 0.5% N-acetyl-L-cysteine solution as control group 2. The lyophilized formulation 5 and its liquefaction scheme 60 were reconstituted with 4 mL of water. Lower respiratory tract pathogens related to sputum samples were selected as performance test samples. 6 mL of lower respiratory tract pathogen sputum sample was divided into three equal parts, and 4 mL of Reagent 60, 4% sodium hydroxide solution, and 2% sodium hydroxide + 0.5% N-acetyl-L-cysteine solution were added to each part, respectively. Control groups 1 and 2 were treated at room temperature for 20 min, and the experimental group was treated at room temperature for 10 min. Then, 500 µL of sample processing solution was added to each part of the lower respiratory tract seven-pathogen nucleic acid detection reagent card (POCT cartridge structure see [link]). Figure 7 In this study, the test results of sputum samples were verified using a fully automated nucleic acid amplification analyzer, and the test results were judged by amplification curves or CT values.
[0093] 1. Sample DNA processing
[0094] The sample information is shown in Table 11 below.
[0095]
[0096] 2. Results Analysis
[0097] The test results are shown in Table 12 below. The PCR amplification results of the experimental group are shown in Table 12 below. Figures 21 to 28 .
[0098]
[0099] The liquefaction protocols of control group 1 (4% sodium hydroxide solution) and control group 2 (2% sodium hydroxide + 0.5% N-acetyl-L-cysteine solution) are the most commonly used liquefaction protocols by various manufacturers on the market. The liquefaction time of control group 1 and control group 2 is longer than that of the experimental group. However, according to the results in the table above, the liquefied samples of control group 1 (4% sodium hydroxide solution) and control group 2 (2% sodium hydroxide + 0.5% N-acetyl-L-cysteine solution) are not compatible with the POCT cartridge. The analysis shows that the liquefied samples of control group 1 (4% sodium hydroxide solution) and control group 2 (2% sodium hydroxide + 0.5% N-acetyl-L-cysteine solution) are not compatible with the POCT cartridge. The reason is that there is sodium hydroxide residue in the sample processing chamber and microchannel of the POCT cartridge, and the mixing effect is not good. This indicates that the sputum sample processing formula is not suitable for use in the POCT cartridge. The liquefied samples of the experimental group (reagent 60) can be detected normally by the POCT cartridge, indicating that the sputum samples processed by this method have good compatibility with the POCT cartridge.
[0100] Example 5: Stability Verification of Sputum Sample Nucleic Acid Pretreatment Solution
[0101] To test the stability of the sputum sample nucleic acid pretreatment solution, liquefaction scheme 60 was used as the experimental group, 4% sodium hydroxide solution was used as control group 1, and 2% sodium hydroxide + 0.5% N-acetyl-L-cysteine solution was used as control group 2. The sputum sample treatment solution was stored at 50℃ and performance tests were conducted at 1 month, 3 months, 6 months, and 12 months. Liquefaction scheme 60 was reconstituted with 4 mL of water. One tuberculosis sputum positive sample was divided into 3 equal parts, and the sputum was mixed with the sputum sample pretreatment solution at a ratio of 1:2. The mixture was vortexed and allowed to stand at room temperature for 10 min. The sputum liquefaction effect was then tested using a fully automated nucleic acid detection and analysis instrument from Wondfo Biotech. The test results are shown in Table 13 below.
[0102]
[0103] In control group 1 (4% sodium hydroxide solution), the performance of all solutions decreased under accelerated liquefaction at 50℃. After 6 months of accelerated liquefaction at 50℃, the test failed. The reason was that the liquid reagents evaporated in the high-temperature environment, causing a change in their concentration. In control group 2 (2% sodium hydroxide + 0.5% N-acetyl-L-cysteine solution), the test failed after 1 month of accelerated liquefaction at 50℃. The reason was that N-acetyl-L-cysteine was oxidized and degraded in the high-temperature environment, causing a decrease in performance. The experimental group (liquefaction scheme 60) showed normal test results after 12 months of accelerated liquefaction at 50℃, indicating that liquefaction scheme 60 has good stability.
[0104] The above description is merely a preferred example of a freeze-driable sputum sample pretreatment solution and method adapted to POCT cartridges, and is not intended to limit the present invention. Any modifications, equivalent modifications, and improvements made within the spirit and principles of the present invention should be included within the scope of protection of the present invention.
[0105] Currently available sputum sample pretreatment methods suffer from drawbacks such as long processing time, complex operation, easy oxidation, short storage time, and strong alkalinity, making them difficult to match with POCT cartridges. Although conventional nucleic acid extractors can extract nucleic acids, they are not compatible with POCT cartridges, or the sensitivity of the kit decreases after compatibility. This patent addresses the difficulties of room temperature storage of POCT cartridges and the challenges of cleaning shared sample processing chambers by developing a pretreatment method with short liquefaction time, low oxidation, freeze-drying capability, strong compatibility with POCT cartridges, and high stability.
