Chicken CD30 gene targeting sgRNA as well as combination and application of chicken CD30 gene targeting sgRNA

By combining sgRNAs targeting the chicken CD30 gene and using gene editing technology, a CD30 knockout cell line was successfully established, solving the problem of CD30 gene knockout models, providing experimental materials for studying CD30 function, and improving gene editing efficiency and cell screening efficiency.

CN121975804APending Publication Date: 2026-05-05CHINA AGRI UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202610009511.2
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-01-06
Publication Date
2026-05-05

AI Technical Summary

Technical Problem

Existing technologies have failed to effectively establish efficient CD30 gene knockout models, hindering in-depth research into the mechanisms of Marek's disease lymphoma development and tumor transformation in chickens.

Method used

We designed and applied a combination of sgRNAs targeting the chicken CD30 gene, and used gene editing technology to knock out a specific exon region of the CD30 gene in the chicken fibroblast cell line DF-1. We then established a CD30 knockout cell line using multiple plasmid transfection and homologous recombination, and used fluorescent labeling to detect gene editing efficiency.

Benefits of technology

A CD30-/-DF-1 cell line with extremely low CD30 expression was successfully established, providing experimental materials for studying CD30 function, improving gene targeting efficiency and cell screening efficiency, and clarifying the role of CD30 in lymphoma development.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure FT_1
    Figure FT_1
  • Figure FT_2
    Figure FT_2
  • Figure FT_3
    Figure FT_3
Patent Text Reader

Abstract

The invention relates to the technical field of molecular biology and genetic engineering, and discloses sgRNA targeting a chicken CD30 gene and a combination and application thereof. The sgRNA and the sgRNA combination provided by the invention perform targeted knockout on the seventh exon region (transmembrane region) of the chicken CD30 gene, and the sgRNA knockout target of the chicken CD30 is transfected into a chicken fibroblast line DF-1 to prepare the CD30 knockout DF-1 cell, namely the CD30 / -DF-1 cell, and compared with a control group cell through detection, the CD30 expression quantity in the CD30 / -DF-1 cell is extremely low, and the result shows that the CD30 is successfully edited. The establishment of the CD30- / -DF-1 cell line provides an experimental material for deeply researching the functions of CD30.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the fields of molecular biology and genetic engineering, and more specifically, to sgRNAs targeting the chicken CD30 gene, their combinations, and applications. Background Technology

[0002] Marek's disease (MD) in chickens is a contagious, neoplastic disease caused by Marek's disease virus (MDV) of the Herpesviridae family. It has significant economic and scientific value, causing $1-2 billion in economic losses globally annually. MD is used as an important model for studying virus-induced lymphoma. MD leads to the proliferation of lymphoid cells in chickens, resulting in T-cell lymphoma. Chicken Marek's disease lymphoma is a natural animal model of lymphoma with high CD30 gene expression; high CD30 expression is a marker of lymphocyte-tumor transformation.

[0003] CD30 is member 8 of the tumor necrosis factor receptor superfamily, namely TNFRSF8. Its encoded protein is a transmembrane glycoprotein involved in immune regulation and cell signal transduction, playing a crucial role in immune regulation and tumorigenesis. CD30 is mainly expressed in activated T cells, B cells, and natural killer (NK) cells. Through its ligands CD30L (CD153, TNFSF8), it activates downstream signaling pathways, such as the NF-κB and MAPK pathways, thereby regulating cell proliferation, survival, or apoptosis. In normal lymphocytes, CD30 can both promote cell proliferation and induce cell death; however, in malignant lymphoma cells, CD30 expression exhibits a unidirectional regulatory characteristic that promotes proliferation, which may be closely related to cell carcinogenesis.

[0004] Meq, the proto-oncogene of Marek's virus (MDV), is the most important oncogene of MDV. It forms homodimers or heterodimers with other transcription factors, such as c-JUN and c-FOS, playing a crucial role in the development of MDV-induced T-cell lymphoma. Meq expression is positively correlated with CD30 expression; cells with high CD30 expression in lymphoma also highly express the Meq gene. MDV-resistant chickens infected with MDV can produce CD30-specific antibodies, suggesting that CD30 may be involved in tumor immune escape, promoting viral latency and tumorigenesis. To further clarify the role of CD30 in the development of Marek's disease in chickens, it is urgent to establish an efficient CD30 gene knockout cell model to study the role of CD30 in the development and transformation of Marek's disease in chickens. Summary of the Invention

[0005] The purpose of this invention is to provide sgRNAs targeting the chicken CD30 gene, their combinations, and applications.

