Probiotic designed to express and secrete akkermansia muciniphila TARS and vector for producing same

Abstract

The present invention relates to: a transformed strain expressing and secreting Akkermansia muciniphila TARS (AmTARS); and a vector for producing same. More specifically, the present invention relates to an Escherichia coli Nissle 1917 (EcN) strain expressing AmTARS, a composition comprising same, a novel vector for producing same, and an EcN transformation method using same.

Description

Probiotics designed to express and secrete Akkermansia muciniphila TARS and vectors for their manufacture

[0001] The present invention relates to a transformed strain expressing and secreting Akkermansia muciniphila TARS (AmTARS) and a vector for producing the same, and more particularly, to an Escherichia coli Nissle 1917 (EcN) strain expressing AmTARS, a composition comprising the same, a novel vector for producing the same, and an EcN transformation method utilizing the same.

[0002]

[0003] Escherichia coli Nissle 1917 (EcN), a well-known probiotic, is one of the most tested strains worldwide and has been studied for the prevention and alleviation of various gastrointestinal diseases such as inflammatory bowel disease (IBD), constipation, and irritable bowel syndrome. EcN is a non-pathogenic strain that lacks cytotoxic factors and is known to suppress pathogenic microorganisms by inducing the secretion of beta-defensin, a peptide with antimicrobial action that affects intestinal epithelial cells. It is currently manufactured in Korea as Mutaflow Capsules (lyophilized product of EcN) and sold as a prescription drug.

[0004] IBD is a chronic inflammatory disease that includes ulcerative colitis and Crohn's disease. While the exact cause is unknown, it is believed to be influenced by genetic and environmental factors. While various treatments can alleviate symptoms, a definitive cure is currently unavailable. A study comparing the gut microbiomes of healthy individuals and IBD patients revealed that IBD patients had significantly lower proportions of strains typically considered beneficial compared to healthy individuals. This has led various research teams to publish papers on the use of probiotics to alleviate IBD symptoms, and research is still actively underway.

[0005] Aminoacyl-tRNA synthetase (ARS) is an enzyme essential for protein synthesis, linking amino acids to tRNA. Some ARSs are known to perform various functions both intracellularly and extracellularly in addition to their unique function related to protein synthesis. Among them, TARS (threonyl-tRNA synthetase, AmTARS) derived from Akkermansia muciniphila, a beneficial gut microbiome bacterium, has been found to be secreted into the intestinal environment, monitor the intestinal inflammatory environment, and perform anti-inflammatory functions through interaction with macrophages in inflammatory situations. Secreted AmTARS interacts with Toll-like receptor 2 (TLR2), an immune receptor on macrophages, to activate downstream MAPK and PI3K / AKT signaling, thereby promoting the differentiation of M2 macrophages. Ultimately, it promotes the activity of the transcriptional regulatory protein CREB, inducing the secretion of the anti-inflammatory cytokine IL-10. Through this, it plays a role in maintaining intestinal immune homeostasis by alleviating inflammation.

[0006]

[0007] Meanwhile, ARS (aminoacyl-tRNA synthetase) is an enzyme that links amino acids to transfer RNA (tRNA) in the early stage of protein synthesis. Some of the human AARS proteins are known to be secreted from cells and perform various functions. In particular, human TARS (threonyl-tRNA synthetase) has been reported to induce angiogenesis through inflammatory signals when secreted outside of cells, and to increase the synthesis of MUC1 (Mucin 1), one of the main proteins of mucin containing a large amount of threonine, in pancreatic cancer cells. In addition, it has been reported to function as a key component of the vertebrate-specific protein synthesis initiation complex, which is required for the protein synthesis of genes necessary for the development of blood vessels and nervous systems during the evolution from invertebrates to vertebrates.

[0008]

[0009] On the other hand, it has been confirmed that Akkermansia muciniphila, an intestinal microorganism that has been reported to play an important role in metabolic diseases through human immune regulation, specifically secretes TARS, and that TARS induces anti-inflammatory immune homeostasis by activating B cells by promoting IL-10 secretion by macrophages. However, it is difficult to culture / proliferate Akkermansia muciniphila in vitro, so there are limitations in utilizing the strain itself for the purpose of preventing or treating inflammatory diseases.

[0010]

[0011] Accordingly, the inventor of the present invention conducted repeated research to develop a transformed strain that not only stably produces and secretes AmTARS but also allows safe ingestion, and as a result, confirmed that a strain that stably produces and secretes AmTARS can be produced by transforming EcN using a vector composed of specific components and sequences, thereby completing the present invention.

[0012]

[0013] Accordingly, it is an object of the present invention to provide an Escherichia coli Nissle 1917 (EcN) strain transformed with a vector comprising a nucleic acid encoding TARS (AmTARS) of Akkermansia muciniphila.

[0014]

[0015] Another object of the present invention is to provide a composition for preventing, improving or treating inflammatory diseases, comprising the transformed EcN strain.

[0016]

[0017] Another object of the present invention is a vector comprising a 5'-homology arm, a promoter, a ribosome binding site consisting of a base sequence of SEQ ID NO: 2 (AGGAGGT), a nucleic acid encoding TARS (AmTARS) of Akkermansia muciniphila, and a 3'-homology arm,

[0018] The above 5'-homology arm is the exo gene and exo / cea intergenic region of Escherichia coli Nissle 1917 (EcN).

[0019] Contains base sequences corresponding to some of the

[0020] The above 3'-homology arm provides a vector comprising base sequences corresponding to the exo / cea intergenic region of EcN and part of the cea gene.

[0021]

[0022] Another object of the present invention is to provide the above vector;

[0023] A guide RNA (gRNA) comprising a sequence complementary to the exo gene, the exo / cea intergenic region, and a portion of the cea gene sequence of Escherichia coli Nissle 1917 (EcN); and

[0024] A composition for EcN transformation is provided, comprising a nucleic acid encoding a Cas protein.

[0025]

[0026] Another object of the present invention is to provide a method for producing EcN expressing TARS (AmTARS) of Akkermansia muciniphila, comprising the step of treating the composition to Escherichia coli Nissle 1917 (EcN).

[0027]

[0028] Another object of the present invention is to provide a use of the transformed EcN strain for preparing a composition for treating inflammatory diseases.

[0029]

[0030] Another object of the present invention is to provide a method for treating an inflammatory disease, which comprises administering an effective amount of a composition containing the transformed EcN strain as an active ingredient to a subject in need thereof.

[0031]

[0032] Another object of the present invention is to provide a composition for preventing, improving or treating inflammatory diseases comprising the transformed EcN strain.

[0033]

[0034] Another object of the present invention is to provide a composition for preventing, improving or treating inflammatory diseases, which consists essentially of the transformed EcN strain.

[0035]

[0036] In order to achieve the above-described object of the present invention, the present invention provides an Escherichia coli Nissle 1917 (EcN) strain transformed with a vector containing a nucleic acid encoding TARS (AmTARS) of Akkermansia muciniphila.

[0037]

[0038] In order to achieve another object of the present invention, the present invention provides a composition for preventing, improving or treating an inflammatory disease, comprising the transformed EcN strain.

[0039]

[0040] In order to achieve another object of the present invention, the present invention provides a vector comprising a 5'-homology arm, a promoter, a ribosome binding site consisting of a base sequence of SEQ ID NO: 2 (AGGAGGT), a nucleic acid encoding TARS (AmTARS) of Akkermansia muciniphila, and a 3'-homology arm,

[0041] The above 5'-homology arm includes a base sequence corresponding to a portion of the exo gene and exo / cea intergenic region of Escherichia coli Nissle 1917 (EcN),

[0042] The above 3'-homology arm provides a vector comprising base sequences corresponding to the exo / cea intergenic region of EcN and part of the cea gene.

[0043]

[0044] In order to achieve another object of the present invention, the present invention provides the vector;

[0045] A guide RNA (gRNA) comprising a sequence complementary to the exo gene, the exo / cea intergenic region, and a portion of the cea gene sequence of Escherichia coli Nissle 1917 (EcN); and

[0046] A composition for EcN transformation is provided, comprising a nucleic acid encoding a Cas protein.

[0047]

[0048] In order to achieve another object of the present invention, the present invention provides a method for producing EcN expressing TARS (AmTARS) of Akkermansia muciniphila, comprising the step of treating the composition to Escherichia coli Nissle 1917 (EcN).

[0049]

[0050] In order to achieve another object of the present invention, the present invention provides the use of the transformed EcN strain for preparing a composition for treating an inflammatory disease.

[0051]

[0052] In order to achieve another object of the present invention, the present invention provides a method for treating an inflammatory disease, which comprises administering an effective amount of a composition containing the transformed EcN strain as an active ingredient to a subject in need thereof.

[0053]

[0054] In order to achieve another object of the present invention, the present invention provides a composition for preventing, improving or treating an inflammatory disease comprising the transformed EcN strain.

[0055]

[0056] In order to achieve another object of the present invention, the present invention provides a composition for preventing, improving or treating an inflammatory disease, which essentially consists of the transformed EcN strain.

[0057] In this specification, the term "comprising" is used with the same meaning as "including" or "characterized by", and does not exclude additional components or method steps, etc. that are not specifically mentioned in the composition or method according to the present invention. In addition, the term "consisting of" means excluding additional elements, steps, or components, etc. that are not separately described. The term "essentially consisting of" means that, in the scope of the composition or method, it can include materials or steps, etc. that do not substantially affect the basic characteristics thereof, in addition to the materials or steps described.

