Nucleic acid nanostructure-based mRNA delivery system as well as preparation method and application thereof

By utilizing a nucleic acid nanostructure-based mRNA delivery system, which employs the base-complementary self-assembly of mRNA scaffold chains and RNA staple chains, combined with lipid-nucleic acid conjugates and auxiliary lipids, the system addresses the limitations of protein expression controllability and safety in traditional mRNA delivery systems, achieving efficient and safe mRNA delivery and tumor treatment.

CN121987828APending Publication Date: 2026-05-08THE NAT CENT FOR NANOSCI & TECH NCNST OF CHINA
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202610142422.5
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-02-02
Publication Date
2026-05-08

AI Technical Summary

Technical Problem

Existing mRNA delivery systems have shortcomings in terms of protein expression controllability and safety, which makes their therapeutic effects dependent on the delivery efficiency of the vector, making it difficult to achieve sustained and controllable protein expression and low side effects.

Method used

A nucleic acid nanostructure-based mRNA delivery system is employed, which utilizes the base-complementary self-assembly of mRNA scaffold chains and RNA staple chains, combined with lipid-nucleic acid conjugate chains and auxiliary lipids, to form a nucleic acid nanostructure that protects and delivers mRNA, thereby achieving precise delivery and expression of proteins encoding functional proteins.

Benefits of technology

It significantly improved mRNA protein expression and tumor treatment efficacy, enhanced mRNA targeting and delivery efficiency, and reduced side effects.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121987828A_ABST
    Figure CN121987828A_ABST
Patent Text Reader

Abstract

The invention discloses an mRNA (messenger ribonucleic acid) delivery system based on a nucleic acid nanostructure as well as a preparation method and application of the mRNA delivery system. The mRNA delivery system comprises an mRNA scaffold chain, an RNA staple chain, a lipid-nucleic acid coupling chain and an auxiliary lipid; the mRNA scaffold chain comprises a nucleic acid sequence for coding target protein mRNA; the mRNA scaffold chain and the RNA staple chain are self-assembled through complementary base pairing to form a nucleic acid nanostructure; the lipid-nucleic acid coupling chain comprises a lipid molecule and a nucleic acid chain coupled with the lipid molecule. According to the invention, mRNA molecules of coding functional protein are used as scaffold chains to be accurately integrated into the nucleic acid nanostructure, so that the purpose of protecting and delivering mRNA is achieved, and the effect of accurately regulating and controlling the expression of target protein is achieved.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biomedical technology and relates to an mRNA delivery system based on nucleic acid nanostructures, its preparation method and application. Background Technology

[0002] Messenger RNA (mRNA) therapy has shown broad application prospects in various fields such as infectious disease vaccines, tumor immunotherapy, protein replacement therapy, and gene editing due to its ability to efficiently express specific proteins in vivo and its advantages such as low risk of gene integration, high safety, and ease of large-scale preparation. However, as a biomolecule with a strong negative charge, mRNA suffers from problems such as difficulty in penetrating cell membranes and easy degradation. Its in vivo delivery usually relies on a carrier system, making its therapeutic effect highly dependent on the delivery efficiency of the delivery carrier. Currently, developing efficient and safe delivery systems to achieve sustained and controllable protein expression with low side effects remains a significant challenge in the field of mRNA delivery.

[0003] Benefiting from the inherent biomolecular properties of nucleic acids, nucleic acid nanostructures possess unique advantages over other nanomaterials, including superior biomolecular recognition capabilities, sequence programmability, spatial addressability, and biocompatibility. Their preparation methods are simple and universal, with high production efficiency, and multiple functional components can be efficiently integrated through rational design. These characteristics make them promising for applications in biomedical fields such as biosensing, bioimaging, and drug delivery. Drug delivery systems based on nucleic acid nanostructures have been developed for in vivo delivery of small molecule drugs, protein drugs, and some nucleic acid drugs, but their application in mRNA delivery still requires further exploration.

[0004] In summary, leveraging the programmability, spatial addressability, and good biocompatibility of nucleic acid nanostructures, developing a nucleic acid nanostructure based on the precise encoding of functional proteins by mRNA molecules for the safe and efficient delivery of mRNA and the realization of in vivo expression and regulation is of great research significance. Summary of the Invention

[0005] To address the shortcomings of existing mRNA delivery technologies in terms of protein expression controllability and safety, this invention provides an mRNA delivery system based on nucleic acid nanostructures, its preparation method, and its applications. The mRNA delivery system is formed by the self-assembly of mRNA scaffold chains and RNA staple chains through complementary base pairing. This system precisely integrates mRNA molecules encoding functional proteins into nucleic acid nanostructures as scaffold chains, achieving both mRNA protection and delivery, and significantly improving mRNA protein expression and tumor treatment efficacy.

[0006] To achieve this objective, the present invention adopts the following technical solution:

[0007] In a first aspect, the present invention provides an mRNA delivery system based on nucleic acid nanostructures, the mRNA delivery system comprising an mRNA scaffold chain, an RNA staple chain, a lipid-nucleic acid conjugate chain, and an auxiliary lipid;

[0008] The mRNA scaffolding chain includes a nucleic acid sequence encoding the target protein mRNA;

[0009] The mRNA scaffolding chain and the RNA staple chain self-assemble into a nucleic acid nanostructure through complementary base pairing.

[0010] The lipid-nucleic acid conjugate chain includes a lipid molecule and a nucleic acid chain conjugated thereto.

[0011] In this invention, through rational sequence and structural design, the nucleic acid sequence of a functional mRNA molecule is used as a scaffold chain and self-assembled with an RNA staple chain through base complementary pairing to form a nucleic acid nanostructure. The nucleic acid nanostructure not only serves as a drug delivery system to deliver mRNA encoding functional proteins into cells, but also functions as the drug itself to guide protein expression.

[0012] Preferably, the mRNA scaffolding chain comprises mRNA encoding EGFP fluorescent protein, and the nucleic acid sequence of the RNA staple chain comprises the sequences shown in SEQ ID NO. 9 to SEQ ID NO. 24; or,

[0013] The mRNA scaffolding chain comprises mRNA encoding both mCherry and EGFP fluorescent proteins, and the nucleic acid sequence of the RNA staple chain comprises the sequences shown in SEQ ID NO. 25 to SEQ ID NO. 45; or,

[0014] The mRNA scaffolding chain comprises mRNA encoding the p53 protein, and the nucleic acid sequence of the RNA staple chain comprises the sequences shown in SEQ ID NO.46 to SEQ ID NO.73; or,

[0015] The mRNA scaffold chain includes mRNA encoding ovalbumin, and the nucleic acid sequence of the RNA staple chain includes the sequences shown in SEQ ID NO.74 to SEQ ID NO.101.

[0016] SEQ ID NO.9:

[0017] UGUGUGUGUGUGUGUGUGUGUUUUUGGCAGCUUGCCGGUGGGGUGGUCACGAGGGUUUUUGAGAGGAGAGAGAGAGAG。

[0018] SEQ ID NO.10:

[0019] UGUGUGUGUGUGUGUGUGUGUGUUUUUGCCGUCGUCCUUGAGAACUUCACCUCGGCUUUUGAGAGGAGAGAGAGAGAGA.

[0020] SEQ ID NO.11:

[0021] UGUGUGUGUGUGUGUGUGUGUGUUUGUCGGCCAUGAUAUAAAGUUCACCUUGAUGUUUUGAGAGGAGAGAGAGAGAGA.

[0022] SEQ ID NO.12:

[0023] UGUGUGUGUGUGUGUGUGUGUUUUUGCGGACUGGGUGCUCCGCGCUUCUCGUUGGUUUUUGAGAGGAGAGAGAGAGAG。

[0024] SEQ ID NO.13:

[0025] UGUGUGUGUGUGUGUGUGUGUUUUGCAGAUGAACUUCACAGCUCGACCAGGAUUUUUGAGAGGAGAGAGAGAGAGA.

[0026] SEQ ID NO.14:

[0027] UGUGUGUGUGUGUGUGUGUGUUUUGAAGAUGGUGCGCCUCUGCACGCCCGUAGGUCUUUUUGAGGAGAGAGAGAGAGAGA.

[0028] SEQ ID NO.15:

[0029] UGUGUGUGUGUGUGUGUGUGUUUUACGUUGUGGCUGUUGCCAGGGUGUCGCCCCUUUUUUGAGAGGAGAGAGAGAGA.

[0030] SEQ ID NO.16:

[0031] UGUGUGUGUGUGUGUGUGUGUUUUGGUAGUGGUUGUCGGGUUGUGGCGGAUCUUUUUUGAGAGGAGAGAGAGAGAGA.

[0032] SEQ ID NO.17:

[0033] UGUGUGUGUGUGUGUGUGUGUUUUGGUCAGCUUGCCGUAGUAGCGGCUGAAGCAUUUUUGAGGAGAGAGAGAGAGAGA.

[0034] SEQ ID NO.18:

[0035] UGUGUGUGUGUGUGUGUGUGUUUUUGGACGUAGCCUUCGAGCGAUGCGGUUCUUUUUGAGAGGAGAGAGAGAGAGA.

[0036] SEQ ID NO.19:

[0037] UGUGUGUGUGUGUGUGUGUGUUUUAUGUUGUACUCCAGCUCGCUGCCGUCCGUCCUCGAUUUUGAGAGGAGAGAGAGAGAGA.

[0038] SEQ ID NO.20:

[0039] UGUGUGUGUGUGUGUGUGUGUUUUUCAGCAGCACGGGGCCGGCGGUCACGAACUCUUUUUGAGAGGAGAGAGAGAGAG。

[0040] SEQ ID NO.21:

[0041] UGUGUGUGUGUGUGUGUGUGUUUGUGGCAUGCCCUCGACGCUGACUUGUGGUUUUGAGGAGAGAGAGAGAGA.

[0042] SEQ ID NO.22:

[0043] UGUGUGUGUGUGUGUGUGUGUUUUGCAUGGCGGACUGAGCUUCAUGUGGUCGGUUUUUGAGGAGAGAGAGAGAGA.

[0044] SEQ ID NO.23:

[0045] UGUGUGUGUGUGUGUGUGUGUUUGUCCCCAGGAUGUUGAGUCGAUGCCCUUUUUUGAGAGGAGAGAGAGAGAGA.

[0046] SEQ ID NO.24:

[0047] UGUGUGUGUGUGUGUGUGUGUUUUUUCGCCGAUGGGGGUGUGGUCGGCGAGCUGCUUUUUGAGAGGAGAGAGAGAGAG。

[0048] SEQ ID NO.25:

[0049] UGUGUGUGUGUGUGUGUGUGUUUUCCUGGGUCACGGUCGCUUCACCUUGUAGAUGCUCUGCUUGAUCUCGCCCUUUGAGAGGAGAGAGAGAGAG。

[0050] SEQ ID NO.26:

[0051] UGUGUGUGUGUGUGUGUGUGUUUCCUCAGCGUCGUAGUGGGCGCGUUCGUACUGUCUACAGCUCGUCCAUGUUUGAGAGGAGAGAGAGAGAG。

[0052] SEQ ID NO.27:

[0053] UGUGUGUGUGUGUGUGUGUGUUUCGCCGGUGGAGUGGGCAGGGAGGAUUUGAGAGGAGAGAGAGAGAG。

[0054] SEQ ID NO.28:

[0055] ACUCGCCGUCCUCGGCCCUCGCCGCCGUCCUUCAGCUUCAGUUUGAGAGGAGAGAGAGAGAGAG。

[0056] SEQ ID NO.29:

[0057] UGUGUGUGUGUGUGUGUGUGUUUGAACAGCUCCUCGCCACGUCGCCGUCCAGCUCGGUCACGAGGGUGGGCCAUUUGAGAGGAGAGAGAGAGAG。

[0058] SEQ ID NO.30:

[0059] UGUGUGUGUGUGUGUGUGUGUUUGGGUAGCGGCUGAAGCACUCGAACUUCACCUCGGGAUGCCCUCUCAGCUCUUUGAGAGGAGAGAGAGAGAG。

[0060] SEQ ID NO.31:

[0061] UGUGUGUGUGUGUGUGUGUGUUAUGCGGUUCACCAGACCACCCCGGUUUGAGAGGAGAGAGAGAGAGA.

