Aromatic amino acid hydroxylase mutant for relieving substrate inhibition and improving catalytic activity
Patent Information
- Application Number
- CN202510647890.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-05-20
- Publication Date
- 2026-04-10
Smart Images

Figure CN121825908A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to aromatic amino acid hydroxylase mutants that alleviate substrate inhibition and enhance catalytic activity, belonging to the field of bioengineering technology. Background Technology
[0002] Hydroxytryptophan, also known as 2-amino-3-(5-hydroxy-1H-indol-3-yl)propionic acid, is a dietary supplement primarily used to improve sleep and treat depression. Methods for producing hydroxytryptophan include natural plant extraction, chemical synthesis, and microbial fermentation. However, chemical synthesis of tryptophan and hydroxytryptophan is prone to producing toxic impurities that can cause eosinophilic myalgia syndrome. Monitoring and controlling pollutants during synthesis is challenging. Therefore, extraction from the seeds of Ghanaian plants remains the primary method for commercial production of hydroxytryptophan.
[0003] With the rise of synthetic biology, microbial production of hydroxytryptophan has become a popular trend in future industry development. Compared with chemical synthesis, it offers better control over pollutants and breaks the limitation of plant extraction methods' heavy reliance on plant raw materials. Therefore, research on microbial synthesis of hydroxytryptophan is of great significance to its industrial development. Microbial production of hydroxytryptophan mainly involves the catalysis of tryptophan synthesis by ferrous / tetrahydrobiopterin-dependent aromatic amino acid hydroxylases. However, the hydroxylation reaction of tryptophan presents a significant challenge, including issues such as the stability of heterologous expression, typically low hydroxylation efficiency, and severe substrate inhibition. The industrial properties of aromatic amino acid hydroxylases have long been a major factor restricting the yield of hydroxylated tryptophan synthesis. Therefore, it is essential to modify key enzymes using protein engineering, directed evolution, and other technologies to enhance their catalytic activity and alleviate substrate inhibition. Summary of the Invention
[0004] This invention provides an aromatic amino acid hydroxylase mutant that alleviates substrate inhibition and / or enhances catalytic activity by mutating tyrosine at position 235 to serine based on the starting sequence.
[0005] In one embodiment, the mutant also has mutations of (a) and / or (b):
[0006] (a) Mutate serine at position 127 to leucine, lysine, isoleucine, lysine, alanine, methionine, or valine.
[0007] (b) Mutate the methionine at position 124 to cysteine, valine, leucine, glutamic acid, arginine, or glutamine.
[0008] In one embodiment, the starting sequence is as shown in SEQ ID NO.1.
[0009] In one embodiment, the mutant also has an N-terminal or C-terminal truncation.
[0010] In one embodiment, the mutant is a mutant with 99 amino acids truncated at the N-terminus.
[0011] In one embodiment, the mutant has 23 amino acids truncated at its C-terminus.
[0012] In one embodiment, the mutant is truncated by 99 amino acids at the N-terminus and 23 amino acids at the C-terminus.
[0013] In one embodiment, the mutant is based on the sequence shown in SEQ ID NO.1, with tyrosine at position 235 mutated to serine, methionine at position 124 mutated to leucine, and serine at position 127 mutated to isoleucine.
[0014] In one embodiment, the mutant is based on the sequence shown in SEQ ID NO.1, with tyrosine at position 235 mutated to serine, methionine at position 124 mutated to leucine, and serine at position 127 mutated to isoleucine, and with 99 residues truncated at the N-terminus and / or 23 residues truncated at the C-terminus.
[0015] The present invention also provides a gene that expresses the mutant.
[0016] The present invention also provides a recombinant expression vector containing the said gene.
[0017] In one embodiment, the expression vector includes, but is not limited to, pACYCDuet.
[0018] The present invention also provides recombinant bacteria containing a recombinant expression vector.
[0019] In one embodiment, the recombinant bacteria uses Escherichia coli as the host bacterium.