[0058]

[0059] The 'effective amount' of the present invention refers to an amount that, when administered to an individual, exhibits an effect of improving, treating, detecting, diagnosing, or inhibiting or reducing an inflammatory disease or an inflammatory disease, and the 'individual' may be an animal, preferably a mammal, particularly an animal including a human, and may also be a cell, tissue, organ, etc. derived from an animal. The individual may be a patient in need of the effect.

[0060] The terms "nucleic acid," "nucleic acid molecule," "nucleic acid oligomer," "oligonucleotide," "nucleic acid sequence," "nucleic acid fragment," and "polynucleotide" are used interchangeably herein and are intended to encompass, but are not limited to, a polymeric form of covalently linked nucleotides, deoxyribonucleotides or ribonucleotides, or analogs, derivatives, or modifications thereof, which may have various lengths. Different polynucleotides may have different three-dimensional structures and may perform various functions, known or unknown. Non-limiting examples of polynucleotides include genes, gene fragments, exons, introns, intergenic DNA (including but not limited to heterochromatic DNA), messenger RNA (mRNA), transfer RNA, ribosomal RNA, ribozymes, cDNA, sgRNA, guide RNA, tracrRNA, recombinant polynucleotides, branched polynucleotides, plasmids, vectors, isolated DNA of the sequence, isolated RNA of the sequence, PCR products, nucleic acid probes, and primers. Polynucleotides useful in the methods of the present disclosure can include natural nucleic acid sequences and variants thereof, artificial nucleic acid sequences, or combinations of the above sequences.

[0061]

[0062] The terms "polypeptide," "peptide," and "protein" are used interchangeably herein to refer to a polymer of amino acid residues, wherein said polymer can be conjugated to a moiety that is not composed of amino acids. The terms apply to both naturally occurring and non-naturally occurring amino acid polymers, as well as amino acid polymers in which one or more amino acid residues are artificial chemical mimics of corresponding naturally occurring amino acids. A "fusion protein" refers to a chimeric protein encoding two or more distinct protein sequences that are recombinantly expressed as a single moiety.

[0063]

[0064] With respect to amino acid sequences, those skilled in the art will recognize that individual substitutions, deletions, or additions to a nucleic acid, peptide, polypeptide, or protein sequence that alter, add, or delete a single amino acid or a small percentage of the amino acids in the encoded sequence are "conservatively modified variants," resulting in the amino acid being replaced with a chemically similar amino acid. Conservative substitution tables providing functionally similar amino acids are generally known in the art. Such conservatively modified variants are in addition to, and do not exclude, the polymorphic variants, interspecies homologues, and alleles of the present disclosure.

[0065]

[0066] The following eight groups each contain amino acids that are conservative substitutions for one another: (1) alanine (A), glycine (G); (2) aspartic acid (D), glutamic acid (E); (3) asparagine (N), glutamine (Q); (4) arginine (R), lysine (K); (5) isoleucine (I), leucine (L), methionine (M), valine (V); (6) phenylalanine (F), tyrosine (Y), tryptophan (W); (7) serine (S), threonine (T); and (8) cysteine ​​(C), methionine (M).

[0067]

[0068] For certain proteins described herein, the named protein includes any naturally occurring form, natural or engineered variant, or homolog of the protein that retains the activity of the protein (e.g., is at least 50%, 80%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% as active as compared to the native protein). In embodiments, the variant or homolog has at least 90%, 95%, 96%, 97%, 98%, 99%, or 100% amino acid sequence identity to the naturally occurring form over the entire sequence or a portion of the sequence (e.g., a portion of 50, 100, 150, or 200 contiguous amino acids).

[0069]

[0070] As used herein, the term "homology arm" refers to a sequence homologous to an endogenous chromosomal nucleic acid sequence flanking the 5' and 3' directions of a desired genetic modification / replacement / insertion, for example, in the present invention, flanking the 5' and 3' directions of a position where a nucleic acid encoding AmTARS is to be inserted. The homologous nucleic acid sequences may be two or more nucleic acid sequences that are identical or similar enough to hybridize with each other or undergo intermolecular exchange. Due to the homology between the homology arms and the corresponding endogenous sequences, the homology arms guide a repair template to be inserted into a specific chromosomal location within the genome, i.e., between the 5'-homology arm and the 3'-homology arm and the corresponding endogenous sequence.

[0071]

[0072] As used herein, the term "homology-directed repair" or "HDR" refers to a cellular mechanism for correctly and accurately repairing double-stranded DNA breaks using a homologous template for guided repair. The underlying mechanism of HDR is homologous recombination (HR). The term "homologous recombination" or "HR" refers to the genetic process by which nucleotide sequences are exchanged between two similar DNA molecules.

[0073]

[0074] The term "CRISPR" or "clustered regularly interspaced short palindromic repeats" is used in the present invention in its general sense and refers to a genetic element that bacteria use as a type of acquired immunity to protect against viruses. CRISPR comprises a short sequence derived from a viral genome and integrated into the bacterial genome. The Cas (CRISPR-associated protein) protein processes this sequence and cleaves the matching viral DNA sequence. Thus, the CRISPR sequence serves to guide Cas to recognize and cleave DNA that is at least partially complementary to the CRISPR sequence. By introducing a plasmid containing the Cas gene and a specifically constructed CRISPR into a eukaryotic cell, the eukaryotic genome can be cut at any desired location. Non-limiting examples of Cas proteins include Cas1, Cas1B, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9 (also known as Csn1 and Csx12), Cas10, Cas12, Cas13, Csy1, Csy2, Csy3, Cse1, Cse2, Csc1, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmr1, Cmr3, Cmr4, Cmr5, Cmr6, Csb1, Csb2, Csb3, Csx17, Csx14, Csx10, Csx16, CsaX, Csx3, Csx1, Csx15, Csf1, Csf2, Csf3, Csf4, a homolog thereof, or a modified version thereof.

[0075]

[0076] The term "Cas9" or "CRISPR-associated protein 9" is used herein according to its plain ordinary meaning and refers to an enzyme that uses a CRISPR sequence as a guide to recognize and cleave a specific strand of DNA that is at least partially complementary to the CRISPR sequence. The Cas9 enzyme, together with the CRISPR sequence, forms the basis of the technology known as CRISPR-Cas9, which can be used to edit genes in organisms. "Cas9", "Csn1" or "Cas9 protein" includes any recombinant or naturally occurring form of the Cas9 endonuclease or a variant or homologue thereof that retains Cas9 endonuclease enzymatic activity (e.g., at least 50%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% the activity compared to Cas9). In one embodiment, the variant or homolog has at least 90%, 95%, 96%, 97%, 98%, 99% or 100% amino acid sequence identity to a naturally occurring Cas9 protein over the entire sequence or a portion of the sequence (e.g., a portion of 50, 100, 150 or 200 contiguous amino acids). In one embodiment, the Cas9 protein is substantially identical to a protein identified by UniProt reference number Q99ZW2 or a variant or homolog having substantial identity thereto. In one embodiment, the Cas9 protein has at least 75%, 80%, 85%, 90% or 95% sequence identity to the amino acid sequence of the protein identified by UniProt reference number Q99ZW2. In one aspect, the Cas9 enzyme may be S. pneumoniae, S. pyogenes or S. thermophilus Cas9, or a mutant derived therefrom in said organisms.

[0077]

[0078] The term "CRISPR-associated endonuclease Cas12a", "Cas12a", "Cas12" or "Cas12 protein" in the present invention includes any recombinant or naturally occurring form of Cas12 endonuclease or variant or homolog thereof that retains Cas12 endonuclease enzymatic activity (e.g., within at least 50%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% activity compared to Cas12). In one aspect, the variant or homologue has at least 90%, 95%, 96%, 97%, 98%, 99% or 100% amino acid sequence identity to a naturally occurring Cas12 protein over the entire sequence or a portion of the sequence (e.g., a portion of 50, 100, 150 or 200 contiguous amino acids). In aspects, the Cas12 protein is substantially identical to the protein identified by UniProt Reference Number A0Q7Q2 or a variant or homologue having substantial identity thereto.

[0079]

[0080] The term "CRISPR-associated endoribonuclease Cas13a", "Cas13a", "Cas13" or "Cas13 protein" in the present invention includes any recombinant or naturally occurring form of Cas13 endoribonuclease or variant or homolog thereof that retains Cas13 endoribonuclease enzymatic activity (e.g., within at least 50%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% activity compared to Cas13). In one aspect, the variant or homologue has at least 90%, 95%, 96%, 97%, 98%, 99%, or 100% amino acid sequence identity to a naturally occurring Cas13 protein over the entire sequence or a portion of the sequence (e.g., a portion of 50, 100, 150, or 200 contiguous amino acids). In aspects, the Cas13 protein is substantially identical to a protein identified by UniProt Reference Number P0DPB8 or a variant or homologue having substantial identity thereto.

[0081]

[0082] As used herein, the term "guide RNA" or "gRNA" refers to an RNA sequence having sufficient complementarity to a target polynucleotide sequence to hybridize with the target sequence and direct sequence-specific binding of a CRISPR complex to the target sequence. For example, the gRNA can guide Cas to the target polynucleotide. In embodiments, the gRNA comprises a crRNA and a tracrRNA. For example, the gRNA can comprise a crRNA and a tracrRNA that are hybridized by base pairing. Thus, in embodiments, the two RNAs can be separately encoded by the crRNA and the tracrRNA as two RNA molecules, which then form an RNA / RNA complex due to complementary base pairing between the crRNA and the tracrRNA. In one aspect, the degree of complementarity between the guide RNA sequence and its corresponding target sequence is about 50%, 60%, 75%, 80%, 85%, 90%, 95%, 97.5%, 99% or more when optimally aligned using a suitable alignment algorithm.

