Bioluminescent modified ham assay to detect immune complex deposition on human cells, complementopathies, immune deficiency states, and monitoring drug levels

Abstract

The present invention relates generally to the field of disorders of complement activation. More specifically, the present invention provides methods and compositions useful for diagnosing and treating complementopathies and monitoring therapy in disease where complement inhibitors are used. In one aspect, the present invention provides a method for detecting dysregulation of the alternative pathway of complement in a patient. In one embodiment, the method comprises the steps of (a) contacting serum obtained from a patient with a composition comprising double CD46 / PIGA knockout (DKO) cells suspended in MgEGTA buffer; and (b) measuring luminescence continuously or serially over a period of time, wherein a lower luminescence related to a healthy control indicates dysregulation of the alternative pathway of complement in the patient.

Description

[0001]BIOLUMINESCENT MODIFIED HAM ASSAY TO DETECT IMMUNE COMPLEX DEPOSITION ON HUMAN CELLS, COMPLEMENTOPATHIES, IMMUNE DEFICIENCY STATES, AND MONITORING DRUG LEVELS CROSS-REFERENCE TO RELATED APPLICATIONS This application claims the benefit of U.S. Provisional Application No.63 / 699,523, filed September 26, 2024, U.S. Provisional Application No.63 / 652,901, filed May 29, 2024, and U.S. Provisional Application No.63 / 587,572, filed October 3, 2023, each of which are incorporated herein by reference in their entireties. GOVERNMENT SUPPORT CLAUSE This invention was made with Government support under grant no. HL133113, awarded by the National Institutes of Health, and under grant no. W81XWH-21-1-0898, awarded by the Army Medical Research and Development Command. The Government has certain rights in the invention. FIELD OF THE INVENTION The present invention relates generally to the field of disorders of complement activation. More specifically, the present invention provides methods and compositions useful for diagnosing and treating complementopathies and monitoring therapy in disease where complement inhibitors are used. REFERENCE TO AN ELECTRONIC SEQUENCE LISTING The text of the computer readable sequence listing filed herewith, titled “P18025-04”, created October 2, 2024, having a file size of 4,473 bytes, is hereby incorporated by reference in its entirety. BACKGROUND OF THE INVENTION Failure to regulate complement activation on cell surfaces primarily drives the pathogenesis of complement-mediated thrombotic microangiopathies (TMA) [Gavriilaki, E. & Brodsky, R.A., 130(5) J. CLIN. INVEST.2152-63 (2020); Merrill et al., 1 HEMATOL. AM. SOC. HEMATOL. EDUC. PROGRAM 371-76 (2018)]. Atypical hemolytic uremic syndrome (aHUS) is characterized by microangiopathic hemolytic anemia, thrombocytopenia, renal impairment, and preserved ADAMTS13 function [Baines, A.C. & Brodsky, R.A., 31(4) BLOOD REV.213-23 (2017); Nester et al., 67(1) MOL. IMMUNOL.31-42 (2015)]. Endothelial damage in aHUS is complement-mediated and up to 50% of patients harbor germline defects in complement regulatory genes or autoantibodies against complement regulatory proteins that modulate the alternative pathway of complement [Nester et al., 67(1) MOL. IMMUNOL.31-42 (2015); Noris, M. & Remuzzi, G., 66(2) AM. J. KIDNEY DIS.359-75 (2015)]. Penetrance is variable and development of clinically significant disease appears to require a supervening process. aHUS is commonly associated with a trigger, such as infection, surgery, pregnancy, cancer or autoimmunity. HELLP syndrome (hemolysis, elevated liver function tests, and low platelets) is a rare TMA that occurs in up to 0.5% of pregnancies, typically in the third trimester when complement levels are highest [Vaught et al., J. MATERN. FETAL NEONATAL MED 1-9 (2020)]. Similar to aHUS, up to 50% of cases harbor rare germline variants in genes that regulate the alternative pathway of complement [Vaught et al., 3(6) JCI INSIGHT (2018); Vaught et al., 44(5) EXP. HEMATOL.390-98 (2016)]. Typical HUS caused by Shiga toxin-producing Escherichia coli (STEC-HUS) and post-transplant associated TMA are also thought to be complement-driven TMAs but are less well characterized [Gavriilaki et al., 52(10) BONE MARROW TRANSPLANT 1355-60 (2017); Rotz et al., 1(2) BLOOD ADV.1632-34 (2017); Brady et al., 1(2) J. CLIN. EXP. NEPHROL. (2016); Noris et al., 8(11) NAT. REV. NEPHROL.622-33 (2012)]. The diagnosis of these disorders, especially aHUS, is challenging and often a diagnosis of exclusion. C5 inhibition with eculizumab is effective in treating aHUS, but uncertainty in the diagnosis coupled with the high cost of the drug often lead to the delays in treatment [Merrill et al., 130(3) BLOOD 368-72 (2017); Noris et al., 124(11) BLOOD 1715-26 (2014); Legendre et al., 368(23) NEW ENGL. J. MED.2169-81 (2013)]. Previously, we developed the modified Ham (mHam) assay to measure complement-mediated killing of nucleated cells in vitro [Gavriilaki et al., 125(23) BLOOD 3637-46 (2015)]. The assay is performed by mixing human serum with TF1 PIGA null cells, an engineered cell line that is devoid of the downstream cell-surface complement regulators, CD55 and CD59. Non-viability (cell killing) is measured in a colorimetric assay and ^ 20% cell killing after 2 h of incubation distinguishes aHUS from thrombotic thrombocytopenic purpura (TTP) with >95% sensitivity and specificity [Gavriilaki et al., 125(23) BLOOD 3637-46 (2015)]. The mHam is also positive (>20% cell killing) in most cases of HELLP, post-transplant TMAs, catastrophic antiphospholipid antibody syndrome (CAPS), and the acute phase of STEC- HUS [Chaturvedi et al., 135(4) BLOOD 239-51 (2020); Rotz et al., 1(2) BLOOD ADV.1632-34 (2017); Brady et al., 1(2) J. CLIN. EXP. NEPHROL. (2016); Vaught et al., 44(5) EXP. HEMATOL. 