[0062] SEQ ID NO.32:

[0063] ACCAGGAUGGGCGGUGUCGCCCUGCACGCCGUAGGUCAGGGUUUGAGAGGAGAGAGAGAGAGAG。

[0064] SEQ ID NO.33:

[0065] UGUGUGUGUGUGUGUGUGUGUUUUGUAGUUGUACUCCAGUUCUUCUGCUUGUCGGAGUGGUUGUGGCGGCAGCAUUUGAGAGGAGAGAGAGAGAG。

[0066] SEQ ID NO.34:

[0067] UGUGUGUGUGUGUGUGUGUGUUUUUGGGGUCUUUGCUCACCGACGGCAUGGGAAUUCUCUUUGUUCGAAGGUUUGAGAGGAGAGAGAGAGAG。

[0068] SEQ ID NO.35:

[0069] UGUGUGUGUGUGUGUGUGUGUUUGCGGCGCUGCUUGAGUUGUGGCUGUUUGAGAGGAGAGAGAGAGAG。

[0070] SEQ ID NO.36:

[0071] CAUGAUAUAGACAGGUCUUCUGGGCGGACUGGGUGCUCAGGUUUGAGAGGAGAGAGAGAGAGAG。

[0072] SEQ ID NO.37:

[0073] GGCACGGGCAGCUUGUGAACUUGUGGCCGUUUCUUGCUCACCAUGCCUUUAUCUGAGUCCGGACUUGCACGAUGGUGUAGUCCCUUGUAGGUGGUCUU。

[0074] SEQ ID NO.38:

[0075] UGUGUGUGUGUGUGUGUGUGUUUUGUUGUGGGAGGUGAUAACCCUCGCCGGACACGUUUUGAGAGGAGAGAGAGAGAGAG。

[0076] SEQ ID NO.39:

[0077] UGUGUGUGUGUGUGUGUGUGUUUGGUGCAGAUGAACUUCAGGGUCAGCUUGAAGUAGGCGCCGGGCAGCUGCACGGGCUUCUUUUGAGAGGAGAGAGAGAGAGAG。

[0078] SEQ ID NO.40:

[0079] CACGGGGCCGUCGCCAAGUUCACCUUGAUGCCGCUUGUGCCCCAGGAUAACCGUCCUCCUUGAAGUCCGCGGGUCUUGUAGUUGCUGCUUCAUGUGGU。

[0080] SEQ ID NO.41:

[0081] UGUGUGUGUGUGUGUGUGUGUUUUCGUCGUCCUUGAAGAUAGUUGUGGCGGAUCUUUUUUGAGAGGAGAGAGAGAGAGAG。

[0082] SEQ ID NO.42:

[0083] UGUGUGUGUGUGUGUGUGUGUUUGGUGUUCUGCUGGUAGUGGUCGGCGAGAAAGCCUUCGGGCAUGGCGGACUUGAGAAGUUUGAGAGGAGAGAGAGAGAG。

[0084] SEQ ID NO.43:

[0085] UCAGGGCGCCGUCCUGAAGUUGGUGCCGCGCAACCACGCCGCCGUCCUAAAAGUCGGACAUCUUCUACGAAGCUUGAGCUCGAAUGUGAUCGCGCUUC。

[0086] SEQ ID NO.44:

[0087] UGUGUGUGUGUGUGUGUGUGUUUUCUGAGUACUUGUACUUCGGGGCCGUCGAGGUUUUGAGGAGAGAGAGAGAGAGAGA.

[0088] SEQ ID NO.45:

[0089] UGUGUGUGUGUGUGUGUGUGUUUUACAUCCGCUCGGAGGAGGCCUCCCAGCAAAUCCCGGCGGCGGUCACGAACUCCAGCAGUUUGAGAGGAGAGAGAGAGAG。

[0090] SEQ ID NO.46:

[0091] UGUGUGUGUGUGUGUGUGUGUUUUGAACCAUUGUUUAGGGAGCUUCAUCUGGGUUUUGAGAGGAGAGAGAGAGAGA.

[0092] SEQ ID NO.47:

[0093] UGUGUGUGUGUGUGUGUGUGUUUUGCCCUGGUAGGUUUUUGCAAGAAGCCCAGAUUUUGAGGAGAGAGAGAGAGA.

[0094] SEQ ID NO.48:

[0095] UGUGUGUGUGUGUGUGUGUGUUUUUCGGGUGCCGGGCGGGACUGCUUGUAGAUGGUUUUUGAGAGGAGAGAGAGAGAG。

[0096] SEQ ID NO.49:

[0097] UGUGUGUGUGUGUGUGUGUGUUUUCCAAAUACUCCACACACUAUGUCGAAUUUUGAGAGGAGAGAGAGAGAGA.

[0098] SEQ ID NO.50:

[0099] UGUGUGUGUGUGUGUGUGUGUUUUCAGUGUGAUGGUCGUCCCAGUAGAUUAUUUUUGAGAGGAGAGAGAGAGAGA.

[0100] SEQ ID NO.51:

[0101] UGUGUGUGUGUGUGUGUGUGUUUUAGUGCUCGCUUAGUGGCUGGGAGAGGAGCUUUUUGAGAGGAGAGAGAGAGA.

[0102] SEQ ID NO.52:

[0103] UGUGUGUGUGUGUGUGUGUGUUUUUGCUCUUCCCCAGCCUGUGGCUGGAGUGAGCUUUUUGAGAGGAGAGAGAGAGAG。

[0104] SEQ ID NO.53:

[0105] UGUGUGUGUGUGUGUGUGUGUUUUUAUCGUCCGGGGACAGAAUGUUUCCUGACUCUUUUUGAGAGGAGAGAGAGAGAGAG。

[0106] SEQ ID NO.54:

[0107] UGUGUGUGUGUGUGUGUGUGUUUUUUGGGAAGGGACAGAACAGCCUCUGGCAUUCUUUUUGAGAGGAGAGAGAGAGAGAG。

[0108] SEQ ID NO.55:

[0109] UGUGUGUGUGUGUGUGUGUGUGUUUUGUGUGGAAUCAACCCUUGGCUGUCCCAGAUUUUGAGGAGAGAGAGAGAGAGA.

[0110] SEQ ID NO.56:

[0111] UGUGUGUGUGUGUGUGUGUGUUUUCAAAUUUCCUUCCACUCCGUCAUGUGCUGUUUUUGAGAGGAGAGAGAGAGAGA.

[0112] SEQ ID NO.57:

[0113] UGUGUGUGUGUGUGUGUGUGUUUUUAGGAUGGGCCUCCGGGCUCAUAGGGCACCAUUUUUGAGAGGAGAGAGAGAGAG。

[0114] SEQ ID NO.58:

[0115] UGUGUGUGUGUGUGUGUGUGUUUUUUCCCUGGGGGCAGCUCACCUCAAAGCUGUUUUUUUGAGAGGAGAGAGAGAGAG。

[0116] SEQ ID NO.59:

[0117] UGUGUGUGUGUGUGUGUGUGUUUUGGCAUCCUUGAGUUCAGUGGUUUCUUUUUUUUUGAGAGGAGAGAGAGAGAGAGA.

[0118] SEQ ID NO.60:

[0119] UGUGUGUGUGUGUGUGUGUGUUUUUAUCAAAUCAUCCCAUUGGGGCCACGGGGGAUUUUUGAGAGGAGAGAGAGAGAG。

[0120] SEQ ID NO.61:

[0121] UGUGUGUGUGUGUGUGUGUGUUUUUAUGACAGGGGCCAGGACGUGCAAGUCACAGUUUUUGAGAGGAGAGAGAGAGAG。

[0122] SEQ ID NO.62:

[0123] UGUGUGUGUGUGUGUGUGUGUUUUUCAGCUGCACAGGGCAGCAGCGCCUCACAACUUUUUGAGAGGAGAGAGAGAGAG。

[0124] SEQ ID NO.63:

[0125] UGUGUGUGUGUGUGUGUGUGUUUUCGGAUAAGAUGCUGAGAGCCAACCUCAGGCUUUUUGAGAGGAGAGAGAGAGA.

[0126] SEQ ID NO.64:

[0127] UGUGUGUGUGUGUGUGUGUGUUUUUUCAUGCCCGCCCAUGCGACAGGCACAAACACUUUUUGAGAGGAGAGAGAGAGAG。

[0128] SEQ ID NO.65:

[0129] UGUGUGUGUGUGUGUGUGUGUGUUUGUGUGAGGCUCCCCGAAAUAUUCUCUCCACUUUUUGAGGAGAGAGAGAGAGAGA.

[0130] SEQ ID NO.66:

[0131] UGUGUGUGUGUGUGUGUGUGUUUUAAGGCCUCAUUCACCGGGAGGUAGACUGAUUUUGAGGAGAGAGAGAGAGAGA.

[0132] SEQ ID NO.67:

[0133] UGUGUGUGUGUGUGUGUGUGUUUCUUGGGACGGCAAGGUGUUUUCAGGAAGUAUUUUUGAGAGGAGAGAGAGAGA.

[0134] SEQ ID NO.68:

[0135] UGUGUGUGUGUGUGUGUGUGUUUUUUGGGGGCUGGUGCAGGAGGAGCUGCUGGUGCUUUUUGAGAGGAGAGAGAGAGAG。

[0136] SEQ ID NO.69:

[0137] UGUGUGUGUGUGUGUGUGUGUUUUUGUCUUGGCCAGUUGGUUGAGGGCAGGGAGUUUUUGAGAGGAGAGAGAGAGAG。

[0138] SEQ ID NO.70:

[0139] UGUGUGUGUGUGUGUGUGUGUUUGAGGGGCCAGACCAUAGCGCUCAUGGUGGUGUUUUGAGGAGAGAGAGAGAGAGA.

[0140] SEQ ID NO.71:

[0141] UGUGUGUGUGUGUGUGUGUGUUUUUGGAACUGUUACACAUGGUGGUACAGUCUUUUUGAGAGGAGAGAGAGAGAG。

[0142] SEQ ID NO.72:

[0143] UGUGUGUGUGUGUGUGUGUGUUUUUUUUCUGCGGAGAUUCCGCCGGUCUCUCCCAUUUUUGAGAGGAGAGAGAGAGAGAG。

[0144] SEQ ID NO.73:

[0145] UGUGUGUGUGUGUGUGUGUGUUUUUCUCGGAACAUCUCGACACGGAUCUGAAGGGUUUUUGAGAGGAGAGAGAGAGAGAG。

[0146] SEQ ID NO.74:

[0147] UGUGUGUGUGUGUGUGUGUGUUUUCUUAUUUAUCUGUGUUCCUGGAAGUUUAUCUUUUGAGAGGAGAGAGAGAGAGAGA.

[0148] SEQ ID NO.75:

[0149] UGUGUGUGUGUGUGUGUGUGUUUUGUCUACUGGCAAGGCGGAUUGGGUAUCUCUUUUUGAGAGGAGAGAGAGAGAGA.