[0083]

[0084] The terms "sgRNA," "single guide RNA," and "single guide RNA sequence" are used interchangeably and refer to an RNA sequence comprising a crRNA sequence and a tracrRNA sequence. For example, the sgRNA may be a single RNA sequence comprising a crRNA and a tracrRNA. For example, the sgRNA may be a fusion sequence comprising a crRNA and a tracrRNA. In embodiments, the sgRNA is synthesized in vitro. In embodiments, the sgRNA is produced in vivo from a DNA sequence encoding the sgRNA.

[0085]

[0086] The term "crRNA" in the present invention refers to CRISPR RNA, a short guide RNA containing a unique single-repeated spacer unit. In bacterial cells, crRNA targets foreign DNA and prevents the invasion of cognate foreign genomes. Therefore, short mature crRNA is a key element in the interference step of the immune pathway. The crRNA contains a nucleotide sequence that is at least partially complementary to the target DNA. Thus, the crRNA directs target sequence recognition and enables specificity for the CRISPR gene editing mechanism. In embodiments, the crRNA may be provided as a pre-crRNA. The pre-crRNA may form an RNA duplex by complexing with an at least partially complementary region of a tracrRNA. The pre-crRNA may be cleaved by a ribonuclease (e.g., RNase III) to generate a crRNA / tracrRNA hybrid. The hybrid serves as a guide for the endonuclease Cas9, which cleaves the invading nucleic acid.

[0087]

[0088] As used herein, the term "tracrRNA" or "trans-activating crRNA" refers to a small trans-encoded RNA. TracrRNA is at least partially complementary to and base-pairs with crRNA, thereby forming an RNA duplex. In embodiments, the tracrRNA forms an RNA duplex with pre-crRNA. TracrRNA can noncovalently bind to Cas (e.g., Cas9), thereby functioning as a binding scaffold for Cas. In embodiments, recognition and binding of tracrRNA by Cas results in the formation of a Cas9 / tracrRNA / crRNA complex.

[0089]

[0090] In the present invention, the terms "electroporation," "electropermeabilization," and "electrotransfer" are used according to their ordinary and general meanings and refer to a technique in which an electric field is applied to a cell to increase the permeability of the cell membrane, thereby allowing a chemical, drug, protein, or nucleic acid, or a combination thereof, to be introduced into the cell. The cell is then carefully handled until it has a chance to divide. This process is about 10 times more effective than chemical modification. Accordingly, the term "electroporation enhancer" refers to a compound or composition that improves the delivery of a chemical, drug compound, protein, or nucleic acid into a cell, improves the efficiency of genetic modification of a cell, and / or increases the level of cell survival after transfection. In embodiments, the electroporation enhancer improves the delivery of a chemical, drug compound, protein, or nucleic acid into a cell. In embodiments, the electroporation enhancer increases the efficiency of genetic modification in a cell. In embodiments, the electroporation booster increases the efficiency of genetic modification in a cell compared to the efficiency of genetic modification in the absence of the electroporation booster. In embodiments, the electroporation booster increases the level of cell viability after transfection. In embodiments, the electroporation booster increases the level of cell viability after transfection compared to the level of cell viability after transfection in the absence of the electroporation booster.

[0091]

[0092] In the present invention, the term "transfection" is used in its ordinary and general sense, and means the process of intentionally introducing naked or purified nucleic acid into a eukaryotic cell.

[0093]

[0094] Hereinafter, the present invention will be described in detail.

[0095]

[0096] The present invention provides an Escherichia coli Nissle 1917 (EcN) strain transformed with a vector comprising a nucleic acid encoding TARS (AmTARS) of Akkermansia muciniphila.

[0097]

[0098] In the present invention, the strain may be characterized by expressing AmTARS.

[0099]

[0100] In the present invention, the term “expression” means producing and / or secreting AmTARS.

[0101]

[0102] In one aspect of the present invention, the vector may be characterized by including a 5'-homology arm, a promoter, a ribosome binding site consisting of a base sequence of SEQ ID NO: 2 (AGGAGGT), a nucleic acid encoding TARS (AmTARS) of Akkermansia muciniphila, and a 3'-homology arm.

[0103]

[0104] In one aspect of the present invention, the promoter is a lac promoter, a trp promoter, a Tac promoter, a lacUV5 promoter, an lpp promoter, a pLλ promoter, a pRλ promoter, a rac5 promoter, an amp promoter, a recA promoter, an SP6 promoter, a trp promoter, a T7 promoter, a pBAD promoter, a Tet promoter, a trc promoter, a pepT promoter, a sulA promoter, a pol 11(dinA) promoter, a ruv promoter, an uvrA promoter, an uvrB promoter, an uvrD promoter, an umuDC promoter, an lexA promoter, an cea promoter, an caa promoter, an recN promoter, an pagC promoter, an hip promoter, an ansB promoter, an pflE promoter, and an tetR / A promoter. The promoter may be selected from the group consisting of, but is not limited to, a lac promoter, a trp promoter and a Tac promoter, and most preferably a Tac promoter. According to one embodiment of the present invention, the promoter may be characterized by consisting of the base sequence of SEQ ID NO: 6, or exhibiting a sequence homology of 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% thereto.

[0105]

[0106] [Sequence number 6]

[0107] ttgacaattaatcatcggctcgtataatg

[0108]

[0109] In the present invention, the term "TARS (threonyl-tRNA synthetase)" refers to one of the AARS (Aminoacyl-tRNA synthetases), which are enzymes that link amino acids to transfer RNA (tRNA) in the early stage of protein synthesis. Some of the human-derived AARS proteins are known to be secreted from cells and perform various functions. Representatively, human YARS (tyrosyl-tRNA synthetase) is known to be secreted outside of cells and perform a cytokine-like function under certain circumstances, and human KARS (lysyl-tRNA synthetase) is known to stimulate immune cells and promote an inflammatory response. In particular, human TARS (threonyl-tRNA synthetase) has been reported to induce angiogenesis through inflammatory signals when secreted outside of cells, and to increase the synthesis of MUC1 (Mucin 1), one of the main proteins of mucin containing a large amount of threonine, in pancreatic cancer cells. In addition, it has been reported to function as a key component of the vertebrate-specific protein synthesis initiation complex required for protein synthesis of genes necessary for the development of blood vessels and nervous systems during the evolution from invertebrates to vertebrates.

[0110]

[0111] In the present invention, the TARS (AmTARS) of Akkermansia muciniphila may include, for example, an amino acid sequence of SEQ ID NO: 7, but is not limited thereto. The protein including the amino acid sequence of SEQ ID NO: 7 may be used interchangeably with a protein having the amino acid sequence of SEQ ID NO: 7 or a protein composed of the amino acid sequence of SEQ ID NO: 7.

[0112]

[0113] [Sequence number 7]

[0114] MSEHKERKTLEERQQMSDLERLRHSCAHVLATAICRLWPDAQLAGGPAVDNGFYYDVELDHRISTEDFERIEEEMKKVVKENQVFQKEVISRADAMKMAESGELGALGPRSEPSRFKIDLLNDIPEDEEISLYRNGDFTDLCAGPHVGRTGNCKAFKIMSVASAFYKGDKNRPMLQRIYGTCFPNRTQLDEHLERLEEARRRDHRKLGRELGLFCIDESVGQGLILWKPKGALIRRSLQDFITEELDKLGYSQVYTPNIGKLDLYRTSGHFPYYQESQYAPIPERDAMEKLSQEGASCAELFNGLATGTIEGYMLKPMNCPHHIKIYANDAHSYRDLPVRLAEFGTVYRWEQSGELGGMTRVRGFTQDDAHIFCTPDQLAGEIRQCLGIVKTIFGTLGMTDYRVRLSMRDPESDKYVGSPENWDKAEQALREAAEWLGADYSEEAGEAAFYGPKIDFIVRDAIGREWQLGTVQVDYNLPERFDLHYTGADNKPHRPVMVHRAPFGSMERFTGLLIEHFEGKFPTWLSPEQVRVLPISDKVTDVAAAHRTALAARGVRVTVDETPDKIGAKIRNARLDRVPYMLVLGQREAEDGTVSVRHRDKGDLGAMPFEQFADLVAREIAERHISPVI

[0115]

[0116] In the present invention, the above sequence number 7 refers to an amino acid sequence having TARS activity. Specifically, the above sequence number 7 may be a protein sequence having TARS activity encoded by a gene encoding TARS. For the purposes of the present invention, the protein may be specifically derived from the genus Akkermansia (Akkermansia sp.), and more specifically, may be derived from Akkermansia muciniphila, but is not limited thereto, and a sequence having the same activity as the above amino acid may be included without limitation. The amino acid sequence of the above sequence number 7 can be obtained from the known database GenBank (GenBank: ACD05550.1). The above TARS may be used interchangeably with AmTARS (TARS derived from Akkermansia muciniphila).

[0117]

[0118] In addition, although the protein having TARS activity in the present invention is defined as a protein comprising the amino acid sequence of SEQ ID NO: 7, this does not exclude meaningless sequence additions before and after the amino acid sequence of SEQ ID NO: 7, mutations that may occur naturally, or silent mutations thereof. It is obvious to those skilled in the art that if it has the same or corresponding activity as the protein comprising the amino acid sequence of SEQ ID NO: 7, it corresponds to the protein having TARS activity of the present invention.