[0006] The CD30 gene, a member of the tumor necrosis factor receptor superfamily, is an important target in lymphoma treatment. It is highly expressed in classical Hodgkin lymphoma cells and is a core indicator for pathological diagnosis. CD30 plays a crucial role in the biological functions of both normal and malignant lymphocytes, but its specific mechanisms in lymphocyte generation are not fully understood. Marek's disease (MD) in chickens is an infectious, neoplastic disease in birds and is used as an important model for studying virus-induced lymphoma. Marek's disease lymphoma is a natural animal model of lymphoma with high CD30 gene expression. The Marek's disease virus proto-oncogene Meq can significantly increase the transcriptional level of CD30, and high CD30 expression plays an important role in maintaining the growth and proliferation of tumor cells. Therefore, this invention provides a combination of sgRNAs for targeting and knocking out the seventh exon region (transmembrane region) of the chicken CD30 gene, the nucleotide sequences of which are shown in SEQ ID NO:1 and SEQ ID NO:2. Targeting the sgRNA knockout site of chicken CD30, CD30 knockout DF-1 cells were prepared by transfecting the cells into the chicken fibroblast cell line DF-1. - / - DF-1 cells, compared with control cells, showed increased CD30 levels. - / - The extremely low expression level of CD30 in DF-1 cells indicates that CD30 editing was successful. - / - The establishment of the DF-1 cell line provides experimental materials for in-depth research on the function of CD30.

[0007] In order to achieve the objective of the present invention, in a first aspect, the present invention provides an sgRNA that targets the chicken CD30 gene, which is sgRNA1 or sgRNA2. The nucleotide sequence of the sgRNA1 action site is: 5'-AGAGACCAAGAGAAGGCAGA (SEQ ID NO:1)-(AGG)-3'; where AGG is a PAM sequence.

[0008] The nucleotide sequence of the sgRNA2 action site is: 5'-AGGTCTTGTTTTCTGGGCAG (SEQ ID NO:2)-(TGG)-3'; where TGG is a PAM sequence.

[0009] Secondly, the present invention provides a combination of sgRNAs targeting the chicken CD30 gene, consisting of sgRNA1 and sgRNA2.

[0010] Thirdly, the present invention provides a nucleic acid construct comprising a nucleic acid sequence encoding the sgRNA1 or sgRNA2 or a combination of the sgRNAs.

[0011] Furthermore, the nucleic acid construct also contains a nucleic acid sequence encoding the Cas protein.

[0012] Fourthly, the present invention provides a biological material comprising the sgRNA1 or sgRNA2 or a combination of the sgRNAs, or comprising the nucleic acid construct; The biological materials include, but are not limited to, expression cassettes, transposons, plasmid vectors, viral vectors, engineered bacteria, or transgenic cell lines.

[0013] Fifthly, the present invention provides a host cell, the host cell comprising the sgRNA1 or sgRNA2 or a combination of the sgRNAs, or comprising the nucleic acid construct; The host cell is a chicken-derived cell, preferably the chicken fibroblast cell line DF-1.

[0014] In a sixth aspect, the present invention provides a method for editing the chicken CD30 gene in vitro, comprising introducing the sgRNA1 or sgRNA2 or a combination of the sgRNAs, or introducing the nucleic acid construct into cells; The editing resulted in a decrease in the expression level or functional activity of the CD30 protein encoded by the chicken CD30 gene.

[0015] In a seventh aspect, the present invention provides the application of the sgRNA1 or sgRNA2 or the combination of the sgRNAs, or the nucleic acid construct, or the biological material or the host cell in the preparation of cell models or animal models for studying the function of the chicken CD30 gene.