[0150] SEQ ID NO.76:

[0151] UGUGUGUGUGUGUGUGUGUGUUUUUUUUGUCUGACUUUCUGGCUGAAGGACAUUUUUUUUUGAGAGGAGAGAGAGAGAGAGAGAGA.

[0152] SEQ ID NO.77:

[0153] UGUGUGUGUGUGUGUGUGUGUUUUUUGCUCAGUCACUCUGUACAUCAUCUGCACUUUUGAGAGGAGAGAGAGAGAGA.

[0154] SEQ ID NO.78:

[0155] UGUGUGUGUGUGUGUGUGUGUUUUCAAGGCCUGAGACUUCAAAGUUGAUUAACUUUUGAGAGGAGAGAGAGAGAGA.

[0156] SEQ ID NO.79:

[0157] UGUGUGUGUGUGUGUGUGUGUUUAUGCCCAUAGCCAUUUUGGCCUGAAGAGCUAUUUUGAGGAGAGAGAGAGAGAGA.

[0158] SEQ ID NO.80:

[0159] UGUGUGUGUGUGUGUGUGUGUUUUAGCAUCCACUCCAGCAGCCCUAAUUCUUUUUGAGAGGAGAGAGAGAGAGA.

[0160] SEQ ID NO.81:

[0161] UGUGUGUGUGUGUGUGUGUGUGUUUUCUGGUGCUGUCUUUUGACUUGAGCUCUUUUUUGAGGAGAGAGAGAGAGA.

[0162] SEQ ID NO.82:

[0163] UGUGUGUGUGUGUGUGUGUGUUUUGAACGAAUAAACAUCCAAUACUGUCUCCGAUUUUGAGAGGAGAGAGAGAGAGA.

[0164] SEQ ID NO.83:

[0165] UGUGUGUGUGUGUGUGUGUGUUUUCCCAGGAAUUGAUGAUGCAAGUAUUCUGGCUUUUUGAGAGGAGAGAGAGAGA.

[0166] SEQ ID NO.84:

[0167] UGUGUGUGUGUGUGUGUGUGUUUUAAAGGCAUUGCUUGUAGAAUCCACGGAGCUUUUUGAGAGGAGAGAGAGAGAGA.

[0168] SEQ ID NO.85:

[0169] UGUGUGUGUGUGUGUGUGUGUUUAUCAGGCAACAGCACUAAAUAAACCAAUCUUUUUGAGAGGAGAGAGAGAGAGAGA.

[0170] SEQ ID NO.86:

[0171] UGUGUGUGUGUGUGUGUGUGUUUUUAGACAGAUGUGAGGUGAGGUCAUUCAGUCAGUUUUUUUUGAGGAGAGAGAGAGAGA.

[0172] SEQ ID NO.87:

[0173] UGUGUGUGUGUGUGUGUGUGUUUUCUGCUGACCCUACCGGAGAUGCCAGACAUUUUUGAGAGGAGAGAGAGAGAGA.

[0174] SEQ ID NO.88:

[0175] UGUGUGUGUGUGUGUGUGUUUUCACCCAGGUAUACCAGUGCCACACUGAGCUUUUUGAGAGGAGAGAGAGAGAGA.

[0176] SEQ ID NO.89:

[0177] UGUGUGUGUGUGUGUGUGUGUGUUUUUUUGGUUGGUGAUUCAGUUCCUUCACACAUUUUGAGAGGAGAGAGAGAGAGA.

[0178] SEQ ID NO.90:

[0179] UGUGUGUGUGUGUGUGUGUGUGUUUUCUCUCUGGCUUGAUCGAACCAUUGCAGUUUUUUUUUGAGAGGAGAGAGAGAGAGAGA.

[0180] SEQ ID NO.91:

[0181] UGUGUGUGUGUGUGUGUGUGUUUUGUCUUCAUCCUUAAGCCAUUGAUGCCACAUUUUUGAGGAGAGAGAGAGAGA.

[0182] SEQ ID NO.92:

[0183] UGUGUGUGUGUGUGUGUGUGUUUUUAACAUGCUCAUUGUCAACAUUAGAACUGGUUUUUUGAGAGGAGAGAGAGAGAG。

[0184] SEQ ID NO.93:

[0185] UGUGUGUGUGUGUGUGUGUGUUUUGUAUUUUUCCUCCAUUCAGGCUCUGCUUUUUGAGAGGAGAGAGAGAGAGA.

[0186] SEQ ID NO.94:

[0187] UGUGUGUGUGUGUGUGUGUGUUUUCCUCUCUGCCUGCUUAUGUGCUUGUACAGUUUUUGAGAGGAGAGAGAGAGAGA.

[0188] SEQ ID NO.95:

[0189] UGUGUGUGUGUGUGUGUGUGUUUUGGCUAGAGCUGACAUGGGCAGUAGAGAUGUUUUUGAGGAGAGAGAGAGAGAGA.

[0190] SEQ ID NO.96:

[0191] UGUGUGUGUGUGUGUGUGUGUGUUUUGGUUGGAGGAUGUCUCGUGAACGUUUACAGAUUUUGAGAGGAGAGAGAGAGAGAGA.

[0192] SEQ ID NO.97:

[0193] UGUGUGUGUGUGUGUGUGUGUUUUGCAGCUGUUUGAAGCCAAGCCUCCUCUAUUUUUGAGAGGAGAGAGAGAGAGA.

[0194] SEQ ID NO.98:

[0195] UGUGUGUGUGUGUGUGUGUGUUUUGCUUUCCCCACAGACAAUGGCAUUAACCUUUUUGAGAGGAGAGAGAGAGAGA.

[0196] SEQ ID NO.99:

[0197] UGUGUGUGUGUGUGUGUGUGUUUUUCACUGGCAAAUGGAACUUCAUUUUCUCACAGAUUUUUGAGAGGAGAGAGAGAGAG。

[0198] SEQ ID NO.100:

[0199] UGUGUGUGUGUGUGUGUGUGUGUUUUUUCAUGCGAGGUAGUAGUCUUCCUCUUCCAUUUUUGAGAGGAGAGAGAGAGAGA.

[0200] SEQ ID NO.101:

[0201] UGUGUGUGUGUGUGUGUGUGUUUUAUUGAUUUCUGCAUGACAGCUUGAGAUAUCUUUUUGAGGAGAGAGAGAGAGAGA.

[0202] Preferably, the shape of the nucleic acid nanostructure includes any one or a combination of at least two of the following: square, rectangle, or triangle.

[0203] Preferably, the RNA staple chain contains a nucleic acid capture chain.

[0204] Preferably, the nucleic acid capture chain and the lipid-nucleic acid conjugate chain are linked by complementary base pairing.

[0205] In this invention, nucleic acid nanostructures specifically modify lipid molecules based on the base complementary pairing principle, and through hydrophobic interactions, auxiliary lipids with cell-targeting and endosome escape functions are grown in situ on their surface, improving the targeting and delivery efficiency of mRNA molecules delivered by the nucleic acid nanostructures. A schematic diagram of the principle is shown below. Figure 1 As shown.

[0206] Preferably, the 5' or 3' end of the lipid-nucleic acid conjugate chain has an HS-SH C6 modification, and its nucleic acid sequence includes the sequences shown in SEQ ID NO.102 and / or SEQ ID NO.103.

[0207] SEQ ID NO. 102: HS-SH C6-TTTTTCTCTCTCTCTCTCCTCTC.

[0208] SEQ ID NO. 103: CACACACACACACACACACATTTTT-C6 HS-SH.

[0209] Preferably, the lipids in the lipid-nucleic acid coupled chain include any one or a combination of at least two of 1,2-dioleoyl-SN-glycerol-3-phosphatidylethanolamine, distearate-phosphatidylethanolamine, dimyristoylphosphatidylethanolamine, or dipalmitoylphosphatidylethanolamine.

[0210] Preferably, the lipid-nucleic acid conjugate chain and the auxiliary lipid are bound to the nucleic acid nanostructure through hydrophobic interactions.

[0211] Preferably, the molar ratio of the nucleic acid capture chain to the lipid-nucleic acid conjugate chain is 1:(1.0~2.0), for example, it can be 1:1, 1:1.1, 1:1.2, 1:1.3, 1:1.4, 1:1.5, 1:1.6, 1:1.7, 1:1.8, 1:1.9 or 1:2.0, preferably 1:1.5.

[0212] Preferably, the molar ratio of the lipid-nucleic acid conjugate chain to the auxiliary lipid is 1:(25~500), for example, it can be 1:25, 1:50, 1:75, 1:100, 1:125, 1:150, 1:175, 1:200, 1:300, 1:400 or 1:500, preferably 1:100.

[0213] Preferably, the auxiliary lipids include any one or a combination of at least two of cationic lipids, neutral lipids, or polyethylene glycol-modified lipids.

[0214] In this invention, the auxiliary lipids can improve mRNA stability, endosome escape, cell-targeted delivery, and / or immune activation, thereby enhancing mRNA expression efficiency and therapeutic effect.

[0215] Preferably, the cationic lipid comprises any one or a combination of at least two of N-(2,3-dioleoxy)propyl-N,N,N-triethylammonium chloride, N-(2,3-dioleoxy)propyl-N,N,N-trimethylammonium chloride, or N-(1-(2,3-dioleoxy)propyl)-N-2-(sperminecarbamoyl)ethyl-N,N-dimethyltrifluoroacetate ammonium.

[0216] Preferably, the neutral lipid comprises any one or a combination of at least two of the following: 1,2-dioleoyl-SN-glycerol-3-phosphocholine, 1,2-distearyl-SN-glycerol-3-phosphocholine, 1,2-dipalmitoyl-SN-glycerol-3-phosphocholine, 1,2-distearyl-SN-glycerol-3-phosphoethanolamine, 1,2-dioleoyl-SN-glycerol-3-phosphoethanolamine, folic acid-modified 1,2-dioleoyl-SN-glycerol-3-phosphoethanolamine, or folic acid-modified 1,2-distearyl-SN-glycerol-3-phosphoethanolamine.

[0217] Preferably, the PEGylated lipids include 1,2-dimyristic-rac-glycerol-3-methoxy polyethylene glycol 2000 and / or polyethylene glycol-bistetradecylacetamide.

[0218] In this invention, auxiliary lipid molecules with endosome escape, cell targeting and / or immune activation functions are modified onto nucleic acid nanostructures, thereby enhancing the targeted delivery and / or immune activation effects of the nucleic acid nanostructures.

[0219] Preferably, the auxiliary lipid modification has a targeting ligand capable of recognizing cell surface receptors or an immune adjuvant capable of activating immune cells, including any one or a combination of at least two of folic acid, mannose, RGD peptide, lipopolysaccharide, R848 or CpG.

[0220] Preferably, the target mRNA molecule can encode any protein, such as a fluorescent tag protein (e.g., EGFP, mCherry protein), a tumor suppressor protein (e.g., p53 protein), a tumor-specific antigen (e.g., OVA protein), or other disease-related proteins (e.g., exogenous toxic proteins used to kill tumors).

[0221] In a second aspect, the present invention provides a method for preparing the mRNA delivery system based on nucleic acid nanostructures as described in the first aspect, the method comprising:

[0222] A target mRNA scaffold chain is prepared; an RNA staple chain is prepared; the mRNA scaffold chain and the corresponding RNA staple chain are annealed and assembled to form a nucleic acid nanostructure; a lipid-nucleic acid conjugate chain is prepared; the nucleic acid nanostructure and the lipid-nucleic acid conjugate chain are co-assembled, and then co-incubated with an auxiliary lipid to obtain the mRNA delivery system based on the nucleic acid nanostructure.