[0119]

[0120] For example, the protein having TARS activity of the present invention may be a protein composed of an amino acid sequence of SEQ ID NO: 7 or an amino acid sequence having 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% or more homology or identity thereto. In addition, it is obvious that a protein composed of an amino acid sequence in which a portion of the sequence is deleted, modified, substituted, or added is also included within the scope of the protein of the present invention, as long as it has such homology or identity and exhibits an effect corresponding to the protein.

[0121]

[0122] That is, even if the present invention describes a "protein or polypeptide consisting of an amino acid sequence described by a specific sequence number," it is obvious that a protein consisting of an amino acid sequence in which some sequences are deleted, modified, substituted, or added can also be used in the present invention if it has the same or corresponding activity as a polypeptide consisting of the amino acid sequence of the corresponding sequence number. For example, it is obvious that a "polypeptide consisting of the amino acid sequence of SEQ ID NO: 7" can belong to a "polypeptide consisting of the amino acid sequence of SEQ ID NO: 7" if it has the same or corresponding activity.

[0123]

[0124] As used herein, the term "homology" or "identity" refers to the percentage of identity between two polynucleotides or polypeptide moieties. The sequence homology from one moiety to another moiety can be determined by known techniques. For example, the homology between two moieties can be determined by directly aligning the sequence information between two polynucleotide molecules or two polypeptide molecules using readily available computer programs. Alternatively, the homology between polynucleotides can be determined by hybridizing the polynucleotides under conditions that form a stable duplex between the homologous regions, followed by digestion with a single-strand-specific nuclease and determining the size of the digested fragments.

[0125]

[0126] In the present invention, the nucleic acid encoding the TARS may be derived from the genus Akkermansia, more specifically from Akkermansia muciniphila (i.e., AmTARS), but is not particularly limited as long as it is an Akkermansia microorganism capable of expressing a gene encoding TARS. The gene encoding the TARS may include a base sequence encoding the amino acid sequence of SEQ ID NO: 7, and more specifically, may include a base sequence of SEQ ID NO: 1, but is not limited thereto.

[0127]

[0128] [Sequence number 1]

[0129] TGGCGGAATTCGGCACGGTGTACCGTTGGGAACAGAGCGGAGAGCTGGGCGGCATGACGCGCGTGCGCGGTTTCACGCAGGATGACGCCCATATCTTCTGCACGCCGGACCAGCTTGCCGGGGAAATCCGCCAGTGCCTGGGCATCGTGAAAACCATTTTCGGTACGCTGGGCATGACGGACTACCGCGTGCGCCTTTCCATGCGCGACCCGGAAAGCGACAAATACGTGGGTTCTCCGGAAAATTGGGACAAAGCGGAACAGGCTCTGCGGGAAGCTGCGGAATGGCTGGGGGCGGACTACAGCGAGGAAGCTGGGGAAGCCGCCTTCTACGGCCCCAAGATCGACTTCATCGTGCGCGACGCCATCGGCCGCGAATGGCAGCTGGGAACCGTGCAGGTGGACTACAACCTGCCGGAACGCTTTGACCTCCATTACACCGGAGCGGACAACAAGCCGCACCGGCCCGTGATGGTGCACCGCGCCCCCTTCGGCTCCATGGAACGCTTCACGGGGCTTCTGATTGAACACTTTGAAGGCAAATTCCCCACCTGGCTTTCCCCGGAACAGGTGCGCGTGCTTCCCATCTCCGACAAGGTGACGGACGTGGCCGCCGCGCATCGAACCGCCCTGGCCGCCAGAGGCGTGCGCGTCACGGTGGACGAAACGCCGGACAAAATAGGCGCCAAAATCCGCAATGCCCGTCTGGACCGCGTTCCCTACATGCTGGTGCTCGGCCAGCGGGAGGCGGAAGACGGCACCGTCTCCGTCCGCCACCGGGACAAGGGGGATCTGGGCGCGATGCCCTTTGAGCAATTCGCGGACCTCGTAGCCCGGGAAATCGCGGAGCGTCATATTTCTCCCGTGATTTGA

[0130]

[0131] In the present invention, the term "polynucleotide" means a polymer of nucleotides in which nucleotide units (monomers) are covalently bonded to form a long chain, and is a DNA or RNA strand of a certain length or longer, and more specifically, a polynucleotide fragment encoding the variant.

[0132]

[0133] Specifically, the polynucleotide of the present invention may have various modifications in the coding region within a range that does not change the amino acid sequence of the polypeptide due to codon degeneracy or taking into account codons preferred in the organism to which the polypeptide is to be expressed. Specifically, any polynucleotide sequence encoding the TARS of the present invention may be included without limitation.

[0134]

[0135] In one aspect of the present invention, the exo gene may be characterized by consisting of a base sequence of sequence number 3.

[0136]

[0137] [Sequence number 3]

[0138] Tgaaaccagactgaagcccacggtcgtcatcgggacgcaggccgccgccgtgcatggtatcagtgagcaggcactctgcggagcaccatcatggactgatgtggtgcggcaa ctgcgtcatgcaatcggggaccgaccagtaattatctttaatgcccggttcgacatccgcattctgaaaaagactgctgccgcacatagcgatccggctgactggctggaag aactgacggtatattgtgtgatggagctggctgcaggatattatggagcctccaaccgctatggcactatttcactggcctgtgctgccagccagaccggactgaactggga agggcaggcacactcagcgatcgctgacgcacggatgacggcaggggtggtaaacgctattgctgcatatcatctggaactgctgcaggaacaggcacggctgaaaacctga

[0139]

[0140] In one aspect of the present invention, the exo / cea intergenic region may be characterized by being composed of a base sequence of SEQ ID NO: 4.

[0141]

[0142] [Sequence number 4]

[0143] Ctgcctggcctgtataccgcaatcatttacgttatccagacgtaaatatatcaataaatagcaatcccccagatac

[0144]

[0145] In one aspect of the present invention, the cea gene may be characterized by consisting of a base sequence of sequence number 5.

[0146]

[0147] [Sequence number 5]

[0148] Ctaatgtagttccagcaagcacggccgggcagcttgttctgcctgcgttttcttcaattgagcagtagaccatttagctgtggcatgaatggctgcagaactttcactgttgctacctcc agttccaccaccgctgccagagccactcccgtctggattatcattcaaaagagtaatgattacctgccccttatcatcataaggaacaccatctttatagtacgctacagctgtttccat

[0149]

[0150] In one aspect of the present invention, the vector can be utilized as a repair template for inserting a nucleic acid encoding AmTARS into the exo / cea intergenic region in the genome of an EcN strain.

[0151]

[0152] In one aspect of the present invention, the vector may be in the form of linear DNA. In one example, the linear DNA may be produced by cutting the vector using a restriction enzyme or amplifying it using polymerase chain reaction (PCR). In addition, the vector may be a recombinant vector or a DNA strand.

[0153]

[0154] In one aspect of the present invention, the vector may be characterized by including a 5'-homology arm, a promoter, a ribosome binding site consisting of a base sequence of SEQ ID NO: 2 (AGGAGGT), a nucleic acid encoding TARS (AmTARS) of Akkermansia muciniphila, and a 3'-homology arm.

[0155]

[0156] In one aspect of the present invention, the homology arms (i.e., 5' and / or 3'-homology arms) may include a base sequence corresponding to a portion of the exo gene and the exo / cea intergenic region of Escherichia coli Nissle 1917 (EcN), and the 3'-homology arm may include a base sequence corresponding to a portion of the exo / cea intergenic region and the cea gene of EcN, such that the nucleic acid encoding the AmTARS can be inserted into the exo / cea intergenic region in the EcN strain genome.

[0157]

[0158] The length of the above homology arms can be appropriately adjusted as needed, for example, 50 to 1200 bp, 50 to 1000 bp, 50 to 800 bp, 50 to 700 bp, 50 to 600 bp, 50 to 500 bp, 100 to 1200 bp, 100 to 1000 bp, 100 to 800 bp, 100 to 700 bp, 100 to 600 bp, 100 to 500 bp, 200 to 1200 bp, 200 to 1000 bp, 200 to 800 bp, 200 to 700 bp, 200 to 600 bp, 200 to 500 bp, 300 to It may be, but is not limited to, 1200 bp, 300 to 1000 bp, 300 to 800 bp, 300 to 600 bp, or 300 to 500 bp.

[0159]

[0160] If the length of the homology arm is too short, the efficiency of homology-directed repair or homologous recombination may decrease, and if the homology arm is too long, the size of the vector introduced into the cell may become excessively large, which may lower the transfection efficiency.

[0161]

[0162] The above homology arm can be appropriately selected and designed by a person skilled in the art according to the target location (i.e., the exo / cea intergenic region of EcN in the present invention) to which the target gene (i.e., the nucleic acid encoding AmTARS in the present invention) is to be introduced.

[0163]

[0164] Among the above homology arms, the homology arm attached to the 5' end of the target gene may include a nucleic acid sequence in which the PAM (protospacer adjacent motif) sequence is replaced with another sequence. The PAM sequence is known to serve to designate the position at which the Cas9 protein (Cas restriction enzyme) cuts, and generally has the sequence of NGG. In this case, each "N" base of the PAM sequence represents an "A", "T", "G", or "C" base. In the present specification, the PAM sequence may mean "NNGG", which includes one more base at the 5' end of the generally known "NGG" sequence.

[0165]

[0166] The nucleic acid sequence replacing the above PAM sequence can be used without limitation as long as it is not a sequence of 'NNGG' within the scope of the purpose of not being specifically recognized by Cas9, and for example, the NNGG nucleic acid sequence can be replaced with a nucleic acid sequence of NNAA, NNAT, NNAG, NNAC, NNTA, NNTT, NNTG, NNTC, NNCA, NNCT, NNCG, NNCC, NNGA, NNGT, or NNGC.