390-98 (2016)]. To date, there are several challenges that limit more widespread clinical use of the mHam. One such limitation is the presence of CR1 (complement receptor 1) on the TF1 cell line utilized in the assay. CR1 is not expressed on the renal endothelium and is a strong inhibitor of classical pathway complement activation. Secondly, a reliable confirmatory assay to corroborate results from the mHam is needed. Additionally, there are three pathways that can lead to terminal complement activation: classical, lectin and alternative. The mHam assay detects cell death caused by all three complement pathways. In order to predict responses to different complement inhibitors, assays that can isolate the specific complement pathway, which is dysregulated, are required. SUMMARY OF THE INVENTION The present invention is based, at least in part, on the development of a bioluminescent modified Ham assay. As described herein, the assay is a significant improvement on the mHam assay and can be used to diagnose complementopathies and monitor therapy of disease where complement inhibitors are used. The bioluminescent mHam assay has several advantages: ease of assay; remains positive for aHUS and negative for TTP (original purpose of the diagnostic assay); uses more cells (40k vs 7k), which gives more discriminatory power; real-time viability gives users greater confidence in results; ability to monitor therapy while on disease treatment; by combining with specific pathway inhibitors, the assay provides a reliable way to assess for relative contribution of each complement pathway (classical, alternative, or lectin) to a specific disease; and the assay provides a non-discriminatory way to assess for response to complement inhibition therapy regardless of disease class (e.g., aHUS, primary APS, or secondary APS). As described herein, the present inventors demonstrate these advantages in aHUS, primary APS and complement-mediated HUS (CM-HUS), but this assay is applicable to any immune complex disorder. The present invention is a very sensitive and reliable assay for detection of complement activating immune complexes on the cell surface. In particular embodiments, double knock out (PIGA / CD46) cells will allow for greatest sensitivity in monitoring for effective complement blockade (classical, alternative, or lectin pathway). In certain embodiments, when the double knock out is used in alternative pathway only buffer (MgEGTA) it provides a method to evaluate for effective alternative pathway inhibitor blockade. Finally, double knock out cells and mixing studies can be used to screen patients for complement deficiencies or depletion. Accordingly, in specific embodiments, the bioluminescent mHam assay of the present invention can be used in: 1. Diagnosis of complement mediated aHUS 2. Diagnosis of secondary complement-mediated thrombotic microangiopathy (for example post-transplant TMA, drug-associated TMA, malignancy-associated, malignant hypertension, scleroderma renal crisis) if mediated by a complement stimulus 3. Diagnosis of complement deficiency states 4. Diagnosis of HELLP syndrome 5. Diagnosis of antiphospholipid antibody syndrome / CAPS 6. Diagnosis of C3 glomerulopathy disease 7. Detection of autoreactive IgM in human serum 8. Detection of complement activity using whole blood and plasma; ability to probe mechanism of complement-mediated clotting 9. Monitoring of complement inhibitor drugs, for example, C5 inhibitors (ravulizumab and eculizumab), alternative pathway inhibitors (danicopan, iptacopan, pegcetacoplan), classical pathway inhibitors (sutimlimab), and lectin pathway inhibitors. Accordingly, in one aspect, the present invention provides compositions and methods for detecting complement activation in a patient. In one embodiment, a method for detecting complement activation in a patient sample comprising the steps of (a) contacting the patient sample with a plurality of cells that (i) are glycosylphosphatidylinositol-anchored protein (GPI- AP) deficient and (ii) have an autobioluminescent phenotype; and (b) measuring luminescence continuously or serially over a period of time, wherein a significant decrease in luminescence relative to a negative control indicates complement activation in the patient sample and wherein no significant decrease in luminescence relative to a negative control indicates no complement activation in the patient sample. Complement activation can be associated with a complement-mediated disease including, but not limited to, atypical hemolyetic syndrome (aHUS); post-transplant thrombotic microangiopathy (TMA); drug-associated TMA; malignant hypertension; scleroderma renal crisis; Hemolysis, elevated liver enzymes, low platelet count (HELLP) syndrome; antiphospholipid antibody syndrome / CAPS; or C3 glomerulopathy disease. In several embodiments, the negative control comprises heat-inactivated patient sample or healthy control. The patient sample can be serum, whole blood or plasma. In particular embodiments, the comparison of luminescence relative to the negative control is performed using a particular time point or a series of time points within the period of time of step (b). In a specific embodiment, the period of time of step (b) is about 1 to about 5 hours. In certain embodiments, the particular time point is between about 1 and about 2 hours. In other embodiments, the series of time points is about five minutes. The plurality of GPI-AP deficient cells can be biochemically treated to remove GPI-AP. In alternative embodiments, the plurality of GPI-AP deficient cells is a phosphatidylinositol glycan class A (PIGA) null mutant cell line. In some embodiments, the plurality of cells are CD46- / -. In specific embodiments, the plurality of cells are CR1- / -. In more specific embodiments, the plurality of cells are PIGA- / -, CD46- / - and CR1- / -. The plurality of cells can comprise double PIGA / CD46 knockout HEK293 cells. In particular embodiments, the autobioluminescent cells stably express bacterial luciferase (lux) and flavin reductase (luxF). In certain embodiments, the plurality of cells are HEK293, HCT116, HeLa, MepG2, or MCF7 cells. In another aspect, the present invention provides compositions and methods for monitoring complement inhibitor therapy in a patient. In a specific embodiment, a method for monitoring complement inhibitor therapy in a patient being treated for a disease or condition associated with complement activation comprises the steps of (a) contacting a sample obtained from the patient being treated with a complement inhibitor therapy with a plurality of cells that (i) are PIGA- / -, CD46- / - and CR1- / - and (ii) have an autobioluminescent phenotype; (b) measuring luminescence continuously or serially over a period of time; and (c) determining relative luminescence compared to a negative control using a particular time point or a series of time points within the period of time of step (b), wherein a significant decrease in luminescence