Bifidobacterium breve BX-18 and application thereof in regulating intestinal flora homeostasis

Abstract

The invention discloses a bifidobacterium breve BX-18 strain, and the preservation number of the bifidobacterium breve BX-18 strain is CGMCC (China General Microbiological Culture Collection Center The invention also discloses application of the bifidobacterium breve BX-18 strain in preparation of food for improving intestinal flora homeostasis and improving symptoms of inflammatory bowel diseases. The invention can be used as a probiotic preparation, can be applied to products such as pharmaceutical compositions, foods, health-care products and food additives, and is used for regulating intestinal flora and preventing and improving intestinal diseases such as inflammatory bowel diseases. The probiotic preparation provided by the invention is used as a microecological preparation for regulating intestinal flora disorder caused by the inflammatory bowel disease, and has the characteristics of simplicity in taking, no toxic action and the like.

Description

Technical Field

[0001] The present invention belongs to the technical field of microorganisms, and specifically relates to the application of Bifidobacterium breve BX-18 in regulating the homeostasis of intestinal flora and alleviating the symptoms of inflammatory bowel disease. Background Art

[0002] Inflammatory bowel disease (IBD) includes ulcerative colitis (UC) and Crohn's disease (CD). There is no confirmed cause of IBD at present, but the mainstream view is that it is closely related to microbiome disorders and intestinal immune dysfunction. Studies have found that the temporal, spatial and geographical distribution of IBD seems to be parallel to the industrialization and urbanization of society.

[0003] Intestinal flora dysbiosis refers to the loss of balance between the host and the intestinal flora, which leads to changes in their composition and function. It is a potential related mechanism and main feature of the pathogenesis of inflammatory bowel disease, and its characteristics are: loss of symbiosis, changes in microbial communities, and reduced bacterial diversity. If not controlled, inflammation may develop in the direction of cancer. Existing research results show that compared with normal people, the abundance of Firmicutes and Bacteroidetes in the intestines of patients with inflammatory bowel disease is significantly reduced; while the abundance of pathogenic bacteria such as Proteus and fungi is significantly increased. At present, the main ways to regulate intestinal flora include antibiotics, fecal microbiota transplantation and probiotic preparations. However, due to the indiscriminate killing of intestinal microorganisms by antibiotics and the easy induction of drug resistance, and the difficulty of finding donors, uneven quality and high technical difficulty of fecal microbiota transplantation, probiotics seem to have become the "optimal solution" for the treatment or relief of inflammatory bowel disease in the future. Probiotics are a type of active microorganisms that are beneficial to the host by colonizing in the human body and changing the composition of the flora in a certain part of the host. There are many types of probiotics, and the more common ones are bifidobacteria and lactobacilli. The mechanisms of action of probiotics in improving the symptoms of inflammatory bowel disease mainly include: improving intestinal flora imbalance, antagonizing intestinal pathogenic bacteria, strengthening the intestinal mucosal barrier, improving the excessive immune response state of the intestine, producing the protective effect of beneficial metabolites, reducing neutrophil infiltration and effectively alleviating colon inflammation. Summary of the invention

[0004] One of the purposes of this application is to provide a strain of Bifidobacterium breve that has the ability to regulate intestinal flora homeostasis and relieve symptoms of inflammatory bowel disease and its application. The strain was isolated from the intestines of healthy centenarians in Enshi City, Hubei Province in 2018 and has good gastrointestinal digestive juice tolerance.

[0005] The second purpose of the present application is to provide a use of Bifidobacterium breve BX-18 in improving and alleviating the symptoms of inflammatory bowel disease; Furthermore, the Bifidobacterium breve BX-18 is used in the preparation of food, health products or medicines.

[0006] In a first aspect of the present application, a strain of Bifidobacterium breve is provided, named as BX-18. The Bifidobacterium breve BX-18 is deposited in the China Center for Microbiological Culture Collection, with a deposit number of CGMCC No. 28446.