[0016] Eighthly, the present invention provides a kit for editing the chicken CD30 gene, comprising the sgRNA1 or sgRNA2 or a combination of the sgRNAs, or the nucleic acid construct.

[0017] By employing the above technical solution, the present invention has at least the following advantages and beneficial effects: (i) This invention designs multiple sgRNAs simultaneously from a segment of the chicken CD30 gene. By detecting the targeting cleavage efficiency of a single sgRNA and a combination of sgRNAs, it is determined that a combination of sgRNAs can achieve more efficient gene targeting.

[0018] (II) This invention utilizes a PX459 vector containing the Cas9 sequence, a pGL3-gRNA-mCherry vector containing sgRNA, and a pcWXL-EG-CD30-FP vector linked with the target gene CD30 target sequence. Cells are co-transfected with multiple plasmids, and the percentage of cells simultaneously expressing red and green fluorescence is analyzed to identify the gene targeting efficiency and the most efficient sgRNA. The mCherry fluorescence (emitting red fluorescence) in the pGL3-gRNA-mCherry vector can mark positive cells successfully transfected with this vector. The pcWXL-EG-CD30-FP vector contains a CD30 targeting sequence of sgRNA, which is inserted between EGFP sequences. By co-transfecting cells with this vector and the pGL3-gRNA-mCherry vector, the success of sgRNA targeting can be determined by observing EGFP expression. This means that the sgRNA successfully cleaves the target sequence of the CD30 gene on the vector, resulting in the EG and FP fragments on the vector being linked into a complete EGFP sequence that expresses green fluorescence. This allows for a more direct and convenient detection of the sgRNA cleavage efficiency.

[0019] (III) This invention designs a vector CD30 donor-EGFP containing CD30 homologous arms (containing upstream (LA) and downstream (RA) homologous arms of the CD30 gene target sequence, with an exogenous fragment hPGK-EGFP-T2A-PuroR connected between the upstream and downstream homologous arms; EGFP is expressed by an independent exogenous promoter hPGK and emits green fluorescence), CD30 The donor-mCherry vector (containing upstream (LA) and downstream (RA) homologous arms of the CD30 gene target sequence, with the exogenous fragment hPGK-mCherry-T2A-PuroR connected between the upstream and downstream homologous arms; mCherry is expressed by an independent exogenous promoter hPGK and emits red fluorescence) integrates the sequences in the upstream and downstream homologous arms into the chicken CD30 genome through homologous recombination of the CD30 homologous arms in the vector. This replaces the original CD30 targeting region with hPGK-EGFP-T2A-PuroR or hPGK-mCherry-T2A-PuroR, thereby achieving the integration of hPGK-EGFP-T2A-PuroR and hPGK-mCherry-T2A-PuroR markers into the chicken genome. In this way, cells that emit both green and red fluorescence are those whose CD30 biallelic genes have been replaced by elements on the CD30 donor plasmid, while cells that emit only green or red fluorescence are those whose CD30 monollelic genes have been replaced. By detecting green and red fluorescence using flow cytometry, successfully transfected and edited cells can be sorted, improving the efficiency of subsequent screening and culture of positive cells.

[0020] (iv) This invention utilizes the large exogenous sequence in the CD30 donor-EGFP and CD30 donor-mCherry vectors to integrate into the chicken CD30 genome through homologous recombination, thereby disrupting the normal CD30 coding sequence. The CD30 gene is knocked out by replacing the CD30 targeting region with elements on the CD30 donor plasmid. Attached Figure Description

[0021] Figure 1 This is a schematic diagram of the chicken CD30 gene structure and sgRNA target site provided in Example 1 of the present invention; Figure 2 This is a schematic diagram of the pGL3-gRNA-mCherry vector structure provided in Embodiment 1 of the present invention; Figure 3 This is a schematic diagram of the PX459 carrier structure provided in Embodiment 1 of the present invention; Figure 4 This is a schematic diagram of the pcWXL-EG-CD30-FP carrier structure provided in Embodiment 1 of the present invention; Figure 5 This is a schematic diagram of the fluorescence results of sgRNA targeting efficiency provided in Example 1 of the present invention; Figure 6 This is a schematic diagram of the CD30 donor-EGFP vector structure provided in Embodiment 2 of the present invention; Figure 7 This is a schematic diagram of the CD30 donor-mCherry vector structure provided in Embodiment 2 of the present invention; Figure 8 The CD30 successfully established after flow sorting as provided in Embodiment 2 of the present invention - / - Schematic diagram of the DF-1 cell line; Figure 9 CD30 provided in Embodiment 3 of the present invention - / - Figure showing the mRNA expression levels after CD30 knockout in DF-1 cells; all values ​​are expressed as mean ± SD. P<0.01. Detailed Implementation

