Nucleic acid aptamer modified nerve extracellular vesicle and antagonism of nucleic acid aptamer modified nerve extracellular vesicle on marine guanamine neurotoxin
By modifying the nucleic acid aptamer TV46 onto extracellular vesicles of nerve cells to construct Apt-nEVs, the problems of insufficient stability and affinity of nucleic acid aptamers in vivo were solved, achieving efficient antagonism of TTX and protection of nerve cells.
Patent Information
- Application Number
- CN202511632254.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-11-10
- Publication Date
- 2026-04-03
AI Technical Summary
Current technologies lack effective antibody drugs to prevent marine guanidine neurotoxin poisoning, especially tetrodotoxin (TTX). Furthermore, the use of nucleic acid aptamers in vivo is limited, as they are easily degraded by nucleases, have short half-lives, and cannot guarantee affinity for target molecules.
Nucleic acid aptamer TV46 was modified onto neural extracellular vesicles (nEVs) and coupled through the hydrophobic interaction of cholesterol modification to construct nucleic acid aptamer-modified neural extracellular vesicles (Apt-nEVs), which enhanced their stability in vivo and synergistically exerted the function of natural Na+ channels to recognize and trap toxins.
It prolongs the plasma half-life of nucleic acid aptamers, significantly enhances the antagonistic efficacy against TTX, protects nerve cells from oxidative stress damage, and provides a new strategy for the prevention and treatment of marine guanidine neurotoxin poisoning.
Smart Images

Figure CN121780436A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of marine biotechnology, specifically to a nucleic acid aptamer-modified extracellular vesicle of a nerve cell and its application in the prevention and treatment of marine guanidine neurotoxin poisoning. Background Technology
[0002] Toxins produced by marine algae and microorganisms can accumulate in marine shellfish, fish, and other organisms, and are transmitted through the food chain, posing a threat to human health and causing significant negative impacts on aquaculture and other industries. Guanidine neurotoxins, represented by tetrodotoxin (TTX), are widely distributed and are representative marine biotoxins that were discovered and isolated relatively early. TTX is a potent non-protein small molecule neurotoxin with good thermal stability, acting selectively on voltage-gated Na+ ions in excitable cell membranes. + Channel, by blocking Na + Influence interferes with and inhibits the action potential of neuromuscular cells, causing a series of neuromuscular paralysis symptoms. Severe poisoning can lead to coma and respiratory and circulatory failure, resulting in death.
[0003] Seafood contaminated with toxins is a major cause of food poisoning. In recent years, influenced by factors such as the greenhouse effect and environmental pollution, harmful algal blooms in nearshore waters have become more frequent. Increased global trade has further expanded the distribution range of marine organisms and the consumer base for seafood, thereby exacerbating the spread and transmission of marine biotoxins. The threat of marine biotoxins to the safety of global marine products is gradually expanding. However, to date, there is still a lack of effective antitoxin drugs to prevent and treat TTX poisoning. Clinical interventions for TTX poisoning patients mainly focus on promoting toxin metabolism and excretion, as well as symptomatic and supportive treatment. Therefore, the development of highly effective antitoxin agents has become an urgent need for the treatment of TTX poisoning. Although antibody neutralization has been a focus of research on drugs for the treatment of TTX poisoning, TTX has a relatively small molecular weight (approximately 319), requiring binding to carrier proteins to acquire immunogenicity. Obtaining antibodies from TTX is costly and time-consuming, and the binding of carrier proteins may affect the functional groups of TTX, making it difficult to guarantee the affinity of the obtained antibodies. Consequently, the detoxification effect in animals is uncertain, necessitating the development of new alternative toxin neutralization strategies.