[0106] The embodiments described above are merely illustrative of several implementations of the present invention, and while the descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the invention patent. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of the present invention, and these all fall within the protection scope of the present invention. Therefore, the protection scope of this invention patent should be determined by the appended claims.
Claims
1. A sputum sample pretreatment solution, characterized by, The sputum sample pretreatment solution is composed of 4mM-6mM Tris buffer, 6M-8M guanidine isothiocyanate, 0.5M-2M EDTA, 0.35M-0.45M lithium chloride, 15%-20% polyethylene glycol (PEG).
2. The sputum sample pretreatment solution according to claim 1, characterized in that, The sputum sample pretreatment solution is composed of 4mM-6mM Tris buffer, 8M guanidine isothiocyanate, 0.5M-1M EDTA, 0.35M-0.45M lithium chloride, 15%-20% polyethylene glycol (PEG).
3. The sputum sample pretreatment fluid of claim 2, wherein, The sputum sample pretreatment solution is composed of 6mM Tris buffer, 8M guanidine isothiocyanate, 1M EDTA, 0.4M lithium chloride, 20% polyethylene glycol (PEG); or The sputum sample pretreatment solution is composed of 4mM Tris buffer, 8M guanidine isothiocyanate, 0.5M EDTA, 0.4M lithium chloride, 15% polyethylene glycol (PEG); or The sputum sample pretreatment solution is composed of 4mM Tris buffer, 8M guanidine isothiocyanate, 0.5M EDTA, 0.4M lithium chloride, 20% polyethylene glycol (PEG).
4. The sputum sample pretreatment fluid according to any one of claims 1 to 3, characterized in that, The average molecular weight of the polyethylene glycol is 4000 to 8000, preferably 6000.
5. A sputum sample pretreatment reagent, characterized by, The pretreatment reagent comprises: 6wt%-8wt% hydroxypropyl-β-cyclodextrin, 2wt%-3wt% sorbitol, 1wt%-2wt% sucrose are added in the sputum sample pretreatment solution of any one of claims 1-4 to obtain the reagent after lyophilization.
6. The sputum sample pretreatment reagent according to claim 5, characterized by, 8wt% hydroxypropyl-β-cyclodextrin, 3wt% sorbitol, 2wt% sucrose are added in the sputum sample pretreatment solution.
7. The sputum sample pretreatment reagent according to claim 5, characterized by, 6wt% hydroxypropyl-β-cyclodextrin, 2wt% sorbitol, 1wt% sucrose are added in the sputum sample pretreatment solution.
8. The sputum sample pretreatment reagent according to claim 5, characterized by, The pretreatment reagent comprises: 8wt% hydroxypropyl-β-cyclodextrin, 3wt% sorbitol, 2wt% sucrose are added in the sputum sample pretreatment solution composed of 6mM Tris buffer, 8M guanidine isothiocyanate, 1M EDTA, 0.4M lithium chloride, 20% polyethylene glycol to obtain the reagent after lyophilization.
9. The sputum sample pretreatment solution of any one of claims 1-4 or the pretreatment reagent of any one of claims 7-8 is used in the preparation of a respiratory pathogen detection kit; preferably the respiratory pathogen is influenza virus, respiratory syncytial virus (RSV), adenovirus, Aspergillus, Cryptococcus, Pneumocystis, Mycobacterium tuberculosis.
10. A method for the preparation of a sputum sample pre-treatment reagent according to any one of claims 5 to 8, characterised in that, The method comprises the following steps: S1. Guanidine isothiocyanate, EDTA, PEG6000, lithium chloride are added in Tris buffer to obtain the sputum sample pretreatment solution; S2. Hydroxypropyl-β-cyclodextrin, sorbitol, and sucrose are added in the sputum sample pretreatment solution to obtain the sputum sample pretreatment reagent after lyophilization. Preferably the lyophilisation comprises: pre-freeze at -18°C to -22°C for 1.8-2.2 hours, then warm to -38°C to -42°C for 0.9-1.1 hours, main drying at -28°C to -32°C, 0.133 mbar for 7.5-8.5 hours; final drying at 23-27°C, 0.133 mbar for 6.5-7.5 hours.
Citation Information
Patent Citations
A kit for extracting pathogen nucleic acids from a phlegm sample in a high-flux and automatic manner
CN106867998A
Improved treatment method of sputum specimen before PCR detection
CN110499355A
De-host extraction kit for phlegm macrogenome
CN111621496A
Method and kit for rapidly extracting mycobacterium tuberculosis nucleic acid in sputum
CN112063617A