[0223] Preferably, the preparation of the nucleic acid nanostructure includes:

[0224] The mRNA scaffold strand encoding the target protein and the corresponding RNA staple strand were obtained by PCR amplification and in vitro transcription.

[0225] Preferably, the primer nucleic acid sequences for PCR amplification include the sequences shown in SEQ ID NO.1 to SEQ ID NO.8.

[0226] Among them, SEQ ID NO.1~SEQ ID NO.2 are primer pairs for preparing a transcription template encoding EGFP protein, SEQ ID NO.3~SEQ ID NO.4 are primer pairs for preparing a transcription template encoding EGFP+mCherry protein, SEQ ID NO.5~SEQ ID NO.6 are primer pairs for preparing a transcription template encoding p53 protein, and SEQ ID NO.7~SEQ ID NO.8 are primer pairs for preparing a transcription template encoding OVA protein.

[0227] SEQ ID NO.1 (Preparation of forward primers for transcribing EGFP protein):

[0228] TAATACGACTCACTATAGGGGCCACCATGGTGAGCAAGGGCGAGGA.

[0229] SEQ ID NO.2 (Preparation of reverse primers for transcribing templates encoding EGFP protein):

[0230] TTTTTTTTACTTGTACAGCTCGTCCA.

[0231] SEQ ID NO.3 (Preparation of forward primers for transcribing EGFP+mCherry protein):

[0232] TAATACGACTCACTATAGGGAGCCGCCACCATGGTGAGCA.

[0233] SEQ ID NO.4 (Preparation of reverse primers for transcribing EGFP+mCherry protein):

[0234] TTTTTTTTACACTGACAATTTCATCC.

[0235] SEQ ID NO.5 (Preparation of forward primers for transcribing the p53 protein):

[0236] TAATACGACTCACTATAGGGGCCACCATGGAGGAGCCGCAGTCAGA.

[0237] SEQ ID NO.6 (Preparation of reverse primers for transcribing templates encoding p53 protein):

[0238] TTTTTTTTCAGTCTGAGTCAGGCCCTT.

[0239] SEQ ID NO.7 (Preparation of forward primers for transcription template encoding OVA protein):

[0240] TAATACGACTCACTATAGGGGCCACCATGGGCTCCATCGGCGCAGC.

[0241] SEQ ID NO.8 (Preparation of reverse primer for transcription template encoding OVA protein):

[0242] TTTTTTTTAAGGGGAAACACATCTGC.

[0243] Preferably, the molar ratio of the mRNA scaffold chain to the RNA staple chain is 1:(1~20), for example, it can be 1:1, 1:5, 1:10, 1:15 or 1:20, preferably 1:10.

[0244] Preferably, the annealing assembly conditions are: holding at 63~67℃ (e.g., 63℃, 65℃ or 67℃) for 2~10 min (e.g., 2 min, 5 min or 10 min), and gradually cooling to 10~20℃ (e.g., 10℃, 15℃ or 20℃) within 1~4 h (e.g., 1 h, 1.5 h or 4 h).

[0245] Preferably, the preparation of the lipid-nucleic acid conjugate includes:

[0246] A click reaction was performed between a nucleic acid chain with a thiol group at the end and a lipid molecule modified with maleimide to obtain a lipid-nucleic acid coupled chain.

[0247] Preferably, the molar ratio of the nucleic acid chain with thiol groups at the ends to the maleimide-modified lipid molecules is 1:(5~40), for example, it can be 1:5, 1:10, 1:15, 1:20, 1:25, 1:30, 1:35 or 1:40, preferably 1:30.

[0248] Preferably, the reaction temperature of the click reaction is 20~40℃ (e.g., 20℃, 25℃, 30℃, 37℃ or 40℃, preferably 25℃), and the reaction time is 0.5~4 h (e.g., 0.5, 1, 1.5, 2, 2.5, 3, 3.5 or 4, preferably 3 h).

[0249] Preferably, the preparation method further includes hybridizing the nucleic acid nanostructure with a lipid-nucleic acid conjugate and incubating it with an auxiliary lipid to obtain a nucleic acid nanostructure-based mRNA delivery system.

[0250] Preferably, the molar ratio of the nucleic acid capture chain and the lipid-nucleic acid conjugate chain during hybridization is 1:(1~2), for example, it can be 1:1.0, 1:1.1, 1:1.2, 1:1.3, 1:1.4, 1:1.5, 1:1.6, 1:1.7, 1:1.8, 1:1.9 or 1:2.0, preferably 1:1.5.

[0251] Preferably, the hybridization conditions are: maintaining at 20-40°C (e.g., 20°C, 25°C, 30°C, 37°C, or 40°C) for 10-90 min (e.g., 10 min, 30 min, 50 min, 70 min, or 90 min), then cooling to 2-6°C (e.g., 2°C, 3°C, 4°C, 5°C, or 6°C), preferably maintaining at 37°C for 30 min, then cooling to 4°C.

[0252] Preferably, the molar ratio of the lipid-nucleic acid conjugate chain to the auxiliary lipid is 1:(25~500), for example, it can be 1:25, 1:50, 1:75, 1:100, 1:125, 1:150, 1:175, 1:200, 1:300, 1:400 or 1:500, preferably 1:100.

[0253] In this invention, the hybridization conditions between the nucleic acid capture chain and the lipid-nucleic acid conjugate chain on the nucleic acid nanostructure are specific processes. Maintaining the temperature at 37°C for 30 min allows the lipid-nucleic acid conjugate chain to be efficiently anchored on the nucleic acid nanostructure. If the temperature is below 37°C, the secondary structure of the capture chain and the lipid-nucleic acid conjugate chain cannot be opened, resulting in reduced hybridization efficiency. If the temperature is too high, it may cause the nucleic acid nanostructure to disassemble.

[0254] Preferably, the incubation conditions are 2-30°C (e.g., 2°C, 4°C, 10°C, 20°C, 25°C, or 30°C) for 10-90 min (e.g., 10 min, 30 min, 50 min, 70 min, or 90 min), followed by dialysis for 8-24 h (e.g., 8 h, 10 h, 20 h, or 24 h), preferably 4°C for 30 min, followed by dialysis for 18 h.

[0255] In this invention, molecules with cell-targeting and / or immune-activating functions are modified onto nucleic acid nanostructures, thereby enhancing the targeted delivery and / or immune-activating effects of the nucleic acid nanostructures.

[0256] Thirdly, the present invention provides the application of the nucleic acid nanostructure-based mRNA delivery system described in the first aspect in the preparation of tumor therapeutic drugs.

[0257] Preferably, the tumor includes any one or a combination of at least two of cervical cancer, breast cancer, ovarian cancer, prostate cancer, liver cancer, non-small cell carcinoma, skin cancer, or lung cancer.

[0258] Compared with the prior art, the present invention has the following beneficial effects:

[0259] (1) Excellent delivery efficiency: The nucleic acid nanostructure of the present invention co-assembles mRNA molecules encoding different functional proteins with their corresponding RNA staple chains to form a nucleic acid nanostructure with controllable morphology, realizing the controllable and precise loading of functional mRNA molecules; based on the principle of complementary base pairing, lipid molecules are specifically arranged at their surface sites, and molecules with endosome escape, tumor targeting or immune activation functions are modified on the surface of the nucleic acid nanostructure through hydrophobic interactions, thereby improving the efficiency of nucleic acid nanostructure in delivering mRNA and protein expression ability;

[0260] (2) Universality and programmability: The target mRNA molecule in the nucleic acid nanostructure of the present invention is arbitrary and can be flexibly adjusted according to the different lengths of the functional mRNA molecule to adapt to different treatment needs; the preparation method of mRNA molecule and RNA staple chain is simple and can be mass-produced through in vitro transcription reaction, and the coupling reaction does not involve complex organic synthesis; the preparation of nucleic acid nanostructure only requires a simple self-assembly process, and the functional components can be easily modified to the surface through hydrophobic interactions to achieve multimodal synergistic treatment;

[0261] (3) Good biocompatibility: The nucleic acid nanostructure of this invention serves as a template for in situ growth-aiding lipids, thereby reducing the amount of lipid molecules used compared to traditional lipid delivery carriers, thus reducing toxic side effects and immunogenicity in in vivo therapy, and providing an innovative solution for targeted protein expression in vivo. At the same time, its good biocompatibility has great potential in drug delivery and can be applied to a wider range of biological disease models. Attached Figure Description

[0262] Figure 1 A schematic diagram illustrating the construction method and working principle of an mRNA delivery system based on nucleic acid nanostructures;

[0263] Figure 2 Figure 1 shows the characterization results of lipid-encapsulated nucleic acid nanostructures, where figure 2a shows mRNA. EGFP and RO EGFP Figure b shows the agarose gel electrophoresis characterization; Figure 9 shows the RO... EGFP and RO EGFP @lipids' AFM characterization plot; Figure c shows RO. EGFP with RO EGFP The height analysis results of @lipids are shown in the figure.

[0264] Figure 3 Lipid-encapsulated nucleic acid nanostructures (RO) EGFP Image of transmission electron microscopy observation results (@lipids);

[0265] Figure 4 Figure showing the stability of lipid-encapsulated nucleic acid nanostructures in plasma, serum, and RNase A;

[0266] Figure 5 The graph shows the protein expression levels of nucleic acid nanostructures encapsulated with different lipid ratios in human embryonic kidney cells (HEK 293T). Figure a shows the fluorescence microscopy observation results of green fluorescent protein expression; Figure b shows the relative fluorescence intensity statistics analyzed by flow cytometry.

[0267] Figure 6 Triangular nucleic acid nanostructures (T-RO)EGFP+mCherry The characterization results are shown in the figures, where figure a is a schematic diagram of the triangular nucleic acid nanostructure design; figure b is the mRNA... EGFP+mCherry and T-RO EGFP+mCherry Figure c shows the agarose gel electrophoresis characterization; Figure c is the T-RO EGFP+mCherry AFM characterization diagram;

[0268] Figure 7 Figure 1 shows the results of the cell internalization efficiency of nucleic acid nanostructures detected by flow cytometry. Figure 2a shows the flow cytometry analysis results of the internalized nucleic acid nanostructures in HEK293T cells; Figure 3b shows the quantitative statistical graph of the average fluorescence intensity of the flow cytometry analysis.

[0269] Figure 8 Figure showing the results of IFN-α cytokine level analysis after lipid-encapsulated nucleic acid nanostructures were injected into mice via the tail vein;

[0270] Figure 9 The image shows the expression results of green fluorescent protein in HEK 293T cells of lipid-encapsulated nucleic acid nanostructures as detected by fluorescence microscopy.

[0271] Figure 10 Immunoblotting results of lipid-encapsulated nucleic acid nanostructures expressing green fluorescent protein in HEK 293T cells;

[0272] Figure 11 Triangular nucleic acid nanostructures encapsulated in lipids (T-RO) EGFP+mCherry Image showing the expression of two fluorescent proteins in HEK 293T cells (@lipids);

[0273] Figure 12 Nucleic acid nanostructures encoding p53 protein (RO) p53 The internalization efficiency of targeted cells (cervical cancer cell line, HeLa) from @lipids is shown in Figure a. Figure a is the result of laser confocal microscopy analysis; Figure b is the result of flow cytometry analysis.