relative to a negative control indicates complement activation and wherein no significant decrease in luminescence relative to a negative control indicates complement inhibition. In particular embodiments, the period of time of step (b) is about 1 to about 5 hours. In certain embodiments, the particular time point of step (c) is between about 1 and about 2 hours. In other embodiments, the series of time points of step (c) is about five minutes. In particular embodiments, the autobioluminescent cells stably express bacterial luciferase (lux) and flavin reductase (luxF). In certain embodiments, the plurality of cells are HEK293, HCT116, HeLa, MepG2, or MCF7 cells. In yet another aspect, the present invention can be used to determine whether a patient has a complement deficiency or a depletion of complement. In such embodiments, a sample from the patient has been previously tested and complement activation has been confirmed. In particular embodiments, the method comprises the steps of (a) mixing the patient sample with normal human serum and contacting the mixed sample with a plurality of autobioluminescent PIGA- cells; and (b) measuring luminescence continuously or serially over a period of time, wherein a significant decrease in luminescence relative to a heat-inactivated negative control indicates complement activity restoration and that the patient sample is depleted of complement, and wherein no significant decrease in luminescence relative to a negative control indicates the patient has a complement deficiency. In some embodiments, the autobioluminscent PIGA- cells are CR1- or CD46-. In other embodiments, the patient sample is mixed with normal human serum in about a 50:50 ratio. In certain embodiments, steps (a) and (b) are repeated with a plurality of autobioluminescent PIGA- / CD46- / CR1- cells, wherein a significant decrease in luminescence relative to a negative control indicates complement activity restoration and that the patient sample is depleted of complement, and wherein no significant decrease in luminescence relative to a negative control indicates the patient has a complement deficiency. In specific embodiments, the cells are HEK293 cells. In several embodiments, the negative control comprises heat-inactivated patient sample or healthy control. The patient sample can be serum, whole blood or plasma. In particular embodiments, the comparison of luminescence relative to the negative control is performed using a particular time point or a series of time points within the period of time of step (b). In a specific embodiment, the period of time of step (b) is about 1 to about 5 hours. In certain embodiments, the particular time point is between about 1 and about 2 hours. In other embodiments, the series of time points is about five minutes. The plurality of GPI-AP deficient cells can be biochemically treated to remove GPI-AP. In alternative embodiments, the plurality of GPI-AP deficient cells is a phosphatidylinositol glycan class A (PIGA) null mutant cell line. In some embodiments, the plurality of cells are CD46- / -. In specific embodiments, the plurality of cells are CR1- / -. In more specific embodiments, the plurality of cells are PIGA- / -, CD46- / -and CR1- / -. The plurality of cells can comprise double PIGA / CD46 knockout HEK293 cells. In particular embodiments, the autobioluminescent cells stably express bacterial luciferase (lux) and flavin reductase (luxF). In certain embodiments, the plurality of cells are HEK293, HCT116, HeLa, MepG2, or MCF7 cells. In a further aspect, the present invention can be used to determine or identify which complement pathway is activated in a patient. In some embodiments, the method comprises the steps of (a) contacting in a first reaction a patient sample separately with a classical pathway inhibitor, an alternative pathway inhibitor and a lectin pathway inhibitor; (b) contacting each of the first reactions with a plurality of autobioluminescent PIGA- / CD46- / CR1- cells; (c) measuring luminescence continuously or serially over a period of time; and (d) determining for each of the first reactions relative luminescence compared to a negative control using a particular time point or a series of time points within the period of time of step (c), wherein no significant decrease in luminescence relative to a negative control in one of the three first reaction indicates activation of that specific complement pathway, and wherein a significant decrease in luminescence relative to a negative control in one of the three first reactions indicates no activation of that specific complement pathway. In specific embodiments, the cells are HEK293 cells. In several embodiments, the negative control comprises heat-inactivated patient sample or healthy control. The patient sample can be serum, whole blood or plasma. In a specific embodiment, the period of time of step (c) is about 1 to about 5 hours. In certain embodiments, the particular time point of step (d) is between about 1 and about 2 hours. In other embodiments, the series of time points of step (d) is about five minutes. In particular embodiments, the autobioluminescent cells stably express bacterial luciferase (lux) and flavin reductase (luxF). In certain embodiments, the plurality of cells are HEK293, HCT116, HeLa, MepG2, or MCF7 cells. In some embodiments, the classical pathway inhibitor is a C1 inhibitor. In specific embodiments, the alternative pathway inhibitor is a C3 inhibitor. In other embodiments, the lectin pathway inhibitor is a MASP2 inhibitor. Testing for complement activation can include determining whether a complement inhibitor restores luminescence in the assay. Such a complement inhibitor comprises a terminal complement inhibitor such as a C5 inhibitor. In another aspect, the present invention provides a method for detecting dysregulation of the alternative pathway of complement in a patient. In one embodiment, the method comprises the steps of (a) contacting serum obtained from a patient with a composition comprising double CD46 / PIGA knockout (DKO) cells suspended in MgEGTA buffer; and (b) measuring luminescence continuously or serially over a period of time, wherein a lower luminescence related to a healthy control indicates dysregulation of the alternative pathway of complement in the patient. In particular embodiments, the DKO cells are CR1-. In certain embodiments, the alternative pathway buffer