[0167]

[0168] If the homology arm without the PAM sequence being replaced is attached to the 5' end of the target gene, there is a risk that the Cas9 protein will re-recognize the site and cut it again when the target gene is repeatedly introduced.

[0169]

[0170] In addition to the essential components of the target protein, AmTARS, the vector may contain additional components necessary for protein expression within cells.

[0171]

[0172] For example, the additional components may include expression control elements, selection elements, etc.

[0173]

[0174] The above expression control elements may be a promoter, an enhancer, a polyadenylation signal, a Kozak consensus sequence, an inverted terminal repeat (ITR), a long terminal repeat (LTR), a terminator, an internal ribosome entry site (IRES), a 2A self-cleaving peptide, etc.

[0175]

[0176] For example, the promoter may be a lac promoter, a trp promoter, a Tac promoter, an SV40 early promoter, a mouse mammary tumor virus long terminal repeat (LTR) promoter, an adenovirus major late (Ad MLP) promoter, a herpes simplex virus (HSV) promoter, a cytomegalovirus (CMV) promoter, a rous sarcoma virus (RSV) promoter, a U6 promoter, or the like.

[0177]

[0178] For example, the 2A self-cleaving peptide may be T2A, P2A, E2A, F2A, etc. The vector for expressing the differentiation factor may contain one or more 2A self-cleaving peptides. In this case, the 2A self-cleaving peptides produce multiple proteins from the same transcript. Therefore, the 2A self-cleaving peptide may be positioned between two or more different proteins to be expressed within the vector.

[0179]

[0180] The above selection elements may be fluorescent protein genes, tags, reporter genes, antibiotic resistance genes, etc.

[0181]

[0182] For example, the fluorescent protein gene may be a GFP gene, a YFP gene, an RFP gene, or an mCherry gene.

[0183]

[0184] For example, the tag may be a histidine (His) tag, a V5 tag, a FLAG tag, an influenza hemagglutinin (HA) tag, a Myc tag, a VSV-G tag, and a thioredoxin (Trx) tag.

[0185]

[0186] For example, the reporter gene may be glutathione-S-transferase (GST), horseradish peroxidase (HRP), chloramphenicol acetyltransferase (CAT), beta-galactosidase, beta-glucuronidase, etc.

[0187]

[0188] For example, the antibiotic resistance gene may be a hygromycin resistant gene, a neomycin resistant gene, a kanamycin resistant gene, a blasticidin resistant gene, a zeocin resistant gene, etc.

[0189]

[0190] In one aspect of the present invention, the vector may comprise a base sequence of SEQ ID NO: 8.

[0191]

[0192] The present invention also provides a pharmaceutical composition for preventing or treating inflammatory diseases, comprising an EcN strain transformed according to the above method and expressing AmTARS as an active ingredient.

[0193]

[0194] In the present invention, the inflammatory disease refers to a general term for diseases in which inflammation is the main lesion.

[0195]

[0196] The inflammatory disease may include, for example, inflammatory bowel disease (IBD), edema, dermatitis, conjunctivitis, periodontitis, rhinitis, otitis media, pharyngitis, tonsillitis, pneumonia, gout, recurrent spondylitis, gastritis, psoriatic arthritis, osteoarthritis, periarthritis, tendonitis, tenosynovitis, myositis, hepatitis, lymphangitis, felon, urinary tract infection, peritonitis, cystitis, nephritis, respiratory disease, and sepsis, and may be specifically inflammatory bowel disease, and more specifically, may be at least one selected from the group consisting of colitis, ulcerative colitis, Crohn's disease, and Behcet's enteritis, but is not limited thereto.

[0197]

[0198] The inflammatory disease of the present invention may include immune diseases, metabolic diseases, and infectious diseases accompanied by inflammation.

[0199]

[0200] The above "immune disease accompanied by inflammation" includes, for example, autoimmune disease, transplant rejection, graft-versus-host disease, etc., and the autoimmune disease may specifically include atopy, allergy, rheumatoid arthritis, Hashimoto's thyroiditis, multiple sclerosis, endometriosis, psoriasis, asthma, hypothyroidism, hyperthyroidism, Behcet's disease, myasthenia gravis, Meniere's syndrome, Guilian-Barre syndrome, Sjogren's syndrome, vitiligo, and systemic scleroderma, and may specifically be an inflammatory bowel disease, and more specifically may be at least one selected from the group consisting of atopy, allergy, rheumatoid arthritis, Hashimoto's thyroiditis, multiple sclerosis, endometriosis, psoriasis, hypothyroidism, hyperthyroidism, and asthma, but is not limited thereto.

[0201]

[0202] Recently, research results have been reported that metabolic diseases are caused by increased expression of inflammatory factors, and thus, the metabolic diseases can be caused by inflammation or accompanied by inflammation. The "metabolic disease accompanied by inflammation" may include obesity, diabetes, insulin resistance, lipid metabolism disorders, hypertriglyceridemia, increased free fatty acids, decreased high-density cholesterol, hypertension, and various complications caused therefrom, and specifically, may be at least one selected from the group consisting of obesity and diabetes, but is not limited thereto.

[0203]

[0204] The above "infectious disease with inflammation" refers to an inflammatory disease caused by the spread or invasion of disease-causing pathogens, such as viruses, bacteria, fungi, or parasites, into animals or humans. The inflammatory disease is as described above.

[0205]

[0206] In the present invention, the transformed strain can increase secretion of IL-10.

[0207]

[0208] In the present invention, the term "prevention" means any act of suppressing or delaying the onset of an inflammatory disease by administering the composition of the present invention, and "treatment" means any act of improving or beneficially changing the symptoms of an inflammatory disease by administering the composition.

[0209]

[0210] The 'treatment' of the present invention comprehensively refers to improving symptoms caused by the inflammatory disease, which may include curing, substantially preventing, or improving the condition of the disease, and includes, but is not limited to, alleviating, curing, or preventing one or most of the symptoms resulting from the disease.

[0211]

[0212] The pharmaceutical composition of the present invention may additionally include an appropriate carrier, excipient or diluent commonly used in the manufacture of pharmaceutical compositions.

[0213]

[0214] The above pharmaceutical composition may have any one dosage form selected from the group consisting of tablets, pills, powders, granules, capsules, oral solutions, syrups, sterilized aqueous solutions, non-aqueous solvents, suspensions, emulsions, lyophilized preparations, and suppositories, and may be various oral or parenteral dosage forms. When formulated, it is prepared using diluents or excipients such as commonly used fillers, bulking agents, binders, wetting agents, disintegrants, and surfactants. Solid preparations for oral administration include tablets, pills, powders, granules, capsules, etc., and these solid preparations are prepared by mixing one or more compounds with at least one excipient, such as starch, calcium carbonate, sucrose or lactose, gelatin, etc. In addition to simple excipients, lubricants such as magnesium stearate and talc are also used. Liquid preparations for oral administration include suspensions, solutions, emulsions, and syrups. In addition to commonly used simple diluents such as water and liquid paraffin, they may contain various excipients such as wetting agents, sweeteners, fragrances, and preservatives. Preparations for parenteral administration include sterile aqueous solutions, non-aqueous solvents, suspensions, emulsions, lyophilized preparations, and suppositories. Non-aqueous solvents and suspensions can include propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable esters such as ethyl oleate. Suppository bases can include witepsol, macrogol, Tween 61, cacao butter, laurin butter, and glycerogelatin.

[0215]

[0216] The composition of the present invention can be administered in a pharmaceutically effective amount.

[0217]

[0218] As used herein, the term "pharmaceutically effective amount" means an amount sufficient to treat a disease at a reasonable benefit / risk ratio applicable to medical treatment, and the effective dosage level can be determined according to factors including the type and severity of the individual, age, sex, type of disease, activity of the drug, sensitivity to the drug, time of administration, route of administration and excretion rate, duration of treatment, concurrently used drugs, and other factors well known in the medical field. The composition of the present invention can be administered as an individual therapeutic agent or in combination with other therapeutic agents, and can be administered sequentially or simultaneously with conventional therapeutic agents. And it can be administered singly or in multiple doses. It is important to administer an amount that can achieve the maximum effect with the minimum amount without side effects by taking all of the above factors into consideration, and it can be easily determined by those skilled in the art. The preferred dosage of the composition of the present invention varies depending on the patient's condition and weight, the degree of the disease, the drug form, the route and period of administration, but for a desirable effect, the TARS or a fragment thereof derived from Akkermansia muciniphila of the present invention is preferably administered at 0.0001 to 100 μg / kg per day, preferably 0.001 to 100 μg / kg. Administration may be administered once a day or divided into several times. The composition may be administered to various mammals such as rats, livestock, and humans through various routes, and the method of administration includes, without limitation, any conventional method in the art, and may be administered, for example, by oral, rectal, intravenous, intramuscular, subcutaneous, intrauterine, or intracerebrovascular injection.

[0219]

[0220] In the present invention, the content of the composition is not particularly limited depending on the purpose or aspect of use, and may be, for example, 0.01 to 99 wt%, preferably 0.5 to 50 wt%, and more preferably 1 to 30 wt%, based on the total weight of the composition. In addition, the pharmaceutical composition according to the present invention may further include additives such as pharmaceutically acceptable carriers, excipients, or diluents in addition to the active ingredient. The pharmaceutical composition of the present invention may include 0.1 to 99.9 wt% of the strain produced by the method of the present invention, and may include 99.9% to 0.1 wt% of the carrier.