[0274] Figure 13 The figures show the inhibitory effects of nucleic acid nanostructures encoding p53 protein on the growth of cervical cancer HeLa cells. Figure a shows the statistical results of cell viability inhibition; figure b shows the statistical results of the proportion of dead cells; figure c shows the statistical results of the proportion of apoptotic cells; figure d shows the fluorescence microscopy observation results of HeLa cells after Calcein-AM / PI staining (green: live cells, red: dead cells); and figure e shows the results of HeLa cell apoptosis analysis.

[0275] Figure 14The images show the in vivo tumor treatment results of nucleic acid nanostructures encoding the p53 protein. Figure a is a schematic diagram of the treatment process in HeLa tumor-bearing mice; Figure b is a tumor growth curve of HeLa tumor-bearing mice; Figure c is a statistical chart of the relative volume of the tumor; Figure d is an in vitro photograph of the tumor from HeLa tumor-bearing mice; and Figure e is a statistical chart of the relative weight of the tumor.

[0276] Figure 15 The image shows the results of H&E and TUNEL staining analysis of tumor tissues from tumor-bearing mice after treatment with nucleic acid nanostructures encoding p53 protein.

[0277] Figure 16 Nucleic acid nanostructures (RO) encoding OVA protein OVA The results of lymph node targeted delivery (@lipids) are shown in Figure a. Figure a is a schematic diagram of the activation of antigen-specific CTL response in mice; Figure b is an in vitro imaging image of inguinal lymph nodes; and Figure c is a statistical result of lymph node fluorescence intensity.

[0278] Figure 17 The results of nucleic acid nanostructures encoding OVA protein inducing maturation and antigen presentation of dendritic cells in mouse lymph nodes are shown in Figure a. Figure a shows the results of flow cytometry analysis of CD80 and CD86 co-stimulatory factor levels in DC cells in lymph nodes; Figure b shows the statistical graph of OVA antigen presentation by DC cells in lymph nodes analyzed by flow cytometry.

[0279] Figure 18 Figure 1 shows the effect of nucleic acid nanostructures encoding OVA protein on immunotherapy. Figure 2a shows the OVA-specific IFN-γ in mouse spleen analyzed by flow cytometry. + CD8α + Results of T lymphocyte proportion; Figure b shows flow cytometry analysis of OVA-specific IFN-γ in peripheral blood PBMCs. + CD8α + Results of T lymphocyte ratio. Detailed Implementation

[0280] To further illustrate the technical means and effects of this invention, the following description, in conjunction with embodiments and accompanying drawings, provides a further explanation of the invention. It is understood that the specific embodiments described herein are merely illustrative of the invention and not intended to limit it.

[0281] Where specific techniques or conditions are not specified in the examples, they shall be performed in accordance with the techniques or conditions described in the literature in this field, or in accordance with the product instructions. Reagents or instruments whose manufacturers are not specified are all conventional products that can be purchased through legitimate channels.

[0282] The instruments and materials used in the examples are as follows:

[0283] Equipment: Microcentrifuge (ThermoFisher, USA), Nanodrop (ThermoFisher, USA), Thermal Cycling PCR System (Bio-rad, USA), Multimode Scanning Probe Microscope (Bruker, Germany), Transmission Electron Microscope (Hitachi, Japan), Gel Imaging Analysis System (Tianneng, China), Full-wavelength Microplate Reader (TECAN, Switzerland), Flow Cytometer (Agilent, Germany), Fluorescence Microscope (Leica, Germany), Laser Confocal Microscope (Leica, Germany), Small Animal Optical 3D In vivo Imaging System (PerkinElmer, USA).

[0284] Raw materials: Deoxyribonucleic acid sequences were purchased from Sangon Biotech (Shanghai) Co., Ltd.; plasmids were purchased from Fenghui Biotechnology (Hunan) Co., Ltd.; maleimide-modified dioleoylphosphatidylethanolamine was purchased from Avanti PolarLipids Ltd.; DOTAP and DOPE were purchased from Shanghai Maclean Biochemical Technology Co., Ltd.; DMG-PEG 2000 and n-octyl-β-D-glucopyranoside (OG) were purchased from Shanghai Aladdin Biochemical Technology Co., Ltd.; Cy5-UTP was purchased from APExBIO Inc., USA.

[0285] Reagents: The buffer solution used in the experiment was PBS / Mg 2+ The buffer solution (pH 7.4) has the following composition: 136.9 × 10⁻⁶ -3 mol·L -1 NaCl, 2.68 × 10 -3 mol·L -1 KCl, 9.75×10 -3 mol·L -1 Na2HPO4·H2O, 1.47×10 -3 mol·L -1 KH2PO4 and 10×10 -3 mol·L -1 MgCl2. All reagents used in the buffer solution were of analytical grade and purchased from Sigma-Aldrich.

[0286] Reagent kits: Plasmid purification kit purchased from Tiangen Biotech (Beijing) Co., Ltd.; La-Taq DNA polymerase purchased from TaKaRa Corporation, Japan; dNTP mix purchased from Tiangen Biotech (Beijing) Co., Ltd.; gel extraction and purification kit purchased from TaKaRa Corporation, Japan; StarPrep DNA purification kit purchased from Beijing Kangrun Chengye Biotechnology Co., Ltd.; Slide-A-Lyzer dialysis kit purchased from Thermo Fisher Scientific, USA; in vitro transcription kit (IVT) purchased from New England Biolabs, USA; cell viability assay kit purchased from Dojin Chemical, Japan; apoptosis kit and live / dead cell staining assay kit purchased from Beijing Solarbio Science & Technology Co., Ltd.; all flow cytometry antibodies purchased from BioLegend, USA.

[0287] Cells: Human embryonic kidney cells (HEK 293T), cervical cancer cells (HeLa), and melanoma cells (B16-OVA) were purchased from the Cell Center of the Institute of Basic Medical Sciences, Peking Union Medical College.

[0288] Culture media: DMEM-H medium, RPMI-1640 medium, Extreme-MEM medium, fetal bovine serum and double antibodies were purchased from ThermoFisher Scientific, USA.

[0289] Animals: Balb / c-nu nude mice, Balb / c mice and C57BL / 6J Nifdc black mice, aged 6-8 weeks, were purchased from Spiford (Beijing) Biotechnology Co., Ltd.

[0290] Example 1

[0291] The schematic diagram of the construction method and working principle of the mRNA delivery system based on nucleic acid nanostructures of this invention is shown below. Figure 1 As shown. This mRNA delivery system can significantly improve the internalization efficiency and stability of mRNA in cells, thereby enhancing the protein expression effect of mRNA. Surface modification with tumor cell-targeting ligands achieves targeted mRNA delivery efficiency and highly effective tumor treatment. The specific steps are as follows:

[0292] (1) Preparation of target mRNA transcription template

[0293] Using plasmid pEGFP-N1 (containing the gene coding sequence of green fluorescent protein EGFP) as a template, PCR amplification was performed using the primer pairs shown in SEQ ID NO.1~SEQ ID NO.2 to obtain a double-stranded DNA template for preparing green fluorescent protein mRNA. The double-stranded DNA template was purified and recovered using a PCR purification kit and placed in a new centrifuge tube for subsequent in vitro transcription reactions.

[0294] (2) Preparation of mRNA scaffold strands

[0295] The obtained double-stranded DNA template was added to the in vitro co-transcription reaction system and incubated at 37°C for 2 h (EGFP mRNA) to synthesize capped mRNA. DNase I was added to the transcribed system and incubated at 37°C for 15 min to remove the DNA transcription template. Poly(A) polymerase was then added and incubated at 37°C for 5 min to complete the mRNA tailing reaction. After LiCl precipitation, the mRNA was dissolved and resuspended in DEPC H2O, and purified according to the kit's instructions. The purified mRNA was then transferred to a new centrifuge tube for later use.

[0296] (3) Preparation of RNA staple strands

[0297] The DNA transcription template containing the RNA staple strands of the T7 promoter was added to the in vitro transcription system and incubated at 37°C for 16 h. DNase I was then added, and the mixture was incubated at 37°C for 30 min to remove the DNA transcription template. The RNA staple strands (SEQ ID NO.9~SEQ ID NO.24) were purified using a 3 kDa MWCO ultrafiltration column and transferred to new centrifuge tubes for later use.

[0298] (4) Co-assembly of mRNA scaffold strand and RNA staple strand

[0299] Purified mRNA EGFP As scaffolding strands and correspondingly designed RNA staple strands (molar ratio 1:10), in 1×PBS / Mg 2+ Assembly was performed in buffer solution using a programmed annealing co-assembly method: holding at 65°C for 5 min, then gradually cooling to 15°C over 1.5 h, ultimately yielding square nucleic acid nanostructures with mRNA molecules as scaffold strands. After assembly, the nanostructures were removed three times by centrifugation using a 100 kDa MWCO ultrafiltration column, separating and concentrating the nucleic acid nanostructures. The purified liquid was collected in a new centrifuge tube, yielding purified nucleic acid nanostructures with capture strands.

[0300] The above nucleic acid nanostructures were analyzed by electrophoresis on a 2% agarose gel, and the results are as follows: Figure 2 As shown in Figure a, lane 1 contains double-stranded DNA markers of known length, with electrophoresis speeds from fastest to slowest: 100, 300, 500, 700, 900, 1000, and 1200 base pairs. Lane 2 contains mRNA. EGFP Lane 3 contains unpurified mRNA. EGFP Nucleic acid nanostructures for scaffolding chains RO EGFPLane 4 contains the purified nucleic acid nanostructure RO EGFP Compared to individual mRNAs EGFP In comparison, the corresponding nucleic acid nanostructure RO EGFP The electrophoresis rate was significantly delayed, indicating the successful assembly of the nucleic acid nanostructure.

[0301] (5) Preparation of lipid-nucleic acid coupled chains

[0302] HS-SH C6 modified single-stranded DNA (200 μM, 100 μL, SEQ ID NO.102~SEQ ID NO.103) was mixed with tris(2-carboxyethyl)phosphine (TCEP) in PBS at a molar ratio of 1:40 and reacted with shaking at room temperature for 1 h. After the reaction, the final concentration of the solution was adjusted to a mixture of 0.3 mol / L sodium acetate and 75% ethanol, mixed well, and incubated at -80℃ overnight for precipitation. The reduced product DNA-SH was collected by centrifugation at 4℃ and dissolved in 100 μL DEPC H2O. The product was purified three times using a 3 kDa MWCO ultrafiltration column to remove excess TCEP, and the solution in the purified column was collected. Freshly purified DNA-SH (100 μL) was mixed with maleimide-modified DOPE (DOPE-Mal) in 1× reaction buffer (1% OG, 25 mM HEPES, 140 mM KCl, pH 7.4) at a molar ratio of 1:30 and reacted at 25°C with shaking for 3 h. The product (DOPE-DNA) was then separated and purified by agarose gel electrophoresis.

[0303] (6) Co-assembly of nucleic acid nanostructures and lipid-nucleic acid coupled chains

[0304] The capture chain obtained in step (4) and the lipid-nucleic acid coupled chain obtained in step (5) were mixed at a molar ratio of 1:1.5, kept at 37°C for 30 min, and finally cooled to 4°C. The excess lipid-nucleic acid coupled chain was concentrated and removed using a 30 kDa MWCO ultrafiltration column to finally obtain a nucleic acid nanostructure modified with lipid molecules.

[0305] (7) Preparation of mother liquor for auxiliary lipids

[0306] N-(2,3-dioleoyloxy)propyl-N,N,N-trimethylammonium chloride (DOTAP), 1,2-dioleoyl-SN-3-phosphate ethanolamine (DOPE), and 1,2-dimyristoyl-rac-glycerol-3-methoxy polyethylene glycol 2000 (PEG2000-DMG) were dissolved in chloroform at a molar ratio of 80:15:5. The mixture was dried under nitrogen and vacuum for 12 h. Subsequently, the mixed lipids (15 mM) were dissolved in 1×PBS buffer (RNase-free) containing 10 mM MgCl2 and 1% OG, and sonicated for 20 min to obtain a stock solution of auxiliary lipids for lipid growth.