[0022] This invention utilizes gene editing technology to prepare CD30 gene knockout experimental materials. By knocking out a specific sequence in the seventh exon region of the chicken CD30 gene, the expression of the chicken CD30 gene is reduced. Specifically, it provides an sgRNA combination and its application in editing the chicken CD30 gene.

[0023] The present invention adopts the following technical solution: This invention provides an sgRNA combination, wherein the gRNA combination comprises one or two groups of sgRNAs as follows: i) sgRNA1 as shown in SEQ ID NO:1; ii) sgRNA2 as shown in SEQ ID NO:2.

[0024] Furthermore, the sgRNA combination includes the sgRNAs shown in SEQ ID NO:1 and 2.

[0025] The present invention further provides biological materials comprising the sgRNA combination, wherein the biological material may be a carrier or a cell.

[0026] Further, the vector is one or more of the following: PX459 vector, pcWXL-EG-CD30-FP vector, pGL3-gRNA-mCherry vector, CD30 donor-EGFP vector, and CD30 donor-mCherry vector; the cell is one or more of the following: 293T cells and DF-1 cells.

[0027] The present invention further provides the application of the sgRNA1 or sgRNA2 or the combination of the sgRNAs, or the biological material, in the detection of the effect of CD30 gene editing in chickens.

[0028] Furthermore, the expression of the chicken CD30 gene was reduced by knocking out a specific sequence in the seventh exon region of the chicken CD30 gene.

[0029] This invention provides a method for editing the chicken CD30 gene, the method comprising: editing the chicken CD30 gene using the sgRNA1 or sgRNA2 or a combination of the sgRNAs, or the biological material.

[0030] The present invention further provides the application of the sgRNA1 or sgRNA2 or the combination of the sgRNAs, or the biological material, in the detection of CD30 knockout effect.

[0031] The present invention further provides a method for reducing the expression level of the chicken CD30 gene, the method comprising: knocking out the chicken CD30 gene using the sgRNA1 or sgRNA2 or a combination of the sgRNAs, or the biological material.

[0032] The following examples are used to illustrate the present invention, but are not intended to limit the scope of the invention. Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art, and the raw materials used are all commercially available products.

[0033] Example 1: sgRNA Design This embodiment provides a method for designing sgRNAs targeting the seventh exon region of the chicken CD30 gene, as detailed below: 1. Design and selection of sgRNA sequences targeting the seventh exon of chicken CD30 (1) The sequence of the seventh exon region of the chicken CD30 gene (Gene ID: 395090) was found through the NCBI database; (2) Submit the searched sequence to an online website to design sgRNA and set the PAM sequence to NGG.

[0034] This invention designs two targeting sites for the seventh exon region of chicken CD30 (see schematic diagram of CD30 structure and sgRNA targeting site as shown in Figure 1). Figure 1 As shown in the figure), the sgRNA sequence for targeting was obtained as shown in SEQ ID NO:1-2.

[0035] sgRNA1: 5'- AGAGACCAAGAGAAGGCAGA (SEQ ID NO: 1) - (AGG) -3'; sgRNA2: 5'-AGGTCTTGTTTTCTGGGCAG (SEQ ID NO: 2)-(TGG)-3'.