[0004] In recent years, nucleic acid aptamers (Apt), often referred to as "chemical antibodies," have garnered significant attention in both basic and applied research. Compared to antibodies, nucleic acid aptamers offer advantages such as simple synthesis, convenient modification, small size, low immunogenicity, and minimal batch-to-batch variability. More importantly, they can specifically recognize a variety of targets, including metal ions, toxins, proteins, cells and extracellular vesicles, and microorganisms. However, the inherent physicochemical properties of nucleic acid aptamers, such as their susceptibility to nuclease degradation and rapid renal filtration, result in short plasma half-lives, thus limiting their in vivo applications. Conjugating nucleic acid aptamers to biomolecules or nanocarriers (such as liposomes, extracellular vesicles, or inorganic nanomaterials) can not only allow them to effectively evade nuclease degradation and significantly prolong their circulation time, but also maintain their affinity for target molecules, thereby enhancing their therapeutic efficacy. However, no reports have yet documented the use of a nucleic acid aptamer-modified extracellular vesicle in nerve cells and its antagonistic effect against marine guanidine neurotoxins. Summary of the Invention
[0005] The purpose of this invention is to construct a novel marine guanidine neurotoxin antagonistic system, Apt-nEVs, which involves coupling the TTX nucleic acid aptamer to extracellular vesicles of nerve cells. This not only prolongs the plasma half-life of the aptamer but also allows the natural Na+ on the nerve cell membrane to be utilized. + The dual-modal detoxification mechanism, which involves the channel and TTX aptamer jointly recognizing and trapping the toxin, provides a new approach for the effective prevention and treatment of poisoning by marine guanidine toxins such as TTX.
[0006] To achieve the above objectives, the present invention employs the following... Figure 1 Technical solution shown:
[0007] 1. Preparation of extracellular vesicles (nEVs): Extracellular vesicles (nEVs) were obtained by gradient mechanical extrusion and ultra-high-speed centrifugation using polycarbonate membranes.
[0008] 2. Coupling of nucleic acid aptamers to nEVs: First, a selected TTX nucleic acid aptamer sequence (Apt) was synthesized, with cholesterol attached to its 3′ end and a labeling group added to its 5′ end. Then, the 3′ end of the nucleic acid aptamer was directly inserted into the surface of nEVs through hydrophobic interactions to construct nucleic acid aptamer-modified extracellular vesicles derived from nerve cells (Apt-nEVs). The coupling efficiency of the nucleic acid aptamer was detected by gel electrophoresis mobility shift assay (EMSA).
[0009] 3. Stability and safety testing of Apt-nEVs: Apt-nEVs were incubated in a solution containing 10% FBS to simulate the in vivo environment. The fluorescent groups in the ultrafiltration filtrate were then detected and EMSA electrophoresis was performed to determine whether the coupling of the nucleic acid aptamer (TV46) on Apt-nEVs was stable. The safety of Apt-nEVs was tested by cytotoxicity assay.
[0010] 4. Determination of the toxin neutralization efficacy of Apt-nEVs: Apt-nEVs were incubated with TTX solution, and after ultrafiltration and centrifugation, the residual toxin content in the solution was quantitatively determined by ultra-high performance liquid chromatography-tandem mass spectrometry (UPLC-M / MS).
[0011] 5. Neuroprotective effect of Apt-nEVs: The antagonistic efficiency of Apt-nEVs against TTX was detected by CCK8 cytotoxicity assay (based on sodium ion channel-mediated cell swelling model).
[0012] 6. Mechanism of action of Apt-nEVs in protecting nerve cells: The protective effect of Apt-nEVs against TTX-induced oxidative stress damage in a sodium ion channel-mediated cell swelling model was clarified by ROS assay.
[0013] Based on the above technical solution, in a first aspect, the present invention provides a neural extracellular vesicle modified with a nucleic acid aptamer, which is to couple a doubly-terminated tetrodotoxin (TTX) nucleic acid aptamer (TV46) to extracellular vesicles (nEVs) derived from neural cells (C17.2), wherein the nucleotide sequence of the nucleic acid aptamer is shown in SEQ ID NO.1.
[0014] Furthermore, the 3′ end of the TTX nucleic acid aptamer is modified with cholesterol, and the 5′ end is connected with an AMAC fluorescent group. The 3′ end of the nucleic acid aptamer is coupled to the surface of nEVs through hydrophobic interaction to construct nucleic acid aptamer-modified neural cell-derived extracellular vesicles (Apt-nEVs).