comprises Gelatin Veronal Buffer with Magnesium Ethylene Glycol Tetraacetic Acid. In specific embodiments, the control is a heat-inactivated control. In yet another aspect, the present invention provides methods for monitoring alternative pathway complement inhibition in a patient. In a specific embodiment, the method comprises the steps of (a) contacting a sample obtained from the patient being treated with an alternative pathway complement inhibitor with a plurality of cells that (i) are PIGA- / -, CD46- / -and CR1- / -and (ii) have an autobioluminescent phenotype, wherein the plurality of cells are suspended in alternative pathway buffer; (b) measuring luminescence continuously or serially over a period of time; and (c) determining relative luminescence compared to a negative control using a particular time point or a series of time points within the period of time of step (b), wherein a significant decrease in luminescence relative to a negative control indicates complement activation and wherein no significant decrease in luminescence relative to a negative control indicates complement inhibition. In particular embodiments, the negative control comprises heat-inactivated patient sample or healthy control. The patient sample can be serum, whole blood or plasma. In one embodiment, the period of time of step (b) is about 1 to about 5 hours. In another embodiment, the particular time point of step (c) is between about 1 and about 2 hours. In yet another embodiment, the series of time points of step (c) is about five minutes. The autobioluminescent cells can stably express bacterial luciferase (lux) and flavin reductase (luxF). In a further embodiment, the plurality of cells are HEK293, HCT116, HeLa, MepG2, or MCF7 cells. In yet another embodiment, the alternative pathway buffer comprises Gelatin Veronal Buffer with Magnesium Ethylene Glycol Tetraacetic Acid. In an alternative embodiment, a method for monitoring alternative pathway complement inhibition in a patient comprises the steps of (a) contacting a sample obtained from the patient being treated with an alternative pathway complement inhibitor with a plurality of cells that (i) are PIGA- / -, CD46- / -and CR1- / -and (ii) have an autobioluminescent phenotype, wherein the plurality of cells are suspended in alternative pathway buffer; (b) measuring luminescence continuously or serially over a period of time; and (c) determining relative luminescence compared to a positive control using a particular time point or a series of time points within the period of time of step (b), wherein no significant increase in luminescence relative to a positive control indicates complement activation and wherein a significant increase in luminescence relative to a negative control indicates complement inhibition. It is understood that reference herein and throughout this disclosure to CM-HUS is also a reference to TMA in general. For example, the Figures and descriptions thereof can mean CM- HUS as well as TMA. BRIEF DESCRIPTION OF THE FIGURES FIG.1. Example tracings of bioluminescent mHam in aHUS. Relative luminescence of 40,000 LL PIGA0HEK293 cells treated with aHUS serum, heat inactivated aHUS serum (HI), or complement inhibitors. The relative contribution of each complement pathway was determined by use of specific inhibitors: eculizumab (C5 inhibitor, terminal / all pathway blockade, 50 ^g, / mL), sutinmlimab (C1s inh, CP inhibitor, 30 ^g / mL), ACH-4471 (FDi, FD inhibitor, AP inhibitor, 1 ^M or 10 ^M), and lufaxin (C3 proconvertase inhibitor, AP inhibitor, 2 ^M). FIG.2. The bioluminescent mHam in aHUS and APS. Relative luminescence of LL PIGA0HEK293 (t=1h) in healthy control or pooled NHS (n=10), acute TTP (n=5), acute aHUS (n=1) or aHUS in remission (n=6), aHUS + C5 inh (n=5), aHUS + C1s inh (n=5), aHUS + Fdi (n=4), aHUS + lufaxin (n=1), aHUS on C5 inhibitor therapy (n=11), primary (1°) thrombotic APS (n+13 with 5 single positive and 8 triple positive ), 1° APS + C5 inh (n=2), 1° APS + C1s inh (n=2), 1° APS + lufaxin (n=2), secondary (2°) APS (n=12 with 2 single positive, 5 double positive and 5 triple positive). Each dot represents a different patient sample. Multiple comparisons are made by ANOVE with Tukey’s multiple comparisons. Relative luminescence was calculated by comparison to each sample’s own heat inactivated control. A relative luminescence of <25% at one hour is designated as “positive.” FIG.3. The mHam assay relies on PIGA null TF-1 cells (erythroblasts). FIG.4. mHam assay procedure. FIG.5. Traditional mHam assay distinguishes aHUS form normal controls and TTP. FIG.6A-6B. Livelight (LL) HEK293 PIGA knockouts (GPI anchor deficient in CD55 and CD59) were selected with proaerolysin. FIG.6A: Channels—PB450 was CD55, PE was CD59 and FITC was FLAER. FIG.6B: Luminescence of 60K cells PIGA WT and PIGA null. FIG.7A-7B. Livelight HEK293 CD46 KO were generated by CRISPR / Cas9 and single cell sorting. FIG.7A: Histogram of 3 CD46 clones generated by CRISPR / Cas9 and stained with anti-CD46 PE. Wild type in orange for baseline CD46 expression. FIG.7B: Histogram of 2 double PIGA and CD46 clones generated by CRISPR / Cas9 and stained with anti-CD46 PE. Wild type in red for baseline CD46 expression. FIG.8. LL HEK293 cells lack CR1 on the cell surface. FIG.9. LL HEK293 cells lack CR1 and CD46 on the cell surface, making them extremely susceptible to classical pathway activation. FIG.10A-10C. LL HEK293 cells transmittance in PBS and whole blood (FIG.10A), whole blood (FIG.10B) and PBS (FIG.10C). FIG.11A-11B. Luminescence of wild type HEK293 cells in NHS and HI NHS. FIG. 11A: WT NHS v. WT HI NHS. FIG.11B: WT v. HI NHS WT. FIG.12A-12C. PIGA null cells show luminescence difference in healthy controls. FIG. 12A: HC01 v. HI HC01. FIG.12B: HC02 v. HI HC02. FIG.12C: HC03 v. HI HC03. FIG.13A-13B. Luminescence difference is restored by either C5 inhibition or C1s inhibition. Healthy control serum is titrated with eculizumab (FIG.13A) or sutimlimab (FIG. 13B). FIG.14. Serum of patient with aHUS added to LL PIGA null HEK293 cells. FIG.15. Serum of patient with antiphospholipid antibody syndrome added to LL PIGA null HEK293 cells. FIG.16A-16B. Serum of patient with TTP added to LL PIGA null HEK293 cells. FIG. 16A: TTP 52969. FIG.16B: 16148 acute TTP. FIG.17A-17B. Serum of patient known to be on treatment with C5 inhibitors. FIG. 17A: 5859 SOT-HUS on ecu. FIG.17B: 47050 acute aHUS on ecu. FIG.18A-18D. The