[0007] The strain of the present invention is sampled from the feces of healthy centenarians, the feces sample is shaken and mixed, 1 mL is taken in an MRS solid culture medium containing 0.05% L-cysteine ​​salt, and after anaerobically culturing at 37°C for 48 hours, a single colony is picked up by an inoculation loop and streaked in an MRS solid culture medium containing 0.05% L-cysteine ​​salt, and after anaerobically culturing at 37°C for 48 hours, a white colony is picked up and repeatedly inoculated and screened until a uniform single colony is obtained, which is named BX-18.

[0008] Bifidobacterium breve is positive by Gram staining, short rod-shaped under a microscope, and curved, short rod-shaped under an electron microscope; it grows uniformly turbid in MRS liquid medium containing 0.05% L-cysteine ​​salt, and the bacteria form white precipitates after long-term storage. The Bifidobacterium breve BX-18 strain is deposited in the General Microbiological Culture Collection Center of the China Microbiological Culture Collection Administration. The deposit number is CGMCC NO.28446; the classification name is Bifidobacterium breve ( Bifidobacterium breve ).

[0009] The Bifidobacterium breve BX-18 described in the present application has the following biological characteristics: Gram-positive bacteria, no flagella, no motility, no spore formation, and obligate anaerobic; polymorphic bacilli, whose colonies are smooth and have complete edges, are milky white, shiny, and have a soft texture.

[0010] The present invention provides a screening method for the above-mentioned bifidobacterium, which is characterized by comprising the following steps: (1) Lactic acid bacteria screening After collecting the fecal samples and shaking and mixing them, 1 mL of the fecal samples were taken and spread on MRS solid medium containing 0.05% L-cysteine ​​salt for culture; after a period of culture, single colonies were picked and further separated and purified by streaking using MRS solid medium containing 0.05% L-cysteine ​​salt. After purification, Gram staining microscopy experiments were performed in sequence. Strains that met the identification conditions of bifidobacteria were stored in glycerol at -80°C for future use; (2) Identification of bacterial species The genomic DNA of the isolated strain was extracted using a bacterial DNA extraction kit, and the extracted DNA was subjected to PCR amplification of the 16SrDNA sequence. The obtained PCR product was purified and sequenced. The sequencing results were compared by BLAST, and the gene sequence of 16S rRNA of similar strains was found from GenBank. The gene sequence of 16S rRNA of the strain was compared by Blast, and the final identification result determined that the strain was Bifidobacterium breve. The Bifidobacterium breve strain BX-18 has good acid and bile resistance. Its survival rate is 65.97% after being digested in artificial gastric juice at pH 2.5 for 3 hours, and its survival rate is 55.75% after being digested in artificial intestinal juice for 8 hours. It can enter the human intestine in a living state.

[0011] The present invention also provides a method for preparing the bacterial agent described in the above scheme, comprising the following steps: inoculating the Bifidobacterium breve BX-18 described in the above scheme into an MRS culture medium containing 0.05% L-cysteine ​​salt, and culturing under anaerobic conditions at 37° C. to obtain a bacterial agent.

[0012] The second aspect of the present application provides the application effect of the Bifidobacterium breve BX-18 bacterial agent described in the first aspect or the bacterial agent prepared by the preparation method in improving the symptoms of inflammatory bowel disease.

[0013] In the bacterial agent, the number of viable bacteria of Bifidobacterium breve is not less than 1×10 6 CFU / mL or 1×10 6 CFU / g.

[0014] Optionally, the product is Bifidobacterium breve milk powder or starter.

[0015] Optionally, the product is a solid beverage, a milk beverage or a compressed candy.

[0016] Optionally, the product includes functional medicine or health care product.

[0017] Optionally, the product is a soy product, dairy product or fruit and vegetable product produced using the fermentation agent.