[0015] A second aspect of the present invention provides a method for preparing extracellular vesicles modified with nucleic acid aptamers as described above, comprising the following steps:
[0016] (A) Preparation of extracellular vesicles (nEVs): extracellular vesicles (nEVs) were obtained by gradient mechanical extrusion and ultra-high-speed centrifugation of neural stem cells (C17.2) through polycarbonate membrane.
[0017] (B) Coupling of nucleic acid aptamers with nEVs: First, a TTX nucleic acid aptamer sequence (Apt) is synthesized, with cholesterol attached to its 3′ end and a labeling group added to its 5′ end; then, the 3′ end of the nucleic acid aptamer is directly inserted into the surface of nEVs through hydrophobic interactions to construct nucleic acid aptamer-modified extracellular vesicles derived from nerve cells (Apt-nEVs).
[0018] Further, the nEVs mentioned in step (A) are 30 mL (1×10⁻⁶) of mouse neural stem cell (C17.2) suspension. 7 Extracellular vesicles with a particle size of 150-200 nm were prepared by sequentially passing cells ( / mL) through 10 μm, 5 μm, 0.8 μm and 0.4 μm polycarbonate membranes for gradient mechanical extrusion and ultracentrifugation at 120,000 × g for 105 min.
[0019] Further, step (B) involves adjusting the nEVs concentration to 2.5 mg / mL, then mixing it with 10 μM of TTX nucleic acid aptamer and incubating it at 37 °C for 24 h.
[0020] A third aspect of the present invention provides the application of the nucleic acid aptamer-modified extracellular vesicles of nerve cells as described above in the preparation of drugs for the prevention and treatment of marine guanidine neurotoxin poisoning.
[0021] Furthermore, the marine guanidine neurotoxin is tetrodotoxin (TTX).
[0022] In a fourth aspect, the present invention provides the application of the nucleic acid aptamer-modified extracellular vesicles as described above in the preparation of marine guanidine neurotoxin recognition, trapping, adsorption, and detoxification products.
[0023] In a fifth aspect, the present invention provides the use of the nucleic acid aptamer-modified extracellular vesicles as described above in the preparation of a protective medicament against neuronal death induced by marine guanidine neurotoxins.
[0024] In a sixth aspect, the present invention provides the use of the nucleic acid aptamer-modified extracellular vesicles of the present invention as described above in the preparation of a protective drug against oxidative stress damage to nerve cells induced by marine guanidine neurotoxins.
[0025] The advantages of this invention are:
[0026] 1. This invention provides a TTX high-affinity nucleic acid aptamer-modified extracellular vesicle (Apt-nEVs). By coupling the nucleic acid aptamer to the extracellular vesicles, Apt-nEVs retain the natural Na+ on the nerve cell membrane. + Channels can synergistically enhance the interaction between the coupling aptamer and natural Na+. +Apt-nEVs possess a dual detoxification function by channel recognition and trapping TTX. It can achieve efficient detoxification of TTX in both non-cellular systems and cellular levels, and has a significant protective effect against TTX-induced cellular oxidative stress damage.
[0027] 2. On the one hand, it increases the stability of nucleic acid aptamers by coupling with extracellular vesicles; on the other hand, it can synergistically exert the natural Na+ on extracellular vesicles of nerve cells. + The recognition and trapping effects of channels and TTX aptamers on toxins are expected to significantly enhance detoxification efficacy.