[0221]

[0222] In addition, the pharmaceutical composition of the present invention can be used not only as a medicine for humans but also as a form of an animal medicine.

[0223]

[0224] The present invention also provides a food composition for preventing or improving inflammatory diseases, which comprises the transformed strain as an effective ingredient.

[0225]

[0226] In the present invention, the term "improvement" refers to any act of improving or benefiting the symptoms of a suspected inflammatory disease or an invention subject by using the composition.

[0227]

[0228] The food-grade acceptable salt that can be included in the food composition of the present invention is usefully an acid addition salt formed by a food-grade acceptable free acid or a metal salt formed by a base. As an example, the free acid may be an inorganic acid or an organic acid. The inorganic acid may be hydrochloric acid, sulfuric acid, hydrobromic acid, sulfurous acid, phosphoric acid, etc., and the organic acid may be citric acid, acetic acid, maleic acid, fumaric acid, gluconic acid, methanesulfonic acid, etc. In addition, the metal salt may be an alkali metal salt or an alkaline earth metal salt, sodium, potassium, or calcium salt. However, the present invention is not limited thereto.

[0229]

[0230] The food composition of the present invention includes forms such as pills, powders, granules, infusions, tablets, capsules or liquids, and foods to which the composition can be added include, for example, various foods, such as beverages, gum, tea, vitamin complexes, and health supplements.

[0231]

[0232] Ingredients that may be included in the food composition of the present invention, other than those containing the effective ingredient as an essential ingredient, are not particularly limited, and, like conventional foods, various herbal extracts, food additives, or natural carbohydrates may be included as additional ingredients. The content of the effective ingredient in the food composition may be appropriately determined depending on the intended use (prevention, improvement, or therapeutic treatment). At this time, the content of the effective ingredient included in the composition is not particularly limited thereto, but may be 0.0001 wt% to 10 wt%, preferably 0.001 wt% to 1 wt%, based on the total weight of the composition.

[0233]

[0234] In addition, the food auxiliary additive may include food auxiliary additives conventional in the art, such as flavoring agents, flavoring agents, coloring agents, fillers, stabilizers, etc.

[0235]

[0236] Examples of the above natural carbohydrates include monosaccharides such as glucose, fructose, etc.; disaccharides such as maltose, sucrose, etc.; and polysaccharides such as dextrin, cyclodextrin, etc., common sugars, and sugar alcohols such as xylitol, sorbitol, erythritol, etc. In addition to those described above, natural flavoring agents (e.g., rebaudioside A, glycyrrhizin, etc.) and synthetic flavoring agents (saccharin, aspartame, etc.) can be advantageously used as flavoring agents.

[0237]

[0238] In addition to the above, the food composition of the present invention may contain various nutrients, vitamins, minerals (electrolytes), flavoring agents such as synthetic flavoring agents and natural flavoring agents, coloring agents and fillers (cheese, chocolate, etc.), pectic acid and its salts, alginic acid and its salts, organic acids, protective colloid thickeners, pH adjusters, stabilizers, preservatives, glycerin, alcohol, carbonating agents used in carbonated beverages, etc. In addition, it may contain fruit pulp for the production of natural fruit juices, fruit juice drinks, and vegetable drinks. These ingredients may be used independently or in combination.

[0239]

[0240] In the present invention, the health supplement may include health functional foods and health foods.

[0241]

[0242] The term "functional food" refers to foods with high medical and therapeutic effects, synonymous with "food for special health use" (FoSHU). These foods are processed to effectively exhibit bioregulatory functions in addition to providing nutrition. "Functionality" here refers to achieving beneficial health effects, such as regulating nutrients or physiological effects on the structure and function of the human body.

[0243]

[0244] A food comprising the food composition of the present invention can be manufactured using methods commonly used in the art, and during the manufacturing process, raw materials and ingredients commonly added in the art can be added. Furthermore, any formulation of the food can be manufactured without limitation, as long as it is a formulation recognized as a food. The food composition of the present invention can be manufactured in various forms, and unlike general drugs, it has the advantage of not having side effects that can occur with long-term use of drugs since it uses food as a raw material, and can be highly portable.

[0245]

[0246] The present invention also provides a vector comprising a 5'-homology arm, a promoter, a ribosome binding site consisting of a base sequence of SEQ ID NO: 2 (AGGAGGT), a nucleic acid encoding TARS (AmTARS) of Akkermansia muciniphila, and a 3'-homology arm,

[0247] The above 5'-homology arm includes a base sequence corresponding to a portion of the exo gene and exo / cea intergenic region of Escherichia coli Nissle 1917 (EcN),

[0248] The above 3'-homology arm provides a vector comprising base sequences corresponding to the exo / cea intergenic region of EcN and part of the cea gene.

[0249]

[0250] In one aspect of the present invention, the vector is characterized in that it is used for the purpose of transforming EcN to express AmTARS.

[0251]

[0252] The present invention also relates to the above-described vector;

[0253] A guide RNA (gRNA) comprising a sequence complementary to the exo gene, the exo / cea intergenic region, and a portion of the cea gene sequence of Escherichia coli Nissle 1917 (EcN); and

[0254] A composition for EcN transformation is provided, comprising a nucleic acid encoding a Cas protein.

[0255]

[0256] In the composition according to the present invention, the gRNA and Cas protein cleave a specific region among the exo gene, the exo / cea intergenic region, and the cea gene sequence of Escherichia coli Nissle 1917 (EcN), and the vector according to the present invention is used as a repair template to perform homology-directed repair (HDR) or homologous recombination (HR) in the cleavage region, thereby enabling the production of EcN having a gene encoding AmTARS inserted therein.

[0257]

[0258] In one aspect of the present invention, the Cas protein may be characterized in that it is selected from the group consisting of Cas9, Cas12, Cas13, and variants thereof.

[0259]

[0260] The present invention also provides a method for producing Escherichia coli Nissle 1917 (EcN) expressing TARS (AmTARS) of Akkermansia muciniphila, comprising the step of treating the composition according to claim 9 to Escherichia coli Nissle 1917 (EcN).

[0261]

[0262] In one aspect of the present invention, the method may be characterized by comprising the steps of (a) transfecting the Cas protein into EcN; and (b) transfecting the gRNA and the vector into EcN.

[0263]

[0264] In one aspect of the present invention, the transfection in each of the above steps can be achieved through methods known in the art, such as heat shock, electroporation, chemical transfection, and lipid-based transfection.

[0265]

[0266] In the method of the present invention, after steps (a) and (b), the vector can be inserted into the genome of EcN by homology-directed repair or homologous recombination at a double strand break (DSB) formed by the Cas protein.

[0267]

[0268] If the double-strand break generated by the above Cas protein is not repaired by a recombinase enzyme or the like, the strain dies and is eliminated from the selection process, so selection of strains is possible even without antibiotic resistance genes.

[0269]

[0270] The recombinase described above can be selected without limitation within the scope of its purpose for inserting a target gene into the genome of a target cell based on a homologous region, and may be, for example, RED recombinase. When the target gene is inserted into the genome of the target cell by the recombinase and the DSB is repaired, cell death does not occur.

[0271]

[0272] In order to achieve another object of the present invention, the present invention provides the use of the transformed EcN strain for preparing a composition for treating an inflammatory disease.

[0273]

[0274] In order to achieve another object of the present invention, the present invention provides a method for treating an inflammatory disease, which comprises administering an effective amount of a composition containing the transformed EcN strain as an active ingredient to a subject in need thereof.

[0275]

[0276] In order to achieve another object of the present invention, the present invention provides a composition for preventing, improving or treating an inflammatory disease comprising the transformed EcN strain.

[0277]

[0278] In order to achieve another object of the present invention, the present invention provides a composition for preventing, improving or treating an inflammatory disease, which essentially consists of the transformed EcN strain.

[0279]

[0280] The vector according to the present invention and the transformation composition containing the same can be very effectively utilized to produce EcN that stably produces / secretes AmTARS, and the EcN strain produced using the same exhibits very excellent effects in preventing, improving, and treating inflammatory diseases.

[0281]

[0282] Figure 1 is a schematic diagram illustrating the process of producing a probiotic E. coli Nissle [EcN(AmTARS-His)] that delivers the AmTARS-His protein.

[0283] Figures 2a to 2c show the results of confirming the expression of AmTARS-His protein when a plasmid containing an expression cassette expressing AmTARS-His protein was improved and introduced into the EcN strain.

[0284] Figure 3 shows the results confirming that the AmTARS-His expression gene was introduced into the EcN (AmTARS) genome.

[0285] Figure 4 shows the results confirming that the EcN (AmTARS-His) strain in the culture medium expresses and secretes the AmTARS-His protein.

[0286] Figure 5 shows the results of confirming that when the EcN (AmTARS-His) strain is administered orally, the AmTARS-His protein is secreted and delivered to intestinal immune cells.

[0287] Figures 6a to 6h show the results of confirming the therapeutic efficacy of EcN (AmTARS-His) probiotics in inflammatory bowel disease mice.

[0288] Figure 7 is a schematic diagram illustrating the process of producing a probiotic E. coli Nissle [EcN(AmTARS)] that delivers the AmTARS protein with the His tag removed.

[0289] Figure 8 shows the results of comparing the expression and secretion of AmTARS protein in the EcN (AmTARS) strain culture medium with EcN (AmTARS-His).

[0290] Figures 9a to 9h show the results of confirming the efficacy of EcN (AmTARS) probiotics in treating inflammatory bowel disease mice.