[0018] As can be seen from the above technical solutions, the present application provides a strain of Bifidobacterium breve for alleviating the symptoms of inflammatory bowel disease, wherein the Bifidobacterium breve has good tolerance to gastrointestinal digestive juices and can enter the intestines and colonize in a live state. Bifidobacterium breve BX-18 relieves the symptoms of inflammatory bowel disease by regulating the rate of change of body weight, the composition and diversity of intestinal flora, etc. Through the application of the Bifidobacterium breve in the fields of food, probiotic solid beverages, compressed candies, functional pharmaceutical auxiliary materials, etc., effective intervention is carried out to regulate the disorder of the flora of patients with inflammatory bowel disease and improve the symptoms of the disease. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] The accompanying drawings are provided to provide a further understanding of the present invention and constitute a part of the specification. Obviously, the accompanying drawings described below are only some embodiments of the present invention. For those skilled in the art, other accompanying drawings can be obtained based on these accompanying drawings without creative work. Among them: Figure 1 This is an electron micrograph of Bifidobacterium breve BX-18; Figure 2 It is the acid and bile resistance characteristics of Bifidobacterium breve BX-18; Figure 3 This is the DAI score chart of each group before Bifidobacterium breve BX-18 intervention (1-7 days); Figure 4 This is the weight change rate of rats in the model group and the healthy control group after intervention with Bifidobacterium breve BX-18; Figure 5 This is a graph of MPO levels in the serum of rats after intervention with Bifidobacterium breve BX-18, in the model group, and in the healthy control group; Figure 6 The results of α diversity of intestinal microbial flora in rats after intervention with Bifidobacterium breve BX-18, model group, and healthy control group; Figure 7 Results of the β diversity of intestinal microbial flora in rats after intervention with Bifidobacterium breve BX-18, in the model group, and in the healthy control group; Figure 8 This is the species accumulation diagram at the phylum level of the intestinal microbiota of rats after intervention with Bifidobacterium breve BX-18, in the model group, and in the healthy control group.

[0020] Fig. 9 This is the species accumulation diagram at the genus level of the intestinal microbiota of rats after intervention with Bifidobacterium breve BX-18, in the model group, and in the healthy control group.

[0021] Fig.10 The results of different bacterial species in the intestinal microbiota of rats after intervention with Bifidobacterium breve BX-18, model group and healthy control group. Biological Deposit

[0022] Bifidobacterium breve BX-18 ( Bifidobacterium breve BX-18), deposited on September 12, 2023 in the General Microbiological Culture Collection Center of China Microorganism Culture Collection Administration, the deposit address is: No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, China, Institute of Microbiology, Chinese Academy of Sciences, the deposit number is: CGMCC NO.28446. DETAILED DESCRIPTION

[0023] The Bifidobacterium breve BX-18 described in the present application has the following biological characteristics: Gram-positive bacteria, no flagella, no motility, no spore formation, and obligate anaerobic; polymorphic bacilli, whose colonies are smooth and have complete edges, are milky white, shiny, and have a soft texture.

[0024] The Bifidobacterium breve of the present invention ( Bifidobacterium breve ) BX-18 was isolated from the intestines of healthy centenarians in Enshi City, Hubei Province.

[0025] The Bifidobacterium breve BX-18 of the present invention is isolated by the following method: a stool sample is applied to an MRS solid medium containing 0.05% L-cysteine ​​salt and anaerobically cultured at 37°C for 48 hours. After selecting typical colonies for Gram staining and microscopic examination, the colonies are streaked on a modified MRS solid medium containing 0.05% L-cysteine ​​salt for 2 to 3 times to obtain pure colonies, and after enrichment culture, the bacterial sludge is collected and placed in a glycerol tube for low-temperature storage at -80°C.

[0026]

[0027] The Bifidobacterium breve BX-18 can effectively relieve colon inflammation and eliminate edema by regulating intestinal microbial composition, regulating myeloperoxidase levels, and reducing neutrophil infiltration, thereby achieving the purpose of relieving the symptoms of inflammatory bowel disease.