bioluminescent mHam in healthy controls (HC). (FIG.18A) Example HC serum with or without the addition of eculizumab (ecu, C5 inh, 50 μg / mL) or sutimlimab (sut, C1s inh, 30 μg / mL). (FIG.18B) HC sample in all pathway buffer (GVB++, blue), no extra calcium or magnesium added (GVB0, green), or all pathways closed (GVB- EDTA, purple). (FIG.18C) HC sample in AP only buffer (GVB-MgEGTA). (FIG.18D) Relative luminescence of LL PIGA0HEK293 at t=1 h compared to heat inactivated control for HC serum with or without the addition of inhibitors: The relative contribution of each complement pathway was determined by use of specific inhibitors: eculizumab (C5 inh, terminal / all pathway blockade, 50 ug / mL), sutimlimab (C1s inh, CP inhibitor, 30 ug / mL), ACH- 4471 (FD inh, AP inhibitor, 1 μM), and lufaxin (C3 proconvertase inhibitor, AP, 2 μM). Each dot represents a different healthy control or pooled normal serum sample. FIG.19A-19F. The bioluminescent mHam in aHUS and APS. FIG.19A) Example aHUS serum with or without the addition of eculizumab, sutimlimab, ACH-4471 FD inhibitor, or lufaxin (pro-C3 convertase inhibitor). FIG.19B) Example tracing of acute aHUS sample started on eculizimab therapy with or without the addition of additional sutimilmab or eculizumab. FIG. 19C) Relative luminescence of LL PIGA0HEK293 (t=1 h) in aHUS samples in comparison to acute TTP, HC; also with complement inhibitors as specified in methods. aHUS (n=6), aHUS + C5 inh (n=5), C1s inh (n=5), Fdi (n=4), lufaxin (n=1), aHUS on therapy (n=11). FIG.19D) PAPS serum incubated with increasing concentrations of eculizumab. FIG.19E) PAPS serum incubated with increasing concentrations of sutimlimab. FIG.19F) Relative luminescence of LL PIGA0HEK293 compared to heat inactivated control (t=1 h) incubated with APS serum in comparison to HC; also with complement inhibitors as specified in FIG.18. Primary thrombotic APS (n=10 with 5 single positive and 5 triple positive), secondary thrombotic APS (n=12), C5 inh (n=2), C1s inh (n=2), lufaxin (n=2). Each dot represents a different patient sample. FIG.20A-20C. LL CD46 null HEK293 cells treated with NHS and serum from aHUS and primary APS. FIG.20A: CD46 knockout. FIG.20B: HC RB on CD46KO. FIG.20C: 50065 (aHUS, preeclampsia with severe features) on CD46KO. FIG.21A-21B. Double CD46 / PIGA null cells are effective for monitoring complement blockade and complement deficiencies. Healthy control serum on PIGA null cells (FIG.21A) v. double KO cells (FIG.21B). FIG.22A-22C. Serum from patient with suspected complement deficiency is run on PIGA null (FIG.22A), mixed with pool NHS and run on PIGA null (FIG.22B) and serum run on double KO (FIG.22C) FIG.23A-23B. Patients on effective complement blockade still show full blockade on double KO. FIG.23A: 50065-2 (aHUS, preeclampsia with severe features) on ecu on double KO. FIG.23B: 72823 (C3 related aHUS on rav) on double KO. FIG.24A-24F. Complement biosensors identify a range of “normal” complement activation in healthy control sera. FIG.24A: Overview of creation of biosensors with different susceptibilities to complement and description of the assay. Created with biorender.com. FIG. 24B-24E: Livelight WT HEK293 cells (FIG.24B), CD46KO cells (FIG.24C), PIGAKO cells (FIG.24D), Double CD46 and PIGA KO (DKO) cells (FIG.24E) incubated with healthy control (HC) or heat-inactivated sera from the same HC. Relative luminescence measured every 5 minutes for 2.5 h. RLU = relative luminescence units. Data plotted as mean + / - SD for each triplicate. FIG.24F: Summary of relative luminescence at t = 1 h for healthy controls. n= 19 for WT, CD46KO, PIGAKO; n=18 for DKO. (*) identifies outlier by ROUT analysis (Q=1%). P values were calculated using one-way ANOVA for Dunnett’s multiple-comparisons test. ns, not significant, כp < 0.05, ככp < 0.01, כככp < 0.001, ככככp < 0.0001. FIG.25A-25L. Example HUS tracings and summary of relative luminescence and blocking. FIG.25A, 25D: CM02 sera on CD46KO cells (FIG.25A) or PIGAKO cells (FIG. 25D) in GVB++ with or without heat inactivation (HI), eculizumab (ecu, 50 ^g / mL), sutimlimab (sut, 30 ^g / mL), or ACH-5548 (FDi). FIG.25B, 25E: Summary of relative 1 hour luminescence of healthy controls (HC), CM-HUS (acute or remission) with or without the addition of eculizumab, sutimlimab, ACH-4471 / ACH-5548 (FDi, 1 ^M), iptacopan (FBi, 1.5 ^M), or “triple AP blockade” with FDi (1 ^M), FBi (1.5 ^M), and compstatin (18 ^M) on CD46KO (FIG.25B) or PIGAKO (FIG.25E). PIGAKO: HC n=18, acute TTP n=6, acute CM-HUS n=5, remission n=14, CM-HUS + ecu n=12, CM-HUS + sut n=11, CM-HUS + FDi n =11. CD46KO: HC n=18, acute TTP n=6, acute CM-HUS n=5, remission CM-HUS n =13, CM-HUS + ecu n=8, CM-HUS + sut n=8, CM-HUS + FDi n =7, CM-HUS FBi n=3, CM-HUS triple blockade n=3. Graphed as mean + / - SD. Dark green fill indicates sample with pathogenic variant or VUS in complement regulatory protein. Dashed line represents the 15th percentile of healthy control. FIG.25C, 25F: Relative 1 h luminescence recovery (percent recovery from untreated sera to heat inactivated sera) after addition of inhibitor. PIGAKO: n=10 for each condition, CD46KO: CM-HUS + ecu n=12, CM-HUS + sut n=9, CM-HUS + FDi n=8, CM-HUS +FBi n=3, triple blockade n=3. FIG. 25B-25C, 25E-25F: P values were calculated using one-way ANOVA for Dunnett’s multiple- comparisons test. FIG.25G-25H: AP only buffer inhibits complement activity. CM12 sera on PIGAKO in GVB++ (FIG.25G) or MgEGTA (AP only buffer with 13 mM Mg2+) (FIG.25H) with or without inhibitors as indicated in legend. FIG.25I: Example tracing of acute CM-HUS CM03 (Factor H autoantibody) on CD46KO with or without inhibitors as indicated in legend. FIG.25J: Example tracing of remission CM-HUS no mutation CM01 on CD46KO with addition of iptacopan (FBi, 1.5 ^M). FIG.25K: Example tracing of CM13 on CD46KO with addition of “triple AP blockade” including with FDi (1 ^M), FBi (1.5 ^M), and compstatin (18 ^M). FIG. 25L: Example tracing of C3 glomerulopathy (C3G) with VUS in CD46 on CD46KO. Activity persists despite C3 being below limit of detection at time sample was collected (<15 mg / dL). FIG.25A, 25D, 25G-25L: RLU = relative luminescence units. Data plotted as mean + / - SD for each triplicate. ns, not significant, כp < 0.05, ככp < 0.01, כככp < 0.001, ככככp < 0.0001. FIG.26A-26L. C4d and C3c deposition and inhibition in HC and CM-HUS samples. All experiments were done in the