[0036] 2. Construct two oligonucleotide double strands of sgRNA. (1) Add appropriate restriction endonuclease sticky ends to the 5' of the two selected sgRNA sequences, add CACC to the sgRNA sequence linked to the BbsI cleavage site to obtain forward oligonucleotides; if the sgRNA sequence does not start with G at the 5' end, add a restriction endonuclease sticky end to the 5' end and then add another G. (2) Based on the selected sgRNA sequence, obtain the complementary strand of its corresponding DNA, and add AAAC bases to its 5' end to obtain a reverse oligonucleotide; (3) Synthesize the above-mentioned forward oligonucleotides and reverse oligonucleotides respectively; (4) The synthesized forward and reverse oligonucleotides were phosphorylated, denatured, and annealed to form base pairings that could be ligated into a linearized pGL3-gRNA-mCherry vector (this vector was modified from the pGL3-basic vector; first, the pGL3-basic plasmid was digested with restriction endonucleases HindIII and XbaI, and the product was recovered). Figure 2 The expression elements were constructed into the recovered pGL3-basic product using homologous recombination. Figure 2The double-stranded structure (pGL3-basic vector) in the image was purchased from Beijing Qingke Biotechnology Co., Ltd. (Reference: Transactivation of miR-34a by p53 broadly influences gene expression and promotes apoptosis. Chang TC, Wentzel EA, KentOA, Ramachandran K, Mullendore M, Lee KH, Feldmann G, Yamakuchi M, Ferlito M, Lowenstein CJ, Arking DE, Beer MA, Maitra A, Mendell JT. Mol Cell. 2007 Jun8;26(5):745-52.).

[0037] The forward and reverse oligonucleotide base pairing system is shown in Table 1: Table 1. Forward and Reverse Oligonucleotide Base Pairing System

[0038] sgRNA double-strand construction procedure: 37℃ for 30 min; 95℃ for 5 min; 95-85℃ for 10 s (temperature change rate, decreasing by 2℃ per second); 25℃ for 5 s (temperature change rate, decreasing by 0.1℃ per second); 12℃ to infinity. The sgRNA double-stranded product was stored at -20℃.

[0039] 3. Construction of sgRNA oligonucleotide plasmid: To clone sgRNA into the pGL3-gRNA-mCherry vector, the vector was first linearized, and then two sgRNA double strands were ligated into the linearized pGL3-gRNA-mCherry vector using T4 ligase to obtain pGL3-CD30gRNA1-mCherry plasmid and pGL3-CD30gRNA2-mCherry plasmid.

[0040] The linearization system of pGL3-gRNA-mCherry vector is shown in Table 2: Table 2 Linearization system of pGL3-gRNA-mCherry vector

[0041] The enzyme was digested at 37℃ for 2 hours. After digestion, 10 μL of 6× DNA loading buffer was added to the digested product and subjected to 1% agarose gel electrophoresis. The linearized vector was recovered using a gel recovery kit (Tiangen).

[0042] The sgRNA-linearized vector ligation system is shown in Table 3: Table 3. sgRNA-linearized vector ligation system

[0043] Incubate at 16℃ for 2 hours.

[0044] Linkage product transformation: (1) Take 10 μL of the ligation product and add it to 50 μL of DH5α competent cells. Place on ice for 30 min. (2) Heat shock at 45℃ for 30 seconds; (3) Place on ice for 3 minutes; (4) Add 800 μL of ampicillin-free liquid LB medium and shake on a shaker at 37°C for 1 h; (5) Spread 100 μL of bacterial culture onto a solid LB agar plate containing ampicillin and incubate at 37°C for 15 h. (5) Pick a single clone and place it in 30 ml of liquid LB containing ampicillin. Incubate in a shaker at 37°C for 15 h. Extract the plasmid using an endotoxin-free plasmid extraction kit (Tiangen) and perform Sanger sequencing.