[0028] 3. The aptamer-coupled extracellular vesicles (Apt-nEVs) obtained in this invention can also provide insights for constructing a broader-spectrum marine biotoxin antagonistic system. Attached Figure Description
[0029] Figure 1 A schematic diagram of constructing nano-antagonistic Apt-nEVs by coupling nucleic acid aptamers to extracellular vesicles of nerve cells;
[0030] Figure 2 Characterization and detection of neural extracellular vesicles (nEVs): (A) Analysis of nEV particle size distribution and concentration using nano-particle tracking analysis (NTA); (B) Detection of the potential magnitude of nEVs using NTA; (C) Observation of the morphological characteristics of neural extracellular vesicles (nEVs) using transmission electron microscopy (TEM); (D) Protein map of nEVs; (E) Na+ of nEVs. + Channel protein detection, (F) represents the relative quantitative analysis of protein detection;
[0031] Figure 3 To detect the coupling between nucleic acid aptamers and nEVs during the construction of the nano-antagonistic system (Apt-nEVs) of this invention, (A) is the mass spectrum of the TTX aptamer TV46; (B) is the mass spectrum of the aptamer TV46 after double-end modification; (C) is the gel electrophoresis image of nEVs coupled with TV46, where the lanes from left to right are: TV46 after double-end modification, and Apt-nEVs; (D) is the particle size and zeta potential of Apt-nEVs; (E) is a laser confocal micrograph of Apt-nEVs.
[0032] Figure 4To test the stability and safety of the nano-antagonistic system Apt-nEV of the present invention, (A) shows the degradation rate of Apt-nEVs of the present invention in 10% FBS solution at different times; (B) shows the gel electrophoresis images of Apt-nEVs of the present invention in 10% FBS solution at different times, where the lanes from left to right are: TV46 with paired ends modified, ultrafiltered filtrate of Apt-nEVs after incubation in 10% FBS for 8 h, ultrafiltered filtrate of Apt-nEVs after incubation in 10% FBS for 12 h, ultrafiltered filtrate of Apt-nEVs after incubation in 10% FBS for 24 h, and ultrafiltered filtrate of Apt-nEVs after incubation in 10% FBS for 48 h; (C) shows the toxicity assay of Apt-nEVs of the present invention on L929 cells. After 24 h of treatment with both nEVs and Apt-nEVs, the cell viability of L929 cells was higher than 100%.
[0033] Figure 5 To detect the toxin neutralizing efficacy of the nano-antagonistic system Apt-nEV of the present invention, (A) is a multiple reaction monitoring chromatogram of the UPLC-M / MS quantitative detection solution; (B) peak area analysis of the characteristic fragment peak m / z 302 generated by secondary mass spectrometry analysis;
[0034] Figure 6 To demonstrate the neuroprotective effect of the nano-antagonistic system Apt-nEV of this invention, (A) the cell viability of Neuro-2a cells after incubation with a mixture of veratrine (VTD) and ouabain (O), with a molar ratio of VTD to O of 1:20; (B) the cell viability of Neuro-2a cells after incubation with a mixture of TTX, VTD, and O, with molar concentrations of VTD and O of 100 μM and 2 mM, respectively; (C) after incubation of Apt-nEVs with TTX, centrifugation was performed to collect the supernatant, which was then added to Neuro-2a cells along with a mixture of VTD and O for incubation, and the cell viability was then measured, with molar concentrations of VTD and O of 100 μM and 2 mM, respectively, and the initial concentration of TTX of 100 nM.
[0035] Figure 7 This invention demonstrates the inhibitory effect of the nano-antagonistic system Apt-nEVs on intracellular ROS levels in a sodium ion channel-mediated cell swelling model. Detailed Implementation
[0036] The specific implementation methods provided by the present invention will be described in detail below with reference to the embodiments.
[0037] Example 1: Preparation and Characterization of Extracellular Vesicles (nEVs)
[0038] As shown in Figure 1, 30 mL of mouse neural stem cell (C17.2) suspension (1×10⁻⁶) was used.7 Cells / mL were sequentially passed through 10 μm, 5 μm, 0.8 μm and 0.4 μm polycarbonate membranes for gradient mechanical extrusion, then centrifuged at 120,000×g for 105 min to obtain nEVs and resuspend for later use.