[0307] (8) Co-incubation of nucleic acid nanostructures and auxiliary lipid stock solution

[0308] The lipid-modified nucleic acid nanostructure obtained in step (6) was mixed with the mother liquor of the auxiliary lipids obtained in step (7) at a molar ratio of lipid-nucleic acid conjugate to auxiliary lipid of 1:100, and gently shaken and incubated at 4°C for 30 min. Then, it was incubated in 1×PBS / Mg 2+ The mixture was dialyzed at 4°C for 18 h in buffer solution to remove excess auxiliary lipids and detergent (OG), ultimately yielding the lipid-encapsulated nucleic acid nanostructures.

[0309] The above-mentioned nucleic acid nanostructures were further characterized by the following steps:

[0310] Atomic force microscopy characterization: 20 µL of nucleic acid nanostructure and lipid-encapsulated nucleic acid nanostructure solutions were dropped onto the surface of a freshly prepared mica sheet, deposited at room temperature for 3 min, gently rinsed twice with DEPC H2O, dried at room temperature, and then imaged using an atomic force microscope in ScanAsyst in Air mode (MultiMode 8).

[0311] The results are as follows Figure 2 As shown in Figures b and c, nucleic acid nanostructures (RO) EGFP The uniform planar structure indicates successful assembly of the pre-designed nucleic acid nanostructure, with regular morphology and good dispersion. After lipid modification, the lipid-encapsulated nucleic acid nanostructure (RO) was observed. EGFP (@lipids) The morphology is uniform; statistical analysis results show that the height of the nanostructure increased from 2 nm to 6 nm before and after lipid growth, indicating that the auxiliary lipid was successfully modified onto the surface of the nucleic acid nanostructure.

[0312] Transmission electron microscopy characterization: 10 μL of sample was dropped onto the surface of a carbon-supported copper mesh and deposited for 5 min. After the solution was blotted dry with filter paper, 5 μL of uranyl acetate solution (1%) was dropped onto the surface of the copper mesh. After standing for 1 min, the solution was blotted dry with filter paper and dried overnight. The sample was then imaged using a transmission electron microscope Ht-7700.

[0313] The results are as follows Figure 3 As shown, lipid-encapsulated nucleic acid nanostructures (RO) were observed. EGFP @lipids) presents a monodisperse state.

[0314] Stability characterization: Individual mRNA molecules (mRNA) EGFP ) and lipid-encapsulated nucleic acid nanostructures (RO) EGFP @lipids were mixed with 10% mouse plasma, 10% fetal bovine serum and 50 μg / mL ribonuclease A respectively, and incubated at 37°C for different times (0 h, 1 h, 2 h, 3 h, 6 h, 12 h, 24 h). The amount of remaining nucleic acid in the samples was analyzed by agarose gel electrophoresis to determine the stability of the lipid-encapsulated nucleic acid nanostructures.

[0315] The results are as follows Figure 4 As shown, mRNA alone is completely degraded in less than 1 h when incubated with plasma, serum, and RNase A, while lipid-encapsulated nucleic acid nanostructures (RO) are completely degraded. EGFP No significant degradation was observed after incubation for 24 h (@lipids), indicating that lipid modification can further protect mRNA molecules.

[0316] Fluorescence microscopy characterization: When the molar ratio of lipid-nucleic acid conjugate to accessory lipid was 1:50, 1:100, and 1:200, the lipid-encapsulated nucleic acid nanostructures (ROS) prepared exhibited different characteristics. EGFP @lipids) were incubated with human embryonic kidney cells HEK 293T, and the expression level of green fluorescent protein in the cells was detected by fluorescence microscopy and flow cytometry.

[0317] The results are as follows Figure 5 As shown in Figures a and b, the fluorescence images and flow cytometry results of HEK 293T cells indicate that a molar ratio of lipid-nucleic acid conjugate to helper lipid of 100 eq is sufficient to enable the lipid-encapsulated nucleic acid nanostructure to efficiently express the target protein in HEK293T cells.

[0318] Example 2

[0319] Compared with Example 1, in the process of constructing the double-stranded DNA template in this example, a plasmid containing the green and red fluorescent protein EGFP+mCherry expression cassette was used as a template, and the primer pairs shown in SEQ ID NO.3~SEQ ID NO.4 were used for PCR amplification to obtain a double-stranded DNA template containing the EGFP+mCherry double-tag protein.

[0320] In the transcription reaction system, mRNA was synthesized by incubation at 37°C for 3 hours. EGFP+mCherry ;

[0321] During co-assembly, programmed annealing co-assembly was performed using corresponding RNA staple chains (SEQ ID NO.25~SEQ ID NO.45) to obtain triangular nucleic acid nanostructures. Figure 6 (As shown in Figure a), other conditions are the same as in Example 1.

[0322] The above nucleic acid nanostructure T-RO EGFP+mCherry Electrophoresis was performed on a 1% agarose gel, and the results are as follows: Figure 6 As shown in Figure b, lane 1 contains double-stranded DNA markers of known length, with electrophoresis speeds from fastest to slowest: 100, 250, 500, 750, 1000, 2000, 3000, 4000, and 5000 base pairs. Lane 2 contains mRNA. EGFP+mCherry Lane 3 contains unpurified mRNA. EGFP+mCherry T-RO, a triangular nucleic acid nanostructure for scaffolding chains EGFP+mCherry Lane 4 contains the purified triangular nucleic acid nanostructure (T-RO). EGFP+mCherry ). Compared with unassembled mRNA alone. EGFP+mCherry In comparison, the corresponding triangular nucleic acid nanostructure T-RO EGFP+mCherry The electrophoresis rate was significantly delayed, indicating the successful assembly of the triangular nucleic acid nanostructure.

[0323] Atomic force microscopy characterization results as follows Figure 6 As shown in Figure c, nucleic acid nanostructures (T-RO) EGFP+mCherry The presence of a clear triangle indicates successful assembly of the pre-designed nucleic acid nanostructure, which has a regular morphology and good dispersion.

[0324] Example 3

[0325] Compared with Example 1, in the process of constructing the double-stranded DNA template in this example, a plasmid containing the expression cassette of the tumor suppressor protein p53 was used as a template, and the primer pairs shown in SEQ ID NO.5~SEQ ID NO.6 were used for PCR amplification to obtain a double-stranded DNA template encoding p53.

[0326] In the transcription reaction system, mRNA was synthesized by incubation at 37°C for 3 hours. p53 ;

[0327] During the co-assembly process, programmed annealing co-assembly was performed using corresponding RNA staple chains (SEQ ID NO.46~SEQ ID NO.73) to obtain rectangular nucleic acid nanostructures;

[0328] When preparing the nucleic acid nanostructure for delivering p53 mRNA, the 1,2-dioleoyl-SN-3-phosphate ethanolamine (DOPE) component in the auxiliary lipid stock solution was replaced with folic acid-modified 1,2-dioleoyl-SN-3-phosphate ethanolamine (FA-DOPE) to achieve targeted delivery, with other conditions being the same as in Example 1.

[0329] Example 4

[0330] Compared with Example 1, in the process of constructing the double-stranded DNA template in this example, a plasmid containing the tumor antigen ovalbumin OVA expression frame was used as a template, and the primer pairs shown in SEQ ID NO.7~SEQ ID NO.8 were used for PCR amplification to obtain a double-stranded DNA template encoding OVA protein.

[0331] In the transcription reaction system, mRNA was synthesized by incubation at 37°C for 3 hours. OVA ;

[0332] During the co-assembly process, programmed annealing co-assembly was performed using corresponding RNA staple chains (SEQ ID NO.74~SEQ ID NO.101) to obtain rectangular nucleic acid nanostructures;

[0333] When preparing the nucleic acid nanostructure for delivery of OVA mRNA, lipopolysaccharide (5% of the total weight of lipids) was added to the auxiliary lipid stock solution as an immunoadjuvant, and other conditions were the same as in Example 1.

[0334] Example 5

[0335] Compared with Example 1, in step (4), the molar ratio of scaffold chain to RNA staple chain is 1:1, and the programmed annealing co-assembly method is: hold at 65°C for 2 min, and gradually cool to 10°C within 1 h;

[0336] In step (5), the molar ratio of DNA-SH to DOPE-Mal is 1:5, and the reaction is carried out at 20°C with shaking for 0.5 h.

[0337] In step (6), the capture chain and the lipid-nucleic acid conjugate chain are mixed at a molar ratio of 1:1, kept at 20°C for 10 min, and finally cooled to 2°C.

[0338] In step (8), the lipid-nucleic acid conjugate and the helper lipid are mixed at a molar ratio of 1:25 and incubated with gentle shaking at 2°C for 10 min. Then, in 1×PBS / Mg 2+ Dialyze in buffer solution at 4°C for 8 h, with other conditions the same as in Example 1.

[0339] This embodiment only adjusts the reaction and assembly conditions in steps (4), (5), (6) and (8), and can still efficiently obtain an mRNA delivery system based on nucleic acid nanostructures.

[0340] Example 6

[0341] Compared with Example 1, the molar ratio of scaffold strand to RNA staple strand in step (4) is 1:20, and the programmed annealing co-assembly method is: hold at 65°C for 10 min, and gradually cool to 20°C within 4 h;

[0342] In step (5), the molar ratio of DNA-SH to DOPE-Mal is 1:40, and the reaction is carried out at 40℃ with shaking for 4 h.

[0343] In step (6), the capture chain and the lipid-nucleic acid conjugate chain are mixed at a molar ratio of 1:2, kept at 40°C for 90 min, and finally cooled to 6°C.

[0344] In step (8), the lipid-nucleic acid conjugate and the helper lipid were mixed at a molar ratio of 1:500 and incubated with gentle shaking at 30°C for 90 min. Then, the mixture was placed in 1×PBS / Mg 2+ Dialyze in buffer solution at 4°C for 24 h, with other conditions the same as in Example 1.

[0345] This embodiment only adjusts the reaction and assembly conditions in steps (4), (5), (6) and (8), and can still efficiently obtain an mRNA delivery system based on nucleic acid nanostructures.

[0346] Example 7

[0347] Compared with Example 1, the molar ratio of lipid-nucleic acid conjugate to auxiliary lipid in step (8) is 1.0, and other conditions are the same as in Example 1.

[0348] Example 8

[0349] Compared with Example 2, the molar ratio of lipid-nucleic acid conjugate to auxiliary lipid in step (8) is 1.0, and other conditions are the same as in Example 2.

[0350] Example 9

[0351] Compared with Example 3, the molar ratio of lipid-nucleic acid conjugate to auxiliary lipid in step (8) is 1.0, and other conditions are the same as in Example 3.

[0352] Example 10

[0353] Compared with Example 4, the molar ratio of lipid-nucleic acid conjugate to auxiliary lipid in step (8) is 1.0, and other conditions are the same as in Example 4.