[0045] 4. Transfection of 293T cells with multiple plasmid combinations to verify sgRNA cleavage efficiency. The pGL3-CD30 gRNA1 / 2-mCherry plasmid and the PX459 vector (as shown in the image) were used. Figure 3 (as shown), pcWXL-EG-CD30-FP vector (spectrum as shown) Figure 4 As shown), according to the instructions of Lipofectamine 3000, it was transfected into 293T cells. Among them, the PX459 vector was kindly provided by Professor Li Juan's laboratory at Sichuan University. Reference: Genome engineering using the CRISPR-Cas9 system. Ran FA, Hsu PD, Wright J, Agarwala V, Scott DA, Zhang F. Nat Protoc. 2013 Nov;8(11):2281-308; The pcWXL-EG-CD30-FP plasmid was obtained by modifying the pcDNA3.1(+) vector. First, the pcDNA3.1(+) plasmid was digested with the restriction endonuclease BamHI. After recovering the digestion product, the pcDNA3.1(+) plasmid was then... Figure 4The expression elements were constructed into the pcDNA3.1(+) vector via homologous recombination. The pcDNA3.1(+) vector was purchased from Beijing Qingke Biotechnology Co., Ltd. (Reference: Hou L, Hou J, Yao J, Zhou Z. Effects of osteoprotegerin from transfection of pcDNA3.1(+) / chOPG on bioactivity of chicken osteoclasts. Acta Vet Scand. 2011 Mar 24;53(1):21.)

[0046] Plasmid transfection system: (1) Take 3 μL of Lipofectamine 3000 transfection reagent and add it to 50 μL of OPTI-MEM medium, then mix well; (2) Take 1 μg of pGL3-CD30 gRNA-mCherry plasmid (pGL3-CD30 gRNA1-mCherry or pGL3-CD30 gRNA2-mCherry or a combination of two plasmids), PX459 vector, and pcWXL-EG-CD30-FP vector and add them to 50 μL of OPTI-MEM medium; after mixing, add them to the transfection reagent diluted in (1), mix well, and let stand at room temperature for 10 min; (3) Add the DNA-transfection reagent mixture to 293T cells and incubate at 37°C for 48 hours.

[0047] 5. Observe the transfected cells using a fluorescence microscope. Using EGFP fluorescent labeling on the pcWXL-EG-CD30-FP vector, the cleavage efficiency of sgRNA can be directly, conveniently, and accurately assessed (fluorescence results are shown in the figure). Figure 5 (As shown in the figure). From the above experimental results, it can be seen that green fluorescence can be observed in all three sets of results, that is, sgRNA1, sgRNA2 and sgRNA combination can all achieve cleavage and targeting effects, but obviously the green fluorescence efficiency is higher when sgRNA combination is effective, indicating that sgRNA combination has the highest cleavage efficiency.

[0048] Example 2: Constructing a knockout cell line using sgRNA combination targeting the chicken CD30 gene This embodiment provides a method for constructing a chicken CD30 gene knockout cell line, as detailed below: 1. Transfecting DF-1 cells to prepare CD30 - / - DF-1 cell line The pGL3-CD30 gRNA1-mCherry plasmid, pGL3-CD30 gRNA2-mCherry plasmid, PX459 vector, and CD30 donor-EGFP vector (as shown in the image) were used. Figure 6 (as shown), CD30 donor-mCherry vector (pattern as shown) Figure 7 As shown in the diagram, Lipofectamine 3000 was transfected into DF-1 cells according to the manufacturer's instructions. The nucleotide sequences of the upstream (LA) and downstream (RA) homologous arms are shown in SEQ ID NO:3-4, and the nucleotide sequences of the nucleic acid constructs hPGK-EGFP-T2A-PuroR and hPGK-mCherry-T2A-PuroR are shown in SEQ ID NO:5-6, respectively.

[0049] Plasmid transfection system: (1) Take 3 μL of Lipofectamine 3000 transfection reagent and add it to 50 μL of OPTI-MEM medium, then mix well; (2) Take 1 μg of pGL3-CD30 gRNA1-mCherry plasmid, pGL3-CD30 gRNA2-mCherry plasmid, PX459 vector, CD30 donor-EGFP vector, and CD30 donor-mCherry vector and add them to 50 μl of OPTI-MEM medium; after mixing, add them to the transfection reagent diluted in (1), mix well, and let stand at room temperature for 10 min; (3) Add the DNA-transfection reagent mixture to DF-1 cells and culture them in a cell culture incubator at 37°C for 1 week.

[0050] 2. Successfully transfected cells were sorted using flow cytometry. Transfected and successfully edited DF-1 cells were sorted by flow cytometry using EGFP and mCherry fluorescent labels on the CD30 donor vector.