[0039] The particle size and zeta potential of nEVs were detected by NTA, as shown in Figures 2A and 2B. The diameter of the nEVs was approximately 152.9 nm, and the zeta potential was −39.22 mV, indicating that the extrusion process yielded appropriately sized vesicles with negatively charged surfaces, consistent with cell membrane surface characteristics. The morphology and structure of the nEVs were observed using TEM, as shown in Figure 2C. It is evident that the mechanically extruded vesicles possess a bilayer membrane structure (as indicated by the red arrow). As shown in Figure 2D, SDS-PAGE gel staining revealed that the nEVs' protein profile overlapped with that of the cell membrane, indicating that the mechanical gradient extrusion process did not significantly damage the membrane structure. Meanwhile... Figure 2 E showed that Western blotting indicated that vesicles retained voltage-gated Na+ on the nerve cell membrane. + Channel (NA) V 1.7) Protein.
[0040] Example 2: Preparation, Characterization, and Detection of Apt-nEVs
[0041] First, a TTX aptamer (TV46) with high affinity reported in the literature was selected and chemically synthesized by Sangon Biotech Co., Ltd. Cholesterol was added to the 3′ end of the nucleic acid aptamer, and an AMAC fluorescent group was attached to the 5′ end. Specifically:
[0042] TV46: 5′-CGCGGCCGATGGCGAAGCCTCAACGTTGGAGGCCGCGCGCGAAGCG-3′ (SEQ IDNO.1)
[0043] Modified: 5′-AMCA-
[0044] CGCGGCCGATGGCGAAGCCTCAACGTTGGAGGCCGCGCGCGAAGCG
[0045] -Cholesterol-3′.
[0046] The correctness of the synthesized nucleic acid aptamer was verified by mass spectrometry. The molar mass of TV46 was 14253.2 μg / μmol, and the molar mass of its modified (5′-AMAC, 3′-cholesterol) aptamers was 14386.7 μg / μmol. (Figure 3A and...) Figure 3As shown in B, no multiplets appeared on the mass spectrum, indicating that the sequence does not contain degenerate bases; and the molecular weight error is ≤0.05%, indicating that the aptamer sequence is correct.
[0047] The TTX nucleic acid aptamer TV46 was mixed with 100 μL of nEVs obtained in the previous step and incubated at 37 °C for 24 h. The successful conjugation of the aptamer was characterized by EMSA electrophoresis. As shown in Figure 3C, lane 1 is the band with TV46 modified at both ends, and lane 2 is the band of Apt-nEVs. It is clearly visible that the Apt-nEVs band lags significantly behind the TV46 band, indicating that the molecular weight of the band in lane 2 is larger than that in lane 1. The conjugation of TV46 to nEVs results in a larger molecular weight, causing it to lag behind the free TV46 band. Simultaneously, nEVs were labeled with DiL fluorescent dye, and fluorescence co-localization and binding were observed under a laser confocal microscope. The particle size and zeta potential of Apt-nEVs were detected by DLS, as shown in Figure 3D. The diameter of Apt-nEVs is approximately 178.0 nm, slightly larger than that of nEVs (approximately 155.1 nm), and its surface zeta potential is approximately −43.33 mV. Figure 3E shows that the fluorescence of the two components is highly fused under laser confocal microscopy, indicating that the nucleic acid aptamer TV46 was successfully coupled to the surface of nEVs.
[0048] Example 3: Stability and safety testing of Apt-nEVs
[0049] 10% FBS was added to Apt-nEVs (8 h, 12 h, 24 h, 48 h). The mixture was centrifuged at 10,000 g for 10 min using a 30 kDa ultrafiltration tube. AMAC fluorescent groups (Ex / Em = 350 / 450 nm) were detected in a portion of the filtrate, as shown in Figure 4A. The AMAC group ratio detected in the filtrate within 48 h was less than 5% (i.e., the uncoupling rate between the TV46 aptamer and nEVs was less than 5%). In addition, a portion of the filtrate was detected by EMSA electrophoresis, as shown in Figure 4B. No TV46 aptamer or its degradation bands were found in the filtrate within 48 h. The two experimental results reveal the stability of the TV46 aptamer coupled to nEVs via cholesterol in a simulated in vivo environment.