[0291]

[0292] Hereinafter, the present invention will be described in detail with reference to the following examples. However, the following examples are intended only to illustrate the present invention and the present invention is not limited thereto.

[0293]

[0294] E. coli Nissle (EcN) AmTARS gene introduction transformation

[0295] We aimed to construct EcN(AmTARS-His) or EcN(AmTARS), a strain expressing the AmTARS protein, by introducing the Akkermansia muciniphila threonyl-tRNA synthetase (AmTARS) gene into the Escherichia coli Nissle 1917 (EcN) strain genome using the λ-Red-mediated CRISPR-Cas9 system. The AmTARS gene insertion site was targeted to the exo / cea intergenic region sequence so as not to affect the expression of surrounding genes, and the 20 nucleotides between the exo / cea sequences were introduced into the pTarget plasmid. A vector was constructed that included the exo gene sequence and the exo / cea intergenic sequence as 5'-homology arms to induce homologous recombination, the exo / cea intergenic sequence and the cea gene sequence as 3'-homology arms at the ends, and the tac promoter (SEQ ID NO: 6) and ribosome binding sequence (SEQ ID NO: 2 (AGGAGGT)) for protein expression, and the AmTARS gene to be expressed (SEQ ID NO: 1) between them (SEQ ID NO: 8). To express the Cas9 protein in the EcN strain, the pCas plasmid was introduced, and then the pTarget (sgRNA: SEQ ID NO: 9 (caatcatttacgttatccag)) and the insert gene were co-transfected into the strain expressing Cas9. After culturing at 30°C on LB plate medium containing kanamycin, a pCas antibiotic marker, and spectinomycin, a pTarget marker, the strain with the inserted gene was identified and secured through exo / cea sequence screening.

[0296]

[0297] Immunoblotting

[0298] 100 μl of pre-cultured A. muciniphila, EcN, EcN(AmTARS), and EcN(AmTARS-His) strains were inoculated into 50 ml LB liquid medium and cultured at 37°C for 3, 6, 12, and 24 h. 10 ml of each culture was collected and centrifuged at 4,000 rpm for 10 min to separate the cells and supernatant. The cells were suspended in 1X PBS buffer, sonicated to lyse the cells, and centrifuged at 13,000 rpm for 20 min. The culture supernatant was concentrated to a final volume of 100 μl using a 30K cut-off filter. For immunoblot analysis of the proteins in the samples, the samples were loaded onto a 7.5% SDS-PAGE gel and transferred to a PVDF membrane. To prevent nonspecific binding of antibodies, the membrane was incubated for 1 hour and 30 minutes with 1X TBST (137 mM NaCl, 50 mM Tris-HCl, 0.1% Tween 20), 4% BSA solution. Each antibody was diluted according to the concentration used in 1X TBST, 4% BSA solution and reacted on the membrane overnight at 4°C. The target protein was detected through a chemi-luminescence signal.

[0299]

[0300] Mouse Management

[0301] The mouse line used in this study was 8-week-old C57BL / 6. All mice were maintained at 22°C under a 12-hour light-dark cycle and used for experiments after genotyping.

[0302]

[0303] Creation of a mouse model of inflammatory bowel disease

[0304] To induce inflammatory bowel disease, 8-week-old mice were given 2% DSS (Dextran Sulfate Sodium) for 10 days, and EcN, EcN(AmTARS), and EcN(AmTARS-His) strains were given 10 times a day.7 It was administered orally at a dose of cells / 100 ul.

[0305]

[0306] Enzyme-linked immunosorbent assay (ELISA)

[0307] To obtain mouse plasma, mice were anesthetized with isoflurane, laparotomy was performed, and blood was collected from the heart. To obtain pure plasma, the cells were left to stand at room temperature for 4 hours and centrifuged at 1,000 × g for 20 minutes. To confirm the secretion of mouse-derived immune cytokines, the mouse IL-10 ELISA set DUO from BD Biosciences was used.

[0308]

[0309] Flow cytometry

[0310] 1 x 10 isolated from colon tissue 6 After washing the cells once with a staining buffer solution (PBS containing 1% FBS and 0.01% NaN3, pH 7.4), antibodies conjugated to each fluorescent material (F4 / 80: macrophages, CD11b: monocytes, CD206: M2 macrophages) were added to the samples and reacted for 20 minutes at 4°C. After washing twice with a staining buffer solution, the expression of cell surface molecules was analyzed by flow cytometry.

[0311]

[0312] Tissue staining (H&E and immunofluorescence staining)

[0313] Colon tissues were fixed in 10% paraformaldehyde, embedded in paraffin, and sectioned at 5 μm thickness to prepare slides. Paraffin removal through xylene treatment and hydration using ethanol were performed according to standard experimental methods. For H&E staining, the slides were reacted with hematoxylin for 1 minute and eosin for 30 seconds, dehydrated, and observed under a light microscope. For immunofluorescence, the slides were exposed to antigens using antigen retrieval solution (0.1 M sodium citrate, pH 6.0, and 0.05% Tween-20), and then reacted with 1X PBS solution containing 3% BSA for 1 hour to prevent nonspecific antibody binding. After reacting each fluorescent substance-conjugated antibody (F4 / 80: macrophage, His:AmTARS) at room temperature for 2 hours, residual antibodies were removed through three washing steps using 1X PBS containing 0.1% Tween-20, and then mounting solution containing DAPI was treated and observed under a fluorescence microscope.

[0314]

[0315] Disease activity and epithelial damage score measurement

[0316] The disease activity score was calculated by adding up the scores of 0-4 for bloody stool, diarrhea, and weight loss, and the epithelial damage score was calculated by assigning scores of 0-4 according to the degree of damage to the colon tissue.

[0317]

[0318] [Experimental Results]

[0319] Example 1. Production of probiotic E. coli Nissle [EcN(AmTARS-His)] expressing and secreting A. muciniphila threonyl-tRNA synthetase (AmTARS) and confirmation of AmTARS-His protein secretion.

[0320] To produce a probiotic E. coli Nissle EcN (AmTARS-His) that expresses and secretes AmTARS-His, a protein derived from Akkermansia muciniphila, the AmTARS gene was inserted into the strain genome using the λ-Red-mediated CRISPR-Cas9 system. As shown in the schematic diagram in Fig. 1, engineering was performed by preparing a pCas plasmid expressing a Cas9 protein capable of recognizing and cleaving a specific sequence of a gene, a pTarget plasmid expressing an sgRNA that helps recognize the gene insertion site, and a repair template containing the gene to be inserted.

[0321] We attempted to introduce the AmTARS-His gene into the threonyl-tRNA synthetase gene (EcN_thrS) site in the EcN genome, but a problem occurred in which EcN did not survive the transformation. Therefore, we attempted to create a strain that continuously expresses the AmTARS-His protein by inserting the AmTARS-His gene into a different site in the genome. First, we tested whether the AmTARS-His protein was expressed when the gene was introduced into the strain in the form of a plasmid. As a result, as shown in Figures 2a and 2b, when a plasmid (pHO2224) using a T7-derived RBS in the Tac promoter was introduced into the strain, it was confirmed that the AmTARS-His protein was expressed. However, a problem occurred in which the repair template was not formed properly. Therefore, a new plasmid, pHO2225, was constructed using the RBS unique to lacZ while using the promoter as is. In the case of pHO2225, repair template construction was possible, but when the plasmid was introduced into the strain, it was confirmed that the protein was not expressed even in the plasmid form. Therefore, a new plasmid was constructed by inducing a mutation in the RBS from the lacZ native RBS to the shine-Dalgano sequence (pHO2225-edit1). As a result, as shown in Fig. 2c, although pHO2225-edit1 showed weaker AmTARS-His protein expression than pHO2224, it was used because it was possible and could construct a repair template for gene introduction into the genome.

[0322] The expression cassettes on pTarget and pHO2225-edit1 were introduced into the E. coli Nissle strain, which had been introduced with pCas, by electroporation together using the repair template DNA. Genomic DNA of the transformed strain was extracted, and strains containing the AmTARS-His gene in the exo / cea genome were screened. As a result, as shown in Fig. 3, the EcN (AmTARS-His) strain, in which the AmTARS-His expression cassette in the exo / cea genome was introduced, was obtained.

[0323] To confirm whether the AmTARS-His gene introduced into the genome is expressed and secreted, the EcN (AmTARS-His) strain was cultured in LB medium for 6, 12, and 24 hours. As a result, as shown in Fig. 4, it was confirmed through immunoblot analysis that the AmTARS-His protein was expressed and secreted in the cell lysate and cell culture sup. The culture of EcN (AmTARS-His) was confirmed after being concentrated 40-fold, and in the case of the culture of Akkermansia muciniphila, it was confirmed that the secretion of the AmTARS protein of EcN (AmTARS-His) was about 40-fold lower than that of Akkermansia when immunoblot analysis was performed without concentration.

[0324]

[0325] Example 2. Confirmation of AmTARS secretion and delivery to intestinal immune cells upon oral administration of EcN (AmTARS-His)

[0326] To determine whether the EcN(AmTARS-His) strain expresses and secretes the AmTARS-His protein in the intestinal environment, the EcN and EcN(AmTARS-His) strains were incubated for 10 days daily. 7Cells were administered orally for 5 days at a dose of 100 μl. Thereafter, colon tissue was obtained and confirmed by immunofluorescence. As shown in Figure 5, in the intestines administered with EcN (AmTARS-His), the AmTARS-His protein present in the intestines was confirmed using His antibody. In addition, co-localization with macrophages labeled with F4 / 80 antibody was confirmed, demonstrating that the AmTARS-His protein was secreted into the intestinal environment and that the protein delivered to the intestines interacted with intestinal immune cells.