[0028] The technical solution of the present invention will be clearly and completely described below in conjunction with the embodiments of the present invention.

[0029] The methods and culture media used in the embodiments of the present invention are as follows: The medium used to culture Bifidobacterium breve in the experimental example of this application is MRS medium containing 0.05% L-cysteine. MRS liquid medium: peptone (animal source) 10g, beef extract powder 8g, yeast extract powder 4g, glucose 20g, Tween-80 1mL, dipotassium hydrogen phosphate 2g, sodium acetate 5g, triammine citrate 2g, manganese sulfate 0.05g, magnesium sulfate 0.2g, distilled water 1L, adjust pH to 6.5±0.2, 121°C, sterilize for 15min.

[0030] 1 Materials and methods 1.1 Source, isolation and identification of Bifidobacterium breve BX-18 strain Fecal samples were smeared on MRS solid medium containing 0.05% L-cysteine ​​salt and cultured anaerobically at 37°C for 48h. After selecting typical colonies for Gram staining microscopy, they were streaked on MRS solid medium containing 0.05% L-cysteine ​​salt for 2-3 times to obtain pure colonies. After enrichment culture, the bacterial mud was collected and stored in a glycerol tube at -80°C. Microscopic observation showed that Bifidobacterium breve BX-18 was a Gram-positive bacterium without flagella, no movement, no spore formation, and anaerobic; the bacteria were short rod-shaped, and the colonies were milky white, smooth, small round colonies with neat edges.

[0031] The isolated BX-18 strain was PCR amplified by 16S rDNA universal primers (27F: AGAGTTTGATCCTGGCTCAG, 1492R: TACGGCTACCTTGTTACGACTT), and the amplification conditions were pre-denaturation at 94°C for 5min, denaturation at 94°C for 30s, annealing at 54°C for 30s, extension at 72°C for 90s, 35 cycles, and extension at 72°C for 10min. The PCR product was sequenced. The obtained 16S rDNA sequence (SEQ ID No: 1) was BLAST-aligned in the Genome database of NCBI. The results showed that the homology between the BX-18 strain and the known 16S rDNA sequence of Bifidobacterium breve was >99%, confirming that BX-18 was a different strain of Bifidobacterium breve of the same species. In the present invention, the 16SrRNA sequence of the Bifidobacterium breve BX-18 is shown in SEQ ID No.1.

[0032] 1.2 Gastrointestinal fluid tolerance of Bifidobacterium breve BX-18 1.2.1 Gastrointestinal fluid tolerance test method: 1.2.1.1 Preparation of artificial gastric juice Take 40mL of sterilized PBS and add 3.0g / L pepsin (0.3%), adjust the pH to 2.5 (adjust with 0.1mol / L HCL), filter with a 0.22μm filter membrane into a sterilized empty conical flask for later use.

[0033] 1.2.1.2 Preparation of artificial intestinal fluid Take 40 mL of sterilized PBS, add 1.0 g / L trypsin (0.1%) and 1.8% bile salt, adjust the pH to 8.0 (adjust with 0.1 mol / L NaOH), filter with a 0.22 microfiltration membrane into a sterilized empty conical flask for later use.

[0034] 1.2.1.3 Determination method The bacterial liquid cultured in the centrifuge tube was centrifuged to collect the cells, washed twice with PBS, and vibrated with 5 mL of PBS as the original bacterial liquid. The original bacterial liquid was diluted and counted as the value of 0 h; 500 μL of the original bacterial liquid was placed in a test tube containing 4.5 mL of gastric juice, placed in a 37°C water bath for 10 min, and then immediately placed in an anaerobic workstation for 3 h, and then taken out for counting; 500 μL of the bacterial liquid after 3 h of culturing was placed in a test tube containing 4.5 mL of intestinal juice, placed in a 37°C water bath for 10 min, and immediately placed in an anaerobic workstation for 8 h before counting. The number of viable bacteria was measured using the MRS solid culture medium pouring method containing 0.05% L-cysteine ​​salt.