[0354] Example 11

[0355] This embodiment investigates the cell internalization efficiency of a nucleic acid nanostructure-based mRNA delivery system, and the steps are as follows:

[0356] HEK 293T cells were seeded in 48-well plates and cultured overnight at 37°C. The culture medium was then removed, and HEK 293T cells were added to PBS buffer (blank control) dissolved in Opti-MEM medium, followed by Cy5-modified nucleic acid nanostructures (RO). EGFP (Prepared in Example 7) and Cy5-modified and lipid-encapsulated nucleic acid nanostructures (RO) EGFP @lipids (prepared in Example 1), the final concentration of the nanostructure was 6.0 nM. After incubation at 37°C for 6 h, the cells were washed three times with PBS buffer, digested with trypsin for 2 min, collected by centrifugation, and resuspended in PBS. The intracellular Cy5 fluorescence intensity was detected by flow cytometry.

[0357] The results are as follows Figure 7 As shown in Figures a and b, the unmodified lipid-containing nucleic acid nanostructures can be effectively taken up by cells. After being encapsulated by lipids, the cell internalization efficiency of the nucleic acid nanostructures is further enhanced, indicating that nucleic acid nanostructures can serve as delivery carriers for nucleic acid drugs and can effectively cross the cell membrane and enter the cell with the help of the lipid layer.

[0358] Example 12

[0359] This embodiment investigates the safety of nucleic acid nanostructures, and the steps are as follows:

[0360] Female BALB / c mice aged 6-8 weeks were injected via the tail vein with 0.9% saline and mRNA, respectively. EGFP RO EGFP lipids+mRNA EGFP RO EGFP @lipids or LNP EGFP Six hours after injection, mouse blood was collected, and after standing at room temperature for about 2 hours, serum was collected by centrifugation at 4°C. The IFN-α level in the serum samples was detected using an ELISA kit.

[0361] The results are as follows Figure 8As shown, the nucleic acid nanostructures were similar to the saline group, and no significant immunogenicity was observed, demonstrating their good biocompatibility. Among the three delivery groups containing lipid carriers (lipids + mRNA)... EGFP RO EGFP @lipids and LNP EGFP mRNA delivery system based on nucleic acid nanostructures (RO) EGFP The @lipids method elicited the lowest level of IFN-α elevation in mice. These results indicate that the strategy of using nucleic acid nanostructures to guide lipid growth can reduce the in vivo immunogenicity of mRNA delivery systems.

[0362] Example 13

[0363] This embodiment investigates the ability of an mRNA delivery system to express a target protein. The steps are as follows:

[0364] (1) Fluorescence microscopy: HEK 293T cells were seeded in 48-well plates and cultured overnight at 37°C. The culture medium was aspirated, and HEK 293T cells were then added to PBS buffer (blank control) dissolved in Opti-MEM medium and nucleic acid nanostructures (RO) respectively. EGFP : 6.0 nM) and lipid-encapsulated nucleic acid nanostructures (RO EGFP @lipids: 2.0, 4.0 or 6.0 nM). After incubation at 37°C for 24 h, the cells were imaged using a fluorescence microscope under a 488 nm wavelength laser to detect intracellular EGFP signals.

[0365] The results are as follows Figure 9 As shown, in the lipid-free nucleic acid nanostructure group (RO) EGFP No obvious EGFP protein fluorescence signal was observed. However, in the lipid-encapsulated nucleic acid nanostructures (RO... EGFP (@lipids), significant EGFP protein fluorescence signal was detected, indicating that the cells can effectively take up RO. EGFP @lipids, and successfully expressed EGFP protein. Furthermore, with increasing structural concentration, the fluorescence signal of EGFP protein in HEK 293T cells gradually increased, indicating that RO EGFP The EGFP protein expression behavior of @lipids is dose-dependent.

[0366] (2) Western blot: HEK 293T cells were seeded in 6-well plates and cultured overnight. The culture medium was aspirated, and PBS buffer (blank control) dissolved in 2 mL of Opti-MEM medium was added, along with lipid-encapsulated mRNA (lipids+mRNA). EGFP Nucleic acid nanostructures (RO) EGFP) and lipid-encapsulated nucleic acid nanostructures (RO) EGFP @lipids), incubated at 37℃ for 24h. After incubation, total protein was extracted from each drug-treated group, and the content of the target protein EGFP was analyzed by Western blot, with β-Actin as the internal control protein.

[0367] The results are as follows Figure 10 As shown, lipid-encapsulated nucleic acid nanostructures (RO) EGFP @lipids can effectively enhance the expression level of green fluorescent protein in cells, indicating that this type of nucleic acid nanostructure has great application potential in upregulating the expression of target proteins.

[0368] Example 14

[0369] This embodiment investigates the ability of lipid-encapsulated triangular nucleic acid nanostructures to express target proteins. The steps are as follows:

[0370] HEK 293T cells were seeded in 48-well plates and cultured overnight at 37°C. The culture medium was then removed, and the HEK 293T cells were inoculated with lipid-encapsulated triangular nucleic acid nanostructures (T-RO) dissolved in Opti-MEM medium. EGFP+mCherry @lipids, Preparation in Example 2). After incubation at 37°C for 24 h, the cells were imaged using a fluorescence microscope to detect EGFP and mCherry signals within the cells.

[0371] The results are as follows Figure 11 As shown, lipid-encapsulated triangular nucleic acid nanostructures (T-RO) EGFP+mCherry @lipids can simultaneously and efficiently express both green fluorescent protein (EGFP) and red fluorescent protein (mCherry), indicating that the protein expression ability of this type of nucleic acid nanostructure-based mRNA delivery system is not significantly affected by the structural morphology.

[0372] Example 15

[0373] This embodiment investigates the tumor cell-targeted internalization efficiency of nucleic acid nanostructures, and the steps are as follows:

[0374] HeLa tumor cells were seeded into 48-well plates and cultured overnight. The culture medium was then aspirated, and HeLa cells were separately inoculated with PBS buffer (blank control) dissolved in Opti-MEM medium, and Cy5-modified nucleic acid nanostructures (RO) were added. p53 (Prepared in Example 3) and Cy5-modified and lipid-encapsulated nucleic acid nanostructures (RO) p53@lipids (prepared in Example 9), the final concentration of the nanostructure was 10.0 nM. After incubation at 37°C for 6 h, the cells were washed three times with PBS buffer, digested with trypsin for 2 min, collected by centrifugation, and resuspended in PBS. The intracellular Cy5 fluorescence intensity was detected by flow cytometry.

[0375] The results are as follows Figure 12 As shown in Figures a and b, the unmodified lipid-based nucleic acid nanostructures can be taken up by tumor cells. After being encapsulated by auxiliary lipids modified with folic acid, a targeted ligand, the cell internalization efficiency of the nucleic acid nanostructures is further enhanced.

[0376] Example 16

[0377] This embodiment investigates the effect of p53 mRNA-encoded nucleic acid nanostructures on targeted killing of tumor cells in vitro. The steps are as follows:

[0378] (1) Cell viability assay: HeLa cells were seeded in 96-well plates and cultured overnight. The culture medium was discarded, and PBS, positive control group (lipids + mRNA) were added according to the following groups. p53 Nucleic acid nanostructures (RO) p53 ), lipid-encapsulated nucleic acid nanostructures (RO) p53 @lipids) or negative control group (RO) EGFP @lipids), with a final concentration of 5.0 nM, three replicates per group, and incubated at 37°C for 36 h. After incubation, freshly prepared DMEM medium containing 10% CCK-8 was added, and the cells were incubated at 37°C for 30 min. OD values ​​at 450 nm and 620 nm were measured using a microplate reader. The survival rate of tumor cells was calculated based on the OD values ​​using the formula: Survival rate % = Experimental group (OD value of 450 nm + 620 nm + 620 nm) / 620 nm. 450 -OD 620 ) / Control group (OD) 450 -OD 620 ) × 100%.

[0379] The results are as follows Figure 13 As shown in Figure a, lipid-encapsulated nucleic acid nanostructures (RO) p53 The cell viability of the @lipids group was the lowest, indicating that this type of mRNA delivery platform can successfully deliver mRNA. p53 It enters HeLa cells and significantly kills tumor cells.

[0380] (2) Live and dead cell staining experiment: HeLa cells were seeded in 48-well plates and cultured overnight at 37°C. The culture medium was discarded, and PBS, positive control group (lipids + mRNA) were added according to the following groups respectively. p53 Nucleic acid nanostructures (RO) p53), lipid-encapsulated nucleic acid nanostructures (RO) p53 @lipids) or negative control group (RO) EGFP @lipids), with a final concentration of 5.0 nM, incubated at 37°C for 36 h. After incubation, staining was performed using the Calcein-AM / PI double staining kit (Yeasen) at 37°C for 10 min. Cells were imaged using a fluorescence microscope, and live cells (Calcein-AM labeled) or dead cells (PI labeled) were detected using lasers at wavelengths of 488 nm or 545 nm.

[0381] The results are as follows Figure 13 As shown in Figures b and d, the treatment group with lipid-encapsulated nucleic acid nanostructures resulted in the largest number of dead cells (red fluorescence) and the smallest number of live cells (green fluorescence), which visually demonstrates its most efficient cell-killing ability.

[0382] (3) Apoptosis detection experiment: HeLa cells were seeded in 48-well plates and cultured overnight. The culture medium was discarded, and PBS, positive control group (lipids + mRNA) were added according to the following groups respectively. p53 Nucleic acid nanostructures (RO) p53 ), lipid-encapsulated nucleic acid nanostructures (RO) p53 @lipids) or negative control group (RO) EGFP @lipids), with a final concentration of 5.0 nM, incubated at 37°C for 36 h. After incubation, cells were washed three times with pre-cooled PBS buffer, digested with EDTA-free trypsin, and collected. The collected cells were stained using the Annexin V-FITC / PI apoptosis detection kit. Finally, flow cytometry was used to detect apoptosis in different treatment groups.

[0383] The results are as follows Figure 13 As shown in Figures c and e, the group treated with lipid-encapsulated nucleic acid nanostructures exhibited the highest proportion of apoptosis, indicating that it can effectively enhance mRNA production. p53 The delivery efficiency of these cells is reduced, thereby inducing tumor cell death.

[0384] Example 17

[0385] This embodiment investigates the therapeutic effect of the p53 mRNA delivery system on tumors in HeLa tumor-bearing mice. The steps are as follows:

[0386] When the tumor volume is greater than 40 mm 3 At that time, HeLa tumor-bearing mice were randomly divided into 6 groups (n=5 per group), and were injected via tail vein with 0.9% saline, positive control group (lipids+mRNA), etc. p53Nucleic acid nanostructures (RO) p53 ), lipid-encapsulated nucleic acid nanostructures (RO) p53 @lipids), negative control group (RO) EGFP @lipids) or lipid nanoparticle group (LNP) p53 (Dosage: 1 mg / kg), administered once every 3 days during the treatment period, for a total of 4 doses. During treatment, the tumor volume and body weight of the mice were recorded. The volume was calculated using the formula: V = 0.5ab 2 The longest (a) and shortest (b) diameters of the tumors were measured. Mice were sacrificed on day 15 after treatment, and the collected tumors were imaged and weighed.

[0387] The results are as follows Figure 14 As shown in Figures a-d, compared with the control group, the tumor growth curves, relative tumor volume, tumor photographs, and tumor weight of the lipid-encapsulated nucleic acid nanostructure group in mice indicate that RO p53 The @lipids treatment group showed the best tumor suppression effect in HeLa tumor-bearing mice.

[0388] Example 18

[0389] This embodiment explores the tumor treatment mechanism of the p53 mRNA delivery system in HeLa tumor-bearing mice. The steps are as follows:

[0390] After completing the in vivo tumor treatment in Example 13 above, tumor tissues from each group of mice were collected and stained using hematoxylin-eosin (H&E) staining and TdT-mediated dUTP nick-end labeling (TUNEL) staining.