[0020] In one embodiment, the recombinant bacteria also overexpress the pETDuet plasmid containing the genes for cyclization hydrolase folE (Genbank accession number: CP034943.1), 6-pyruvyltetrahydrobiopterin synthase PTPS (Genbank accession number: D17400.1), guanopterin reductase SPR (Genbank accession number: AK291856.1), pterin-4α-methanolamine dehydratase PCD (Genbank accession number: CP166925.2), and dihydropteridine reductase DHPR (Genbank accession number: CP057673.1).
[0021] The present invention also provides a method for preparing hydroxytryptophan using the recombinant bacteria.
[0022] In one embodiment, the method involves reacting the recombinant bacteria in an environment containing tryptophan at 25–40°C for at least 2 hours.
[0023] In one embodiment, the concentration of tryptophan is 0.5–6 g / L.
[0024] In one embodiment, the method involves reacting the recombinant bacteria at 37°C for at least 2 hours in an environment containing 2–6 g / L tryptophan.
[0025] The present invention also provides the use of the aromatic amino acid mutant, or the recombinant bacteria, in the preparation of hydroxytryptophan or products containing hydroxytryptophan.
[0026] Beneficial effects:
[0027] This invention combines computational analysis and machine language prediction to mutate the M124, S127, and Y235 sites. The resulting beneficial mutants significantly improve catalytic activity while alleviating substrate inhibition. The catalytic ability of the variants is more than 1.5 times higher than that of the wild type, and the yield of hydroxytryptophan produced under high substrate concentration is increased by 1.7 times, showing great application potential. Attached Figure Description
[0028] Figure 1 The relative enzyme activity of the mutant constructed by saturating mutation of the Y235 site.
[0029] Figure 2 The relative enzyme activity of the mutants at different tryptophan concentrations is given.
[0030] Figure 3 The yield of hydroxytryptophan synthesized for different tryptophan concentrations. Detailed Implementation
[0031] Example 1: Construction of recombinant engineered bacteria containing genes encoding aromatic amino acid hydroxylases
[0032] The prokaryotic codons were optimized using the protein sequence shown in SEQ ID NO: 1, and the gene sequence (shown in SEQ ID NO: 2) was synthesized and inserted between the BamHI and HindIII restriction sites of the pACYCDuet-1 vector. The synthesis of the plasmid containing the wild-type gene was performed by Genewiz Suzhou. The synthesized plasmid was transformed into *Escherichia coli* BL21(DE3) strain via chemical transformation and stored at -80°C.
[0033] Example 2: Construction of Saturated Mutants at Key Sites
[0034] Analysis of the substrate tunnel of the enzyme protein shown in SEQ ID NO: 1 revealed that the Y235 site was the bottleneck of the tunnel, and therefore, a saturation mutation was performed on this site. Nineteen pairs of primers were designed to perform reverse PCR amplification using a codon-optimized vector containing the gene shown in SEQ ID NO: 2 as a template. The obtained PCR product was digested with DpnI fast digester and then chemically transformed into *E. coli* strain BL21(DE3). The transformed product was plated on LB agar plates containing chloramphenicol and incubated overnight at 37°C. Clones were randomly selected for colony PCR identification and sequencing verification. Single colonies with correct sequencing verification were inoculated into LB liquid medium containing antibiotics and incubated overnight at 37°C. The strain was preserved in glycerol tubes and stored at -80°C. Sequencing was performed by Genewiz Suzhou.
[0035] The primer sequences are:
[0036] F1: TAATG NNK GGGAGCGAACTGGATG;
[0037] R1: CAGTTCCGCTCCCMNNCATTAAAAC;
[0038] In this context, NNK is replaced by the codons for 19 amino acids, excluding serine.
[0039] The recombinant mutant strain expressing the constructed mutant and the strain expressing the wild-type enzyme were induced at 16℃ for 12 h, respectively. The bacterial cells were collected by centrifugation, washed three times with PBS buffer, and the bacterial cell density (OD) was controlled. 600 =50, cells were lysed on ice at 4℃. Crude enzyme activity was determined using the lysed cell slurry. Using wild-type enzyme activity as 100%, mutants constructed by mutating the Y235 site to alanine (A), phenylalanine (F), histidine (H), isoleucine (I), methionine (M), or serine (S) showed a 120%-200% increase in catalytic activity (e.g., ). Figure 1 (As shown).