presence of C5 inhibitor, eculizumab (100 ^g / mL). WT, PIGAKO, or CD46KO cells were treated with 20% serum in GVB++ for 30 minutes and then stained singly for either C4d or C3c and deposition quantified by flow cytometry. The same healthy control (n=4) and CM-HUS (n=4 for WT, n=5 for PIGAKO and CD46KO) were used across all cell types. ns, not significant, כp < 0.05, ככp < 0.01, כככp < 0.001, ככככp < 0.0001. FIG.26A: Comparison of C4d deposition across cell types by percent positive cells determined by gating on heat-inactivated HC sample. FIG.26B: Relative median fluorescence intensity (MFI) of C3c deposition on sample compared to average MFI of 4 healthy controls samples. FIG.26C: Comparison of C3c deposition across cell types by percent positive cells determined by gating on heat-inactivated HC sample. FIG.26A-26C: Intra cell line differences between HC and CM- HUS P values were calculated with unpaired Mann-Whitney test. Inter cell line P values were calculated with a paired, two-tailed student’s t-test. FIG.26D, 26G, 26J: C4d deposition on WT cells (FIG.26D), PIGAKO (FIG.26G), PIGAKO (FIG.26J) in HC or CM-HUS with or without addition of sutimlimab (50 ^g / mL, sut) or ACH-5548 (1 ^M, FDi). FIG.26E, 26H, 26K: C3c median fluorescence intensity (MFI) on WT cells (FIG.26D), PIGAKO (FIG.26G), PIGAKO (FIG.26J) in HC or CM-HUS with or without addition of sutimlimab (50 ^g / mL, sut) or ACH- 5548 (1 ^M, FDi). FIG.26D-26E, 26G-26H, 26J-26K: P values calculated using Friedman’s test for Dunn’s multiple comparisons. FIG.26F: Example histograms of CM07 on WT cells with or without heat inactivation (HI), sutimlimab or factor D inhibitor. FIG.26I: Example histograms of CM12 on PIGAKO cells with or without heat inactivation (HI), sutimlimab or factor D inhibitor. FIG.26L: Example histograms of CM06 on CD46KO cells with or without heat inactivation (HI), sutimlimab or factor D inhibitor. FIG.27A-27H. PIGAKO and DKO can be used to monitor therapeutic complement inhibition. FIG.27A: Example tracing of solid organ transplant-associated TMA sample on therapeutic eculizumab ran on PIGAKO cells with or without addition of sutimlimab or eculizumab. FIG.27B: Example tracing of CM01 remission sample after being started on eculizumab on DKO cells. FIG.27C: Summary of relative luminescence at t = 1 h for CM-HUS samples (n=14). Unpaired acute and remission samples are included as a reference. P values were calculated using one-way ANOVA for Dunnett’s multiple-comparisons test. ns, not significant, כp < 0.05, ככp < 0.01, כככp < 0.001, ככככp < 0.0001. FIG.27D: Example tracing of CM21 on ravulizumab therapy with or without the addition of additional C5 inhibitor (eculizumab), sutimlimab, or factor D inhibitor on PIGAKO cells. FIG.27E: Example tracing of HC on DKO with increasing concentrations of eculizumab. FIG.27F: Example tracing of HC on PIGAKO with increasing concentrations of sutimlimab. FIG.27G: Example tracing of HC on DKO with increasing concentrations of C1-inhibitor. FIG.27H: Acute CM-HUS sample on eculizumab therapy, CM06, on PIGAKO diluted with pooled normal human serum. FIG.27A- 27B, 27D-27H. Example traces plotted as mean + / - SD for each triplicate. RLU = relative luminescence units. FIG.28A-28I. Serum treatment with DTT or IdeS and protein G spin columns identify IgM as the predominant immunoglobulin species leading to complement activation. FIG.28A: Non-reducing, no heat SDS-PAGE gel of IgG and IgM with increasing concentrations of DTT. IgG (3 ^g), IgM (3 ^g), or both were incubated with DTT (0 mM, 0.5 mM, 1 mM, 3 mM) in PBS (pH 7.4) in a final reaction volume of 10 ^L at room temperature for 30 min. Following treatment, samples were diluted with 4x loading dye (without reducing agent) and left at room temperature for 10 min prior to running SDS-PAGE gel and staining with coomassie. HC = heavy chain, LC = LC. IgM’ represents a partially reduced form of IgM. FIG.28B: Sera from patient with hemolysis, elevated liver enzymes, low platelets (HELLP) with or without the addition of additional C5 inhibitor (eculizumab), sutimlimab, DTT, or factor D inhibitor on PIGAKO cells. FIG.28C: CM12 sera (60 ^L per column, 120-240 ^L total) was processed over a protein G spin column to purify IgG (protein G eluate, GE) or isolate flow-through (protein G flow-through, GF). GE and GF underwent centrifugal concentration (as required), desalting, and buffer exchange into PBS. One third of final preparation per well was added to healthy control sera in the bioluminescent mHam on CD46KO cells with or without IdeS treatment (3.6 U / ^L for 2 h at 37 °C). FIG.28D: CM04 sera (240 ^L) prepared as per c. Following preparation GF samples were treated with IdeS (3.6 U / ^L for 2 h at 37 °C), DTT (3 mM pretreatment, final 0.6 mM), or sutimlimab (30 ^g / mL). One third of final preparation (60 ^L original volume) per well was added to healthy control sera in the bioluminescent mHam on CD46KO cells. FIG.28E: Example tracing of CM04 in bioluminescent mHam on CD46KO cells with or without heat inactivation, temperature control (untreated serum heated to 37 °C for 30 min), eculizumab, sutimlimab, IdeS pretreatment, or DTT pre-treatment. Final concentrations listed except for DTT. FIG.28F: Summary of relative luminescence at t = 1 h for CM-HUS samples treated with DTT (n=5) or IdeS (n=5). Unpaired acute, remission samples, and eculizumab spiked samples are included again as a reference. P values were calculated using one-way ANOVA for Dunnett’s multiple-comparisons test. ns, not significant, כp < 0.05, ככp < 0.01, כככp < 0.001, ככככp < 0.0001. FIG.28G: Healthy control sera spiked with polyclonal IgM (extra 5, 10, or 20 ^g / well) with final concentrations as indicated and ran in bioluminescent mHam on CD46KO cells. FIG.28H: Healthy control sera spiked with myeloma IgM (10 ^g / well), polyclonal IgM (10 ^g / well), myeloma IgG1 (10 ^g / well), polyclonal IgG (10 ^g or 60 ^g / well) with final concentrations as indicated and ran in bioluminescent mHam on PIGAKO cells. FIG.28I: Healthy control sera spiked with polyclonal IgM (5 or 10 ^g / well), polyclonal IgG (20 or 60 ^g / well), myeloma IgG1 (20 ^g / well), or myeloma IgM (10 ^g / well) with final concentrations as indicated and ran in bioluminescent mHam on DKO cells. FIG.28B-28E, 28G-28I: Example traces plotted as mean + / - SD for each triplicate. RLU = relative luminescence units. FIG.29A-29K. CM-HUS sera has increased