[0391] The results are as follows Figure 15 As shown, in RO p53 The tumor tissue of the @lipids treatment group showed the highest levels of apoptosis and nucleic acid damage, further demonstrating the efficacy of RO. p53 @lipids can effectively induce tumor cell apoptosis at the in vivo level and achieve the goal of inhibiting tumor growth.

[0392] Example 19

[0393] This embodiment investigates the effectiveness of the OVA mRNA delivery system in targeting lymph nodes in vivo. The steps are as follows:

[0394] Female C57BL / 6J Nifdc mice were randomly divided into 4 groups (n=3 per group) and Cy5-mRNA was injected subcutaneously into the base of the tail. OVA lipids+Cy5-mRNA OVA Cy5-RO OVA(Prepared in Example 10) or Cy5-RO OVA @lipid (prepared in Example 4) (dosage: 1 mg / kg). Mice were sacrificed 24 h after administration, and inguinal lymph nodes were collected. The collected lymph nodes were subjected to in vitro fluorescence imaging and quantitative analysis using a small animal imaging system (IVIS Spectrum).

[0395] The results are as follows Figure 16 As shown in Figures a-c, with mRNA OVA Compared with the control group, RO OVA The increased fluorescence intensity in the lymph nodes of the group demonstrated that nucleic acid nanostructures can enhance the lymph node-targeted delivery of mRNA. Simultaneously, the lipid-modified nucleic acid nanostructure group (RO) showed improved fluorescence intensity. OVA The enhanced Cy5 fluorescence signal in the lymph nodes (@lipid) indicates that the lipid-encapsulated nucleic acid nanostructures can remain in the lymph nodes for a longer period of time.

[0396] Example 20

[0397] This embodiment investigates the effect of the OVA mRNA delivery system on specific immune activation in vivo, and the steps are as follows:

[0398] Female C57BL / 6J Nifdc mice were randomly divided into 5 groups (n=5 per group). The mice were administered 0.9% saline solution subcutaneously at the base of their tails, and a positive control group (lipids + mRNA) was also administered the 0.9% saline solution. OVA Nucleic acid nanostructures (RO) OVA ), lipid-encapsulated nucleic acid nanostructures (RO) OVA @lipids) or negative control group (RO) EGFP @lipids (dosage: 1 mg / kg). Injections were administered on days 0 and 7. Mice were dissected on day 14 after administration of the two injections, and their inguinal lymph nodes, spleen, and circulating peripheral blood (PBMCs) were collected. Flow cytometry was used to detect immune activation in vivo.

[0399] The results are as follows Figure 17 Figures a and b in the middle Figure 18 As shown in Figures a and b, lipid-encapsulated nucleic acid nanostructures (RO) OVA The lymph nodes of @lipids showed the highest levels of antigen-presenting cell activation and antigen-presenting signaling, indicating that it can activate antigen-presenting cells and promote the antigen-presenting process in vivo. Simultaneously, the abundance of antigen-specific T cells was also highest in the spleen and circulating peripheral blood, suggesting that it can effectively activate the immune system in vivo, thereby activating antigen-specific cytotoxic T lymphocyte responses (CTLs).

[0400] In summary, this invention, through meticulous sequence and structural design, uses mRNA molecules encoding functional proteins as scaffold chains, and their corresponding RNA staple chains self-assemble through base complementary pairing to obtain morphology-controllable nucleic acid nanostructures. Utilizing the addressability of the surface of these nucleic acid nanostructures, lipid molecules can be precisely anchored, thus serving as templates for in-situ lipid growth. Modification with a small amount of lipids improves the cell internalization efficiency of the nucleic acid nanostructures while reducing the toxicity and immunogenicity of lipid-based nucleic acid drug delivery systems. Further modification with tumor-related targeting groups enables the constructed nucleic acid nanostructures to target and deliver mRNA molecules to in vivo tumors with good biosafety, providing a new approach for developing novel mRNA delivery platforms based on nucleic acid nanotechnology, with broad application prospects.

[0401] The applicant declares that the detailed method of the present invention is illustrated by the above embodiments, but the present invention is not limited to the above detailed method, that is, it does not mean that the present invention must rely on the above detailed method to be implemented. Those skilled in the art should understand that any improvements to the present invention, equivalent substitutions of the raw materials of the product of the present invention, addition of auxiliary components, selection of specific methods, etc., all fall within the protection scope and disclosure scope of the present invention.

Claims

1. An mRNA delivery system based on nucleic acid nanostructures, characterized in that, The mRNA delivery system includes an mRNA scaffold chain, an RNA staple chain, a lipid-nucleic acid conjugate chain, and auxiliary lipids; The mRNA scaffolding chain includes a nucleic acid sequence encoding the target protein mRNA; The mRNA scaffolding chain and the RNA staple chain self-assemble into a nucleic acid nanostructure through complementary base pairing. The lipid-nucleic acid conjugate chain includes a lipid molecule and a nucleic acid chain conjugated thereto.

2. The mRNA delivery system based on nucleic acid nanostructures according to claim 1, characterized in that, The mRNA scaffolding chain comprises mRNA encoding EGFP fluorescent protein, and the nucleic acid sequence of the RNA staple chain comprises the sequences shown in SEQ ID NO. 9 to SEQ ID NO. 24; or, The mRNA scaffolding chain comprises mRNA encoding both mCherry and EGFP fluorescent proteins, and the nucleic acid sequence of the RNA staple chain comprises the sequences shown in SEQ ID NO. 25 to SEQ ID NO. 45; or, The mRNA scaffolding chain includes mRNA encoding the p53 protein, and the nucleic acid sequence of the RNA staple chain includes the sequences shown in SEQ ID NO. 46 to SEQ ID NO. 73; or, The mRNA scaffold chain includes mRNA encoding ovalbumin, and the nucleic acid sequence of the RNA staple chain includes the sequences shown in SEQ ID NO.74 to SEQ ID NO.101; Preferably, the shape of the nucleic acid nanostructure includes any one or a combination of at least two of the following: square, rectangle, or triangle.

3. The mRNA delivery system based on nucleic acid nanostructures according to claim 1 or 2, characterized in that, The RNA staple chain contains a nucleic acid capture chain.

4. The mRNA delivery system based on nucleic acid nanostructures according to claim 3, characterized in that, The nucleic acid capture chain and the lipid-nucleic acid conjugate chain are linked by complementary base pairing; Preferably, the 5' or 3' end of the lipid-nucleic acid conjugate has an HS-SH C6 modification, and its nucleic acid sequence includes the sequence shown in SEQ ID NO. 102 and / or SEQ ID NO. 103; Preferably, the lipids in the lipid-nucleic acid coupled chain include any one or a combination of at least two of 1,2-dioleoyl-SN-glycerol-3-phosphatidylethanolamine, distearate-phosphatidylethanolamine, dimyristoylphosphatidylethanolamine, or dipalmitoylphosphatidylethanolamine.

5. The mRNA delivery system based on nucleic acid nanostructures according to any one of claims 1-4, characterized in that, The lipid-nucleic acid conjugate chain and the auxiliary lipid are bound to the nucleic acid nanostructure through hydrophobic interactions; Preferably, the molar ratio of the lipid-nucleic acid conjugate to the auxiliary lipid is 1:(25~500); Preferably, the auxiliary lipids include any one or a combination of at least two of cationic lipids, neutral lipids, or polyethylene glycol-modified lipids; Preferably, the cationic lipid comprises any one or a combination of at least two of N-(2,3-dioleoxy)propyl-N,N,N-triethylammonium chloride, N-(2,3-dioleoxy)propyl-N,N,N-trimethylammonium chloride, or N-(1-(2,3-dioleoxy)propyl)-N-2-(sperminecarbamoyl)ethyl-N,N-dimethyltrifluoroacetate ammonium. Preferably, the neutral lipids include any one or a combination of at least two of the following: 1,2-dioleoyl-SN-glycerol-3-phosphocholine, 1,2-distearyl-SN-glycerol-3-phosphocholine, 1,2-dipalmitoyl-SN-glycerol-3-phosphocholine, 1,2-distearyl-SN-glycerol-3-phosphoethanolamine, 1,2-dioleoyl-SN-glycerol-3-phosphoethanolamine, folic acid-modified 1,2-dioleoyl-SN-glycerol-3-phosphoethanolamine, or folic acid-modified 1,2-distearyl-SN-glycerol-3-phosphoethanolamine. Preferably, the PEGylated lipids include 1,2-dimyristic-rac-glycerol-3-methoxy polyethylene glycol 2000 and / or polyethylene glycol-bistetradecylacetamide.

6. The mRNA delivery system based on nucleic acid nanostructures according to any one of claims 1-5, characterized in that, The assisting lipid modification has a targeting ligand capable of recognizing cell surface receptors or an immune adjuvant capable of activating immune cells, including any one or a combination of at least two of folic acid, mannose, RGD peptide, lipopolysaccharide, R848, or CpG.

7. A method for preparing an mRNA delivery system based on nucleic acid nanostructures according to any one of claims 1-6, characterized in that, The preparation method includes: A target mRNA scaffold chain is prepared; an RNA staple chain is prepared; the mRNA scaffold chain and the corresponding RNA staple chain are annealed and assembled to form a nucleic acid nanostructure; a lipid-nucleic acid conjugate chain is prepared; the nucleic acid nanostructure and the lipid-nucleic acid conjugate chain are co-assembled, and then co-incubated with an auxiliary lipid to obtain the mRNA delivery system based on the nucleic acid nanostructure.

8. The method for preparing the mRNA delivery system based on nucleic acid nanostructures according to claim 7, characterized in that, The preparation of the nucleic acid nanostructure includes: The mRNA scaffold strand encoding the target protein and the corresponding RNA staple strand were obtained by PCR amplification and in vitro transcription. Preferably, the primer nucleic acid sequences for PCR amplification include the sequences shown in SEQ ID NO.1 to SEQ ID NO.8; Preferably, the molar ratio of the mRNA scaffold chain to the RNA staple chain is 1:(1~20); Preferably, the annealing assembly conditions are: holding at 63~67℃ for 2~10 min, and gradually cooling to 10~20℃ within 1~4 h.

9. The method for preparing the mRNA delivery system based on nucleic acid nanostructures according to claim 7 or 8, characterized in that, The preparation of lipid-nucleic acid conjugates includes: A click reaction was performed between a nucleic acid chain with a thiol group at the end and a lipid molecule modified with maleimide to obtain a lipid-nucleic acid coupled chain. Preferably, the molar ratio of the nucleic acid chain with thiol groups at the ends to the lipid molecules modified with maleimide is 1:(5~40); Preferably, the reaction temperature of the click reaction is 20~40℃ and the reaction time is 0.5~4 h. Preferably, the preparation method further includes hybridizing the nucleic acid nanostructure with a lipid-nucleic acid conjugate and incubating it with an auxiliary lipid to obtain a nucleic acid nanostructure-based mRNA delivery system; Preferably, the molar ratio of the nucleic acid capture chain and the lipid-nucleic acid conjugate chain during hybridization is 1:(1~2); Preferably, the hybridization conditions are: maintaining the temperature at 20-40°C for 10-90 minutes, then cooling to 2-6°C. Preferably, the incubation conditions are 2-30°C for 10-90 min, followed by dialysis for 8-24 h.

10. The use of the nucleic acid nanostructure-based mRNA delivery system according to any one of claims 1-6 in the preparation of tumor therapeutic drugs; Preferably, the tumor includes any one or a combination of at least two of cervical cancer, breast cancer, ovarian cancer, prostate cancer, liver cancer, non-small cell carcinoma, skin cancer, or lung cancer.