[0035] Survival rate = [N1 / N0] × 100% Among them, N0 represents the number of live bacteria at 0h; N1 represents the number of live bacteria after simulated digestion for 3h or 8h.

[0036] Tolerance effect: After Bifidobacterium breve BX-18 was treated with simulated gastric fluid and simulated intestinal fluid, the results are shown in Table 1 below: Table 1 Survival of Bifidobacterium breve BX-18 in simulated gastrointestinal digestive fluid strains Survival rate in simulated gastric fluid (pH 2.5, 3h) (%) Survival rate in simulated intestinal fluid (pH 8.0, 8h) (%) BX-18 65.97% 55.75% From Table 1 and Figure 2 It can be seen that Bifidobacterium breve BX-18 has good tolerance characteristics, and the survival rate can reach 55.75% after 8 hours of treatment with simulated intestinal fluid.

[0037] According to the gastrointestinal fluid tolerance effect of this example, it can be seen that Bifidobacterium breve BX-18 has good tolerance in the intestine. Example

[0038] Experimental design of the effect of Bifidobacterium breve BX-18 on regulating intestinal flora disorder in rats with inflammatory bowel disease The experimental rats were randomly divided into 3 groups for inflammatory bowel disease model treatment. A total of 18 6-week-old SPF male rats were purchased from Beijing Huafukang Biotechnology Co., Ltd. The animals were raised in the Key Laboratory of Dairy Biotechnology Engineering of the Ministry of Education, Inner Mongolia Agricultural University, with 12 h light and dark alternation indoors. After one week of adaptive feeding, they were randomly divided into the control group (NC), model group (DM), and probiotic intervention group (LB).

[0039] Specifically, except for the NC group, all other groups were given 3% (w / v) DSS aqueous solution from day 0 to the end of the experiment. From day 7, the rats in the LB group were gavaged with 2 mL (2×10 9 CFU / d), the NC group and the DSS group were given 2 mL of normal saline, and the intervention period was 21 days. During the entire experiment, the weight and fecal status of the rats were recorded every day. The rats were free to eat and drink every day. On the 21st day, the rats were killed and samples were taken for subsequent analysis.

[0040] 1. Disease activity index (DAI), a comprehensive score of physical signs is given according to the DAI score table. The weight loss rate, stool characteristics, and bloody stools are scored. The higher the score, the more serious the disease state. That is, DAI = weight change rate score + stool characteristics score + stool occult blood score.

[0041] The DAI changes of rats were monitored for the first 7 days, and the results are shown in the figure. The DAI scores of the DM and LB groups increased rapidly, the condition of the rats gradually deteriorated, the body weight decreased significantly, the stools were unformed, and some had bloody stools, indicating that the disease model was successfully induced, and there was no significant difference between the DM and LB groups.

[0042] 2. Body weight change rate: The daily body weight changes of rats were monitored and the body weight change rate was calculated on days 0, 7, 14, and 21.

[0043] Under the action of DSS, the weight change rate of DM rats decreased. On the 21st day, the weight change rate of the DM group was significantly different from that of the NC group ( p <0.0001), under the intervention of probiotics, the condition of rats improved significantly, and the weight change rate increased significantly ( p <0.01).