[0327]

[0328] Example 3. Verification of the anti-inflammatory efficacy of the EcN (AmTARS-His) strain in a mouse model of inflammatory bowel disease.

[0329] In Example 2, it was confirmed that the EcN (AmTARS-His) strain delivered orally synthesizes and secretes AmTARS-His protein in the intestinal environment. Therefore, the anti-inflammatory efficacy of the EcN (AmTARS-His) strain oral administration was investigated in a mouse model of inflammatory bowel disease. Inflammatory bowel disease was induced in 8-week-old C57BL / 6 male mice by drinking 2% DSS (Dextran Sulfate Sodium). Every day, the PBS group received 100 ul of 1X PBS, and the EcN and EcN (AmTARS-His) group received 10 7 Cells / 100 ul were administered orally. As a result, as shown in Figures 6a to 6h, it was confirmed that inflammation was alleviated by EcN (AmTARS-His) administration, including disease activity score, colon length reduction, and tissue damage. As a result of analyzing intestinal immune cells using flow cytometry, inflammatory monocytes (CD11b) infiltrated into the intestines + F4 / 80 - ) was significantly reduced in the EcN (AmTARS-His) administration group compared to the PBS control group, and the proportion of M2 macrophages capable of secreting IL-10 (CD11b+ F4 / 80 + CD206 + ) was confirmed to increase. The concentration of IL-10 in the mouse plasma was significantly increased in the EcN (AmTARS-His) administration group compared to the EcN administration group, confirming that the AmTARS-His protein secreted by the EcN (AmTARS-His) strain interacts with intestinal immune cells to exhibit anti-inflammatory effects.

[0330]

[0331] Example 4. Construction of EcN(AmTARS) strain expressing AmTARS protein lacking His tag and confirmation of AmTARS protein secretion.

[0332] Since it was confirmed that the engineered EcN (AmTARS-His) strain through Examples 2, 3, and 4 secretes AmTARS-His protein in the intestinal environment and has an anti-inflammatory function, we attempted to construct a strain expressing AmTARS protein without a His tag. As shown in Fig. 7, the method for constructing the EcN (AmTARS-His) strain expressing and secreting AmTARS with a His tag at the C-terminus through Example 1 was used as is, and an expression cassette with a stop codon (TAG) inserted along with the deletion of the 18 nucleotide sequence (CACCACCACCACCACCA) expressing the His tag was used as a repair template. To confirm the expression and secretion of AmTARS protein in the EcN(AmTARS) strain expressing AmTARS lacking His tag, the EcN(AmTARS) strain was cultured in LB medium for 3 and 6 hours, and cells and culture medium were separated and subjected to immunoblot analysis as performed in Example 1. As shown in Fig. 8, both the EcN(AmTARS) and EcN(AmTARS-His) strains expressed and secreted AmTARS protein, which was confirmed using an AmTARS-specific antibody. When the His tag antibody was used, AmTARS-His was confirmed only in the lysate, sup, derived from the EcN(AmTARS-His) strain.

[0333]

[0334] Example 5. Verification of the anti-inflammatory efficacy of the EcN (AmTARS) strain in a mouse model of inflammatory bowel disease.

[0335] To confirm the anti-inflammatory efficacy of the EcN (AmTARS) strain expressing the AmTARS protein, the same experiment as in Example 3 was performed. Inflammatory bowel disease was induced in 8-week-old C57BL / 6 male mice by drinking 2% DSS (Dextran Sulfate Sodium). The PBS group received 100 ul of 1X PBS, and EcN and EcN (AmTARS) received 10 7It was administered orally daily at a dose of 100 μl per cell. As a result, as shown in Figures 9a to 9h, it was confirmed that the EcN (AmTARS) treatment group showed alleviation of lesion index, colon length reduction, colon tissue damage, etc. compared to the control group, PBS and EcN treatment groups. In the intestinal immune cell analysis, the intestinal monocyte infiltration rate (CD11b + F4 / 80 - ) was reduced compared to the two control groups, and M2 macrophages (CD11b + F4 / 80 + CD206 + ) was confirmed to result in an increase in the ratio. The amount of anti-inflammatory cytokine IL-10 in mouse plasma was also confirmed to increase in the EcN (AmTARS) treatment group.

[0336] Through this, it was confirmed that the anti-inflammatory effect of AmTARS was also observed in the probiotic E. coli Nissle strain EcN (AmTARS), which can secrete the AmTARS protein into the intestine.

[0337]

[0338] The vector according to the present invention and the composition for transformation containing the same can be very effectively utilized to manufacture EcN that stably produces / secretes AmTARS, and the EcN manufactured using the same exhibits excellent effects in preventing, improving, and treating inflammatory diseases, and thus has high potential for industrial application.

Claims

1. Escherichia coli Nissle 1917 (EcN) strain transformed with a vector containing a TARS (AmTARS) coding nucleic acid of Akkermansia muciniphila.

2. A strain according to claim 1, characterized in that the strain expresses AmTARS.

3. A strain according to claim 1, characterized in that the AmTARS coding nucleic acid is introduced into the exo / cea intergenic region.

4. A strain according to claim 1, characterized in that the vector comprises a 5'-homology arm, a promoter, a ribosome binding site consisting of a base sequence of SEQ ID NO: 2, a nucleic acid encoding TARS (AmTARS) of Akkermansia muciniphila, and a 3'-homology arm.

5. A strain according to claim 4, characterized in that the promoter is selected from the group consisting of a lac promoter, a trp promoter, and a Tac promoter.

6. A strain according to claim 4, wherein the 5'-homology arm includes a base sequence corresponding to a portion of the exo gene and the exo / cea intergenic region of Escherichia coli Nissle 1917 (EcN), and the 3'-homology arm includes a base sequence corresponding to a portion of the exo / cea intergenic region and the cea gene of EcN.

7. A strain according to claim 1, characterized in that the nucleic acid encoding AmTARS comprises the base sequence of SEQ ID NO:

1.

8. A strain characterized in that the exo gene in paragraph 6 consists of a base sequence of sequence number 3.

9. A strain characterized in that the exo / cea intergenic region in paragraph 6 consists of the base sequence of sequence number 4.

10. A strain according to claim 6, characterized in that the cea gene consists of a base sequence of sequence number 5.

11. A strain according to claim 1, wherein the vector further comprises at least one selected from the group consisting of an enhancer, a polyadenylation signal, a Kozak consensus sequence, an inverted terminal repeat (ITR), a long terminal repeat (LTR), a terminator, an internal ribosome entry site (IRES), a fluorescent protein gene, glutathione-S-transferase (GST), horseradish peroxidase (HRP), chloramphenicol acetyltransferase (CAT), beta-galactosidase, beta-glucuronidase, luciferase, a histidine (His) tag, a V5 tag, a FLAG tag, an influenza hemagglutinin (HA) tag, a Myc tag, 2A self-cleaving peptides, and an antibiotic resistance gene.

12. A pharmaceutical composition for the prevention or treatment of inflammatory diseases, comprising a strain according to any one of claims 1 to 11 as an active ingredient.

13. In claim 12, the inflammatory disease may include inflammatory bowel disease (IBD), edema, dermatitis, conjunctivitis, periodontitis, rhinitis, otitis media, pharyngitis, tonsillitis, pneumonia, gout, recurrent spondylitis, gastritis, psoriatic arthritis, osteoarthritis, periarthritis, tendonitis, tenosynovitis, myositis, hepatitis, lymphangitis, felon, urinary tract infection, peritonitis, cystitis, nephritis, respiratory disease, and sepsis, and may be specifically inflammatory bowel disease, and more specifically, a pharmaceutical composition characterized in that it is at least one selected from the group consisting of colitis, ulcerative colitis, Crohn's disease, and Behcet's enteritis.

14. A food composition for preventing or improving inflammatory diseases, comprising a strain according to any one of claims 1 to 11 as an active ingredient. A vector comprising a 15.5'-homology arm, a promoter, a ribosome binding site consisting of a base sequence of SEQ ID NO: 2, a nucleic acid encoding TARS (AmTARS) of Akkermansia muciniphila, and a 3'-homology arm, The above 5'-homology arm includes a base sequence corresponding to a portion of the exo gene and exo / cea intergenic region of Escherichia coli Nissle 1917 (EcN), The above 3'-homology arm is a vector containing a base sequence corresponding to the exo / cea intergenic region of EcN and a part of the cea gene.

16. Vector according to Article 15; A guide RNA (gRNA) comprising a sequence complementary to the exo gene, the exo / cea intergenic region, and a portion of the cea gene sequence of Escherichia coli Nissle 1917 (EcN); and A composition for EcN transformation, comprising a nucleic acid encoding a Cas protein.

17. A composition according to claim 16, wherein the Cas protein comprises Cas9, Cas12, Cas13 or a variant thereof.

18. A method for producing an EcN strain expressing TARS (AmTARS) of Akkermansia muciniphila, comprising the step of treating Escherichia coli Nissle 1917 (EcN) with a composition according to claim 16.

19. A manufacturing method according to claim 18, characterized in that the method comprises: (a) a step of transforming the Cas protein into EcN; and (b) a step of transforming the gRNA and the vector into EcN.

20. Use of a strain according to any one of claims 1 to 11 for preparing a composition for treating inflammatory diseases.

21. A method for treating an inflammatory disease, comprising administering an effective amount of a composition containing a strain according to any one of claims 1 to 11 as an active ingredient to a subject in need thereof.

Images