[0051] (1) Collect cells at 1000 rpm for 5 minutes; (2) After washing twice with PBS, add 1 ml of DMEM medium containing 10% fetal bovine serum and 1% penicillin antibiotics to the cell pellet and gently pipette to mix the cells. (3) The cells were filtered through a 40 μM cell filter into a 5 ml flow cytometer tube; (4) Take a new flow cytometry tube and add 1 ml of DMEM medium containing 10% fetal bovine serum and 1% penicillin-dextrin antibiotics; (5) DF-1 cells (CD30) containing EGFP and mCherry from (3) were analyzed by flow cytometry.- / - DF-1) is sorted into (4); (6) Take CD30 from (5) - / - DF-1 cells were transferred to cell culture dishes for further culture (cell diagram shown). Figure 8 (As shown).

[0052] Example 3: Effect of sgRNA combination on CD30 expression level 1. Collect DF-1 and CD30 - / - DF-1 cell samples.

[0053] 2. Collect RNA from the cells in step 1 and reverse transcribe it to obtain cDNA. Use β-actin expression level as an internal control and employ 2... -ΔΔCt The relative expression level of CD30 was calculated using this method.

[0054] The CD30 fluorescence quantitative primer sequence is as follows: F: 5'-CCTTTCAAGTGCCACAACCG-3'; R: 5'-GGCGTTTTGAAGACCCCAC-3'.

[0055] The results are as follows Figure 9 As shown, wild-type DF-1 cells and CD30 - / - The significant difference in CD30 expression in DF-1 cells indicates that the expression of the CD30 gene was blocked by sgRNA, and the knockout was successful.

[0056] Although the present invention has been described in detail above with general descriptions and specific embodiments, modifications or improvements can be made to it, which will be obvious to those skilled in the art. Therefore, all such modifications or improvements made without departing from the spirit of the present invention fall within the scope of protection claimed by the present invention.

Claims

1. An sgRNA targeting the chicken CD30 gene, characterized in that, It is either sgRNA1 or sgRNA2; The nucleotide sequence of the sgRNA1 action site is: 5'-AGAGACCAAGAGAAGGCAGA-3'; The nucleotide sequence of the sgRNA2 action site is: 5'-AGGTCTTGTTTTCTGGGCAG-3'.

2. A combination of sgRNAs targeting the chicken CD30 gene, characterized in that, It consists of sgRNA1 and sgRNA2; The sgRNA1 and sgRNA2 are the same as those described in claim 1.

3. A nucleic acid construct, characterized in that, The nucleic acid construct comprises a nucleic acid sequence encoding the sgRNA of claim 1 or the combination of sgRNAs of claim 2.

4. The nucleic acid construct according to claim 3, characterized in that, The nucleic acid construct also contains a nucleic acid sequence encoding the Cas protein.

5. A biomaterial, characterized in that, The biomaterial comprises the sgRNA of claim 1 or the combination of sgRNAs of claim 2, or comprises the nucleic acid construct of claim 3 or 4; The biological materials are expression cassettes, transposons, plasmid vectors, viral vectors, engineered bacteria, or transgenic cell lines.

6. A host cell, characterized in that, The host cell contains the sgRNA of claim 1 or the combination of sgRNAs of claim 2, or contains the nucleic acid construct of claim 3 or 4; The host cell is a chicken-derived cell, preferably the chicken fibroblast cell line DF-1.

7. A method for editing the chicken CD30 gene in vitro, characterized in that, This includes introducing the sgRNA of claim 1 or the sgRNA of claim 2, or the nucleic acid construct of claim 3 or 4, into cells; The editing resulted in a decrease in the expression level or functional activity of the CD30 protein encoded by the chicken CD30 gene.

8. The use of the sgRNA of claim 1 or the sgRNA combination of claim 2, or the nucleic acid construct of claim 3 or 4, or the biological material of claim 5 or the host cell of claim 6 in the preparation of cell models or animal models for studying the function of the chicken CD30 gene.

9. A kit for editing the chicken CD30 gene, characterized in that, It comprises the sgRNA of claim 1 or the combination of sgRNAs of claim 2, or the nucleic acid construct of claim 3 or 4.