[0044] 3. Collect serum on days 7 and 21, and detect MPO levels by enzyme-linked immunosorbent assay. Specifically, after the kit is rewarmed, set the positions of the standard wells and sample wells, add 50 μL of standards of different concentrations to the standard wells, and add 50 μL of the sample (serum) to be tested to the sample wells. Add 100 μL of the corresponding detection antibody to the standard wells and sample wells. Cover the reaction plate with a sealing film and incubate at 37°C in the dark for 60 min. Remove the sealing film and wash it 5 times with an automatic plate washer, soaking for 30 s each time. After washing, pat the reaction plate dry with absorbent paper. Add 2 drops of solution A and solution B to all wells, and cover the reaction plate with a sealing film. Incubate at 37°C in the dark for 15 min. Add 50 μL of stop solution to all wells, and read the absorbance (optical density, OD) value of each well with an ELISA reader (450 nm wavelength). A standard curve was drawn using the standard concentration and OD value, and a standard curve equation was created using computer software. The concentration value was calculated using the OD value of the sample well.

[0045] On the seventh day, under the induction of DSS, abnormal secretion of MPO was observed in the serum of the DM and LB groups ( p <0.0001), and the MPO level in the LB group returned to normal on day 21 ( p <0.0001). This indicates that Bifidobacterium breve BX-18 can regulate and restore the homeostasis of the intestinal microenvironment in rats and improve neutrophil infiltration, thereby alleviating the symptoms related to inflammatory bowel disease.

[0046] 3. Metagenomic Sequencing Fecal samples were collected at the end of the experiment and stored in cryopreservation solution. Metagenomic DNA from fecal samples was extracted using the QIAamp Fast DNAStool Mini Kit (Qiagen, Hilden, Germany), and DNA libraries were constructed using the NEBNext® Ultra™ DNA Library Prep Kit for Illumina (NEB, USA) to generate DNA fragments of approximately 300 bp in length. Paired-end reads were generated in both the forward and reverse directions using the Illumina NovaSeq 6000 sequencing platform. Quality control was performed using the KneadData pipeline (http: / / huttenhower.sph.harvard.edu / kneaddata; v0.7.5), and then compared to the genome using Bowtie2 to remove host DNA sequences (v2.3.5.1)19. Sequences were assembled into contigs using MEGAHIT, and Kraken2 was used for species annotation.

[0047] The results showed that at the end point of the experiment, there was no statistical difference in the α diversity (including Shannon index and Simpson index) of intestinal microorganisms among the three groups of rats; further, in the β diversity results, the healthy control group and the model group were significantly separated at the 1 / 2 principal component, while the model group and the probiotic group were separated at 1 / 2.

[0048] The dominant phyla of fecal microbiota were Bacteroidetes and Firmicutes, and the dominant genera were Lactobacillus, Micrococcus and Bacteroides; 7 differential bacterial species were identified between the healthy control group and the model group, including Doretella, Bacteroides ph8, Bacteroides fragilis, etc., and 4 differential bacterial species were identified between the model group and the probiotic group, including Lactobacillus ASF360, etc. Probiotics regulate intestinal homeostasis and restore intestinal barrier function by changing the composition of the intestinal community, which may be one of the reasons why probiotics relieve the symptoms of inflammatory bowel disease.

Claims

1. A strain of Bifidobacterium breve BX-18, characterized in that The deposit number of the Bifidobacterium breve BX-18 is CGMCCNO.28446, and the deposit address is the General Microbiological Culture Collection Center of the China Microbiological Culture Collection Administration.

2. The Bifidobacterium breve BX-18 according to claim 1, characterized in that The sequence of 16S rRNA of the Bifidobacterium breve strain BX-18 is shown in SEQ ID NO.

1.

3. A bacterial agent containing the Bifidobacterium breve BX-18 strain according to claim 1 or 2.

4. A method for preparing a bacterial agent containing the Bifidobacterium breve BX-18 strain according to claim 1 or 2, characterized in that: The culture medium was cultured under anaerobic conditions.

5. Use of the Bifidobacterium breve BX-18 according to claim 1 or 2, or the bacterial preparation according to claim 3, or the bacterial preparation prepared by the preparation method according to claim 4 in preparing a product for improving the symptoms of inflammatory bowel disease.

6. The use according to claim 4, characterized in that: The products include food, health products and medicines.

Images