[0050] L929 cells were incubated with different concentrations of Apt-nEVs (0 mg / mL, 0.2 mg / mL, 0.4 mg / mL, 0.8 mg / mL, 1.6 mg / mL) for 24 h. Cell viability was assessed according to the instructions of the CCK-8 cytotoxicity assay kit. Figure 4As shown in Figure C, the 24-hour survival rate of L929 cells was higher than 100% for nEVs / Apt-nEVs within the concentration range of 0–1.6 mg / mL, indicating that nEVs / Apt-nEVs had no significant toxic effect on L929 cells at concentrations below 1.6 mg / mL.
[0051] Example 4: Determination of the toxin neutralizing efficacy of Apt-nEVs
[0052] Apt-nEVs were incubated with TTX at 37 °C for 1 h. After ultrafiltration and centrifugation, the filtrate was collected, and the free TTX content was detected by UPLC-M / MS. As shown in Figure 5A, the characteristic peak fragments of the nEVs / Apt-nEVs group showed good m / z 302 response, and the peak retention time was consistent with that of the TTX standard solution (control). As shown in Figure 5B, the peak area ratio of the characteristic fragment peaks of nEVs and Apt-nEVs at m / z 302 was significantly lower than that of the TTX standard solution (control). When the concentration of nEVs was 1.6 mg / mL, the toxicity inhibition efficiency against the TTX standard solution (control) was 56.23% (i.e., 0.32 mg of nEVs could inhibit the toxicity of 3.59 ng of TTX); while at the same concentration (1.6 mg / mL), the inhibition efficiency of Apt-nEVs increased to 82.80% (i.e., 0.32 mg of Apt-nEVs could inhibit the toxicity of 5.28 ng of TTX); the results indicate that Apt-nEVs can significantly antagonize the toxic effects of TTX by adsorbing and trapping it.
[0053] Example 5: Protective effect of Apt-nEVs on nerve cells
[0054] Furthermore, the detoxification effect of Apt-nEVs was evaluated using a Neuro-2a cytotoxicity assay (based on a sodium channel-mediated cell swelling model). The sodium channel agonist veratrine (VTD) and Na+ were used. + / K +- The ATPase inhibitor ouabain (O) (i.e., the V+O group) induced cell swelling and death due to Na⁺ influx, and Neuro-2a cell viability decreased with increasing VTD and O concentrations (as shown in Figure 6A). Adding the sodium channel-specific inhibitor TTX to the VTD and O mixture (i.e., the V+O+T group) increased cell viability in a TTX concentration-dependent manner, indicating that TTX could inhibit the cytotoxicity of veratrine and ouabain (as shown in Figure 6B). To verify the detoxification effect of Apt-nEVs, Apt-nEVs (1.6 mg / mL) and TTX (100 nM) were pre-incubated at 37 °C for 1 h. The filtrate was collected by ultrafiltration centrifugation (6,000 × g, 4 °C, 15 min) after mixing with V+O solution and then incubated with Neuro-2a cells (3 × 10⁶ cells / year). 4 (cells / well). After 24 h, cell viability was measured according to the instructions of the CCK-8 cytotoxicity assay kit. As shown in Figure 6C, the cell viability of the Apt-nEVs treatment group was significantly higher than that of the V+O group, but lower than that of the V+O+T group, indicating that Apt-nEVs partially blocked the inhibitory effect of TTX on V+O toxicity by adsorbing and trapping TTX, demonstrating a good detoxification effect.
[0055] Example 6: The protective mechanism of Apt-nEVs on nerve cells
[0056] Apt-nEVs (1.6 mg / mL) and TTX (100 nM) were mixed in equal volumes and incubated at 37 °C for 1 h. The mixture was then subjected to 30 kDa ultrafiltration and centrifugation (6,000 × g, 4 °C, 15 min). The filtrate was collected and VTD and O2 solutions were added. This mixture was then added to Neuro-2a cells (1 × 10⁻⁶ cells / mL). 4 After incubation for 24 h, intracellular ROS levels were measured according to the reactive oxygen species (ROS) detection kit instructions (DCFH-DA method, incubation at 37 ℃ in the dark for 30 min, Ex / Em=488 / 525 nm). As shown in Figure 7, the ROS levels in the nEVs / Apt-nEVs pretreated group were significantly lower than those in the V+O group and slightly higher than those in the V+O+T group. Surface Apt-nEVs, by adsorbing and trapping TTX, weakened the inhibitory effect of TTX on VTD+O-induced oxidative stress damage.