[0040] Example 3: Construction of Cooperative Mutants of Flexible Loops
[0041] Analysis of the mutant with the best catalytic effect revealed a synergistic effect of its flexible ring. Machine language prediction was used to identify variants with improved activity parameters for verification. Primers were designed to mutate position 124 to glutamic acid (E), leucine (L), valine (V), arginine (R), cysteine (C), and glutamine (Q), and position 127 to isoleucine (I), lysine (K), valine (V), serine (S), leucine (L), methionine (M), and alanine (A), showing further enhanced activity in the variants (Table 1).
[0042] Table 1. Mutants and relative enzyme activities
[0043] strain Mutant form Relative enzyme activity (%) Variant 1 Y235S 100 Variant 2 Y235S, S127L 116 Variant 3 Y235S, M124C 122 Variant 4 Y235S, M124V 117 Variant 5 Y235S, M124L, S127K 157 Variant 6 Y235S, M124E, S127I 132 Variant 7 Y235S, M124R, S127A 139 Variant 8 Y235S, M124R, S127M 131 Variant 9 Y235S, M124Q, S127V 129
[0044] Example 4 Catalytic production of hydroxytryptophan at different tryptophan concentrations
[0045] After extracting the plasmid of variant 5 constructed in Example 3 and the wild-type plasmid, it was combined with the pETDuet plasmid containing the tetrahydrobiopterin synthesis gene. Figure 2 The pETDuet plasmid containing the tetrahydrobiopterin synthesis gene was transformed into strain BL21. Specifically, the pETDuet plasmid was constructed by introducing the following genes into the pETDuet plasmid: FolE gene (nucleotide sequence as shown in SEQ ID NO.3), PTPS gene (nucleotide sequence as shown in SEQ ID NO.4), SPR gene (nucleotide sequence as shown in SEQ ID NO.5), DHPR gene (nucleotide sequence as shown in SEQ ID NO.6), and PCD gene (nucleotide sequence as shown in SEQ ID NO.7).
[0046] After colony PCR verification of single colonies grown on LB agar plates containing chloramphenicol and ampicillin, the colonies were inoculated into LB liquid medium containing the two antibiotics and cultured overnight at 37°C and 220 rpm. The inoculum was then transferred to TB medium at a 5% inoculation rate, with the addition of ampicillin at a final concentration of 100 μg / ml and chloramphenicol at a final concentration of 15 μg / ml. The medium was cultured at 37°C and 220 rpm until the OD600 reached approximately 0.8. IPTG was then added at a final concentration of 0.1 mM, and the medium was incubated at 25°C for 18 h. The bacterial cells were collected by centrifugation, and the OD600 was controlled. 600 =25, suspended in M9Y medium containing 0.5g / L-6g / L tryptophan, and incubated at 37℃ for 2h before sampling.
[0047] HPLC detection method: Dilute the reaction solution 5 times with 5% trichloroacetic acid (TCA), centrifuge at 13000 rpm for 10 min, collect the supernatant, filter through a 0.22 μm membrane, and add it to the HPLC sample tray. Column: dimosoil C18
[0048] (5μL, 250mm×4.6mm), mobile phase: A: 0.1% formic acid aqueous solution, B: 100% methanol, detector: UVDetector, detection wavelength: 276nm, column temperature: 25℃, injection volume: 10μL, flow rate: 1.0mL / min.
[0049] Liquid chromatography results showed that the yield of the variant was significantly higher than that of the wild type. Figure 3 At tryptophan concentrations of 4 g / L and 6 g / L, variant 5 showed a 1.71-fold and 1.73-fold increase in yield compared to the wild type, respectively, effectively mitigating the inhibitory effect.