[0057] The preferred embodiments of the present invention have been described in detail above, but the present invention is not limited to the embodiments described. Those skilled in the art can make various equivalent modifications or substitutions without departing from the spirit of the present invention, and these equivalent modifications or substitutions are all included within the scope defined by the claims of this application.
Claims
1. A nucleic acid aptamer-modified extracellular vesicle for nerve cells, characterized in that, The method involves conjugating a tetrodotoxin nucleic acid aptamer with dual-terminal modifications to extracellular vesicles (nEVs) derived from nerve cells. The nucleotide sequence of the nucleic acid aptamer is shown in SEQ ID NO.
1.
2. The extracellular vesicles modified with nucleic acid aptamers according to claim 1, characterized in that, The tetrodotoxin nucleic acid aptamer is modified with cholesterol at its 3′ end and linked to an AMAC fluorescent group at its 5′ end. The 3′ end of the nucleic acid aptamer is coupled to the surface of nEVs through hydrophobic interaction to construct nucleic acid aptamer-modified extracellular vesicles of nerve cells, Apt-nEVs.
3. A method for preparing extracellular vesicles modified with nucleic acid aptamers as described in claim 1 or 2, characterized in that, Includes the following steps: (A) Preparation of extracellular vesicles (nEVs): extracellular vesicles (nEVs) were obtained by gradient mechanical extrusion of polycarbonate membrane and ultra-high-speed centrifugation of neural stem cells. (B) Coupling of nucleic acid aptamers with nEVs: First, the TTX nucleic acid aptamer sequence Apt is synthesized, with cholesterol attached to its 3′ end and a labeling group added to its 5′ end; then, the 3′ end of the nucleic acid aptamer is directly inserted into the surface of nEVs through hydrophobic interaction to construct nucleic acid aptamer-modified extracellular vesicles of nerve cells, Apt-nEVs.
4. The method for preparing nucleic acid aptamer-modified extracellular vesicles of nerve cells according to claim 3, characterized in that, The nEVs mentioned in step (A) are extracellular vesicles with a particle size of 150~200 nm prepared by sequentially passing a suspension of mouse neural stem cells C17.2 through 10 μm, 5 μm, 0.8 μm and 0.4 μm polycarbonate membranes for gradient mechanical extrusion and ultracentrifugation at 120,000 × g for 105 min.
5. The method for preparing nucleic acid aptamer-modified extracellular vesicles of nerve cells according to claim 3, characterized in that, Step (B) involves adjusting the nEVs concentration to 2.5 mg / mL, mixing it with 10 μM of TTX nucleic acid aptamer, and incubating it at 37 °C for 24 h.
6. The application of a nucleic acid aptamer-modified extracellular vesicle of nerve cells as described above in the preparation of a drug for the prevention and treatment of marine guanidine neurotoxin poisoning.
7. The application of the nucleic acid aptamer-modified extracellular vesicles of nerve cells as described in claim 1 in the preparation of marine guanidine neurotoxin recognition, trapping, adsorption, and detoxification products.
8. The use of a nucleic acid aptamer-modified extracellular vesicle as described in claim 1 in the preparation of a protective drug against neuronal death induced by marine guanidine neurotoxins.
9. The use of a nucleic acid aptamer-modified extracellular vesicle as described in claim 1 in the preparation of a protective drug against oxidative stress damage to nerve cells induced by marine guanidine neurotoxins.
10. The application according to any one of claims 6-9, characterized in that, The marine guanidine neurotoxin mentioned is tetrodotoxin.