[0050] Example 5: Construction of mutants with truncated N-terminal and C-terminal residues and testing of hydroxytryptophan synthesis capacity.
[0051] Shortening the hydroxylase helps reduce protein inclusion bodies. Using plasmids containing the wild-type (WT) and plasmids containing variant 5 constructed in Example 3 as templates, the N-terminal 99 residues (ΔN) of the hydroxylase were shortened using primers F2 / R2, the C-terminal 23 residues (ΔC) were shortened using primers F3 / R3, and primers F2 / R2 and F3 / R3 were used to simultaneously shorten the N-terminal 99 residues and the C-terminal 23 residues (ΔNC). The constructed plasmids and the pETDuet plasmid containing the tetrahydrobiopterin synthesis gene described in Example 4 were co-transformed into E. coli BL21. As described in Example 4, 2 g / L tryptophan was added for whole-cell transformation for 1 h, and the yield of hydroxytryptophan was detected as shown in Table 2.
[0052] The primer sequences are:
[0053] F2: CTTTAATAAGATGGAGGATGGAATGGAG;
[0054] R2: ATCTATTAAAGTTAAACAA;
[0055] F3: CTAGCGCTATGTAAAAGTAATCGTATTG;
[0056] R3: TTACATAGCGCTAGTAATTG.
[0057] Table 2. Yields of hydroxytryptophan synthesized from truncated wild-type and variant 5
[0058] strain WT WT△N WT△C WT△NC Yield (g / L) 0.48 0.75 0.52 0.68 strain Variant 5 Variant 5△N Variant 5△C Variant 5△NC Yield (g / L) 0.82 1.08 0.92 1.03
[0059] Although the present invention has been disclosed above with reference to preferred embodiments, it is not intended to limit the present invention. Anyone skilled in the art can make various modifications and alterations without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be determined by the claims.
Claims
1. An aromatic amino acid hydroxylase mutant, characterized in that, Based on the starting sequence shown in SEQ ID NO.1, the tyrosine at position 235 was mutated to serine.
2. The aromatic amino acid hydroxylase mutant according to claim 1, characterized in that, The mutant also has mutations (a) and / or (b): (a) Mutate serine at position 127 to leucine, lysine, isoleucine, lysine, alanine, methionine, or valine. (b) Mutate the methionine at position 124 to cysteine, valine, leucine, glutamic acid, arginine, or glutamine.
3. The aromatic amino acid hydroxylase mutant according to claim 1 or 2, characterized in that, The mutant also has truncation at the N-terminus and / or C-terminus.
4. The aromatic amino acid hydroxylase mutant according to claim 1, characterized in that, The mutant is based on the sequence shown in SEQ ID NO.1, with tyrosine at position 235 mutated to serine, methionine at position 124 mutated to leucine, and serine at position 127 mutated to isoleucine, and 99 residues at the N-terminus and / or 23 residues at the C-terminus are truncated.
5. The gene expressing any of the mutants described in claims 1 to 4.
6. A recombinant expression vector containing the gene of claim 5, characterized in that, The expression vectors include, but are not limited to, pACYCDuet.
7. A recombinant microorganism expressing any of the mutants described in claims 1 to 4.
8. Recombinant Escherichia coli, characterized in that, Express the aromatic amino acid hydroxylase mutant according to any one of claims 1 to 4, and overexpress cyclization hydrolase folE, 6-pyruvyltetrahydrobiopterin synthase PTPS, guanopterin reductase SPR, pterin-4α-methanolamine dehydratase PCD and dihydropteridine reductase DHPR.
9. A method for preparing hydroxytryptophan, characterized in that, The recombinant Escherichia coli according to claim 8 is reacted in an environment containing tryptophan at 25–40°C for at least 2 hours.
10. The use of the aromatic amino acid hydroxylase mutant of any one of claims 1 to 4, or the recombinant microorganism of claim 7, or the recombinant Escherichia coli of claim 8, or the method of claim 9 in the preparation of hydroxytryptophan or products containing hydroxytryptophan.