IgM binding to HEK293 cell surfaces and can pre-sensitize cells even after heat inactivation of serum. Heat inactivated sera was utilized for all cytometry and pre-sensitization experiments to eliminate preloading of cells with C3 or C4 fragments. FIG.29A: WT cells were incubated for 45 min at 37 °C with either heat- inactivated HC or CM-HUS sera (20% in GVB++), washed, and evaluated for deposition of IgG (HC n=9, CM-HUS n=17) or IgM (HC n=7, CM-HUS n=15) by flow cytometry. Acute CM- HUS samples (n=6) indicated by red dots. MFI = median fluorescence intensity. Relative MFI calculated as ratio of sample MFI compared to average of 4 healthy controls ran with each experiment. P values were calculated using unpaired, two-tailed t test with Welch’s correction. ns, not significant. FIG.29B: Example histograms of IgG (left) or IgM (right) staining from CM21 on WT cells with (red) or without (blue) pretreatment of serum with DTT (3 mM pretreatment). HC stained IgG or IgM stained cells included as baseline reference population (grey). FIG.29C: Example histograms of IgG (left) or IgM (right) staining from CM04 on WT cells with (red) or without (blue) pretreatment of serum with DTT (3 mM pretreatment). HC stained IgG or IgM stained cells included as baseline reference population (grey). FIG.29E- 29G, 29I-29K: Specially selected low activity healthy control sera mix was utilized to facilitate complement activity in the bioluminescent mHam after either DKO (FIG.29E-29G) or PIGAKO (FIG.29I-29K) cells were pre-sensitized (20% sera treatment for 45 min in DMEM), washed, and resuspended in GVB++ then ran in the bioluminescent mHam. Baseline activity of the healthy control mix sera shown in each tracing as dark blue (HC sera mix) and dark red (HI HC sera mix). FIG.29D: Bioluminescent mHam tracing of HC1 on DKO. FIG.29E: Bioluminescent mHam tracing of HC1 presensitized DKO cells with HC sera mix. FIG.29F: Bioluminescent mHam tracing of CM21 presensitized DKO cells with HC sera mix. FIG.29G: Bioluminescent mHam tracing of CM04 presensitized DKO cells with HC sera mix. FIG.29H: Bioluminescent mHam tracing of HC2 on PIGAKO. FIG.29I: Bioluminescent mHam tracing of HC2 presensitized PIGAKO cells with HC sera mix. FIG.29J: Bioluminescent mHam tracing of CM07 presensitized PIGAKO cells with HC sera mix. FIG.29K: Bioluminescent mHam tracing of CM06 presensitized PIGAKO cells with HC sera mix. FIG.29D-29K: Example traces plotted as mean + / - SD for each triplicate. RLU = relative luminescence units. FIG.30A-30B. FIG.30A: Wieslab AP inhibition. FIG.30B: Wieslab CP inhibition. Each assay was completed as per manufacturer’s instructions using healthy control serum with or without inhibitors as documented. FIG.31A-31B. Optimized IdeS cleavage. NHS (10.4 ^L of a 1:50 dilution) of NHS after treatment with IdeS at indicated timepoints. FIG.31A: 3.6 U / ^L IdeS. FIG.31B: 7.1 U / ^L IdeS. FIG.32. DTT treatment of HC sera on PIGAKO. HC sera is treated with increasing concentrations of DTT. Sutimlimab inhibition included for comparison. FIG.33A-33B. Inhibition of polyclonal IgM with eculizumab and sutimlimab on PIGAKO (FIG.33A) or DKO (FIG.33B). The data complements uninhibited data in FIG.28H- 28I. FIG.34A-34E. Presensitization of PIGAKO with CM-HUS serum in remission and or on C5 inhibition. CM-HUS-S01 through CM-HUS S04 are four CM-HUS patients in remission known to be on C5 inhibitor therapy not presented elsewhere in the manuscript. Specially selected low activity healthy control sera mix was utilized to facilitate complement activity in the bioluminescent mHam after PIGAKO cells were pre-sensitized (20% sera treatment for 45 min in DMEM), washed, and resuspended in GVB++ then ran in the bioluminescent mHam. Baseline activity of the healthy control mix sera shown in each tracing as dark blue (HC sera mix) and dark red (HI HC sera mix). Example traces plotted as mean + / - SD for each triplicate. RLU = relative luminescence units. FIG.35. Heat aggregated IgG treatment of PIGAKO cells. Heat aggregated gamma globulin from Quidel (a strong CP stimulant) was added into the assay at the indicated volumes. Aggregated IgG was added to the cells to avoid complement depletion prior to running the assay. FIG.36. Assay in A P only buffer (13 mM MgEGTA in GVB0) with healthy control serum on DKO cells. DKO cells were resuspended in MgEGTA with subsequent addition of healthy control serum with or without the addition of eculizumab, sutimlimab, Factor D inhibitor (FDi, ACH-5548), or a combination of sutimlimab and factor D inhibitor. FIG.37A-37B. C4d (FIG.37A) and C3c (FIG.37B) median fluorescence intensity (MFI) on WT TF-1 cells with or without addition of sutimlimab (30 ^g / mL, sut) or ACH-5548 (1 ^M, FDi). HC (n=2) and CM-HUS samples (n=2) utilized are from same sera pools used on HEK293 cells. CR1 expression on TF-1 cells results in slightly different proportions of degradation fragments, i.e., better overall control of C3 in particular comparing HC to CM-HUS. FIG.38A-38G. Alternative pathway assessment. Assay in AP only buffer (13 mM MgEGTA in GVB0) on DKO cells (FIG.38A, 38B, 38 D, 38E, 38F) or CD46KO cells (FIG. 38C). FIG.38A: DKO cells were resuspended in MgEGTA with subsequent addition of healthy control serum with or without the addition of eculizumab, sutimlimab, factor D inhibitor (FDi, ACH-5548), or a combination of sutimlimab and factor D inhibitor. FIG.38B-38C: Serum from CM03, patient with known Factor H autoantibody titer of 57,104 AU, in AP buffer on either DKO cells (FIG.38B) or CD46KO cells (FIG.38C) with or without the addition of factor D inhibitor or sutimlimab. FIG.38D-38G: Isolated alternative pathway inhibitor titrations. Pooled NHS from complement technologies was incubated with increasing concentrations of eculizumab (FIG.38D), factor D inhibitor (ACH-5548) (FIG.38E), factor B inhibitor (iptacopan) (FIG.38F), or C3 inhibitor (cp40) (FIG.38G) in AP buffer on DKO cells. Example traces plotted as mean + / - SD for each triplicate. RLU=relative luminescence units. FIG.39. All pathway bioluminescent mHam assay (in GVB++) on CD46KO cells with incomplete blockade from classical pathway inhibitor (sutimlimab) which is augmented by addition of EVO24, a MASP-2 inhibitor. FIG.40A-40B. Examples of classical pathway and lectin pathway contributions to alternative pathway dysregulation. (FIG.40A) Healthy control sera in MgEGTA on DKO cells with ACH-5548 (factor D inhibitor), EVO24 (MASP-2 / lectin pathway inhibitor), or dual inhibition with sutimlimab (C1s / classical pathway inhibitor) and EVO24. (FIG.40B) aHUS / CM-TMA sera from patient with pathogenic CD46 mutation in MgEGTA on DKO cells blocked with either sutimlimab or cp40 (C3 inhibitor of alternative pathway). FIG.41. Summary of Isolated AP bioluminescent mHam. Summary of relative 1 hour luminescence on DKO cell line in MgEGTA: HC n=21, acute with variant or FHAA (n=4), remission any VUS or FHAA (n=7), acute no variant detected on genetic testing (n=1), remission no variant detected on genetic testing (n=3), acute TNP (n=2), and remission TNP (n- 2). TNP = testing not performed or pending. Specific variants outlined in table 1.P values were calculated using one-way ANOVA for Dunnett’s multiple-comparisons test. DETAILED DESCRIPTION OF THE INVENTION It is understood that the present invention is not limited to the particular methods and components, etc., described herein, as these may vary. It is also to be understood that the terminology used herein is used for the purpose of describing particular embodiments only, and is not intended to limit the scope of the present invention. It must be noted that as used herein and in the appended claims, the singular forms “a,” “an,” and “the” include the plural reference unless the context clearly dictates otherwise. Thus, for example, a reference to a “protein” is a reference to one or more proteins, and includes equivalents thereof known to those skilled in the art and so forth. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Specific methods, devices, and materials are described, although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention. All publications cited herein are hereby incorporated by reference including all journal articles, books, manuals, published patent applications, and issued patents. In addition, the meaning of certain terms and phrases employed in the specification, examples, and appended claims are provided. The definitions are not meant to be limiting in nature and serve to provide a clearer understanding of certain aspects of the present invention. I. Bioluminescent Modified Ham Assay The modified Ham assay (mHam) assay detects abnormal cell-based complement deposition and thus, established measurement of complement activity in aHUS, HELLP, CAPS, and SARS-CoV-2 spike protein. The underlying principle of the mHam assay is that if you knockout surface complement regulators, then more cells will die when exposed to serum of a patient with abnormal complement activation. The assay requires: 1) TF-1 PIGA null cell line (lacking CD55 and CD59); 2) patient serum with aHUS; 3) heat inactivated control; and 4) WST-1 viability assay. A positive assay has been established as >20% cell death. Receiver operator curve had significantly high area under the curve (0.996, P < .001) to differentiate aHUS from TTP. The mHam assay relies upon PIGA null TF-1 cells (erythroblasts) (FIG.3). The loss of all GPI-anchored proteins including CD55 and CD59 makes them more susceptible to surface complement deposition and apoptosis. Heat inactivation acts as negative complement activity control (100% viability). Complement was originally discovered as the “heat-labile” component of antibody mediated cell killing. Heating C3 and C4 at 56 °C for 30 minutes is a well- established method of removing complement activity through hydrolysis of the thioester bond (converting all potential convertase components to inactive forms). The modified Ham assay is shown in FIG.4. Absorbance measurements at t=1h and t=2h. More than 20% cell death is established as the positive / negative cutoff for excess complement-mediated cell killing. Control normal human serum (NHS) should typically be <10%. As shown in FIG.5, the traditional modified HAM assay distinguishes aHUS from normal controls and TTP. More than 20% cell death is established as the positive / negative cutoff for excess complement-mediated cell killing. Control normal human serum (NHS) should typically be <10%. The modified Ham assay has its limitations, however. The assay requires multiple cell washes on a small number of cells (~7000) which can lead to variable cell loss depending upon operator technique. Complement activation is dynamic and pipetting time in setting up the assay can be variable; only a one and two hour timepoint can be obtained. Serum is the substrate and the assay cannot be performed in plasma / whole blood (limiting ability to study interactions with coagulation). In addition, the mHam assay cannot be used to monitor therapy. Finally, CR1 is present on the cells in the traditional mHam and prevents detection of relevant classical complement pathway activity. In order to study complement activation in whole blood and plasma, the present inventors developed an assay based on bioluminsscence. Thus, what is unachievable with absorbance based and fluorescent reporters, can be done in whole blood and in vivo studies with luminescence. In specific embodiments, LiveLight HEK293 cells (BioTech 490) are engineered to stably express the bacterial luciferase (lux) and flavin reductase gene (luxF) to create autonomous bioluminescence. By selecting with proaerolysin, the present inventors developed Livelight HEK293 PIGA knockouts (GPI anchor deficient in CD55 and CD59) (FIG.6A-6B). More specifically, Livelight HEK293 CD46 KO were generated by CRISPR / Cas9 and single cell sorting (FIG.7A-7B). The critical difference is lack of CR1 on the cell surface which more closely approximates the regulators on an endothelial cell (cell of interest in disease pathology) (FIG.8). Without CR1 and CD46, the cells are extremely susceptible to classical pathway activation (FIG. 9). Livelight HEK293 cells are visible in whole blood but about 1-3% transmittance compared to PBS (FIG.10A-10C). The bioluminescent modified Ham assay is simplified without pipetting / washes or added reagents. In particular embodiments, the assay comprises the steps of: (1) Harvest 40k cells; (2) Resuspend in GVB++ buffer; (3); Add serum; and (4) Place in luminometer and measure relative luminescence every 5 minutes over 3 hours at 37°C. Metabolic activity is measured continuously over 3 hours, but in certain embodiments, one hour was selected as readout given enhanced differences at this point. As shown in FIG.11A-11B, wild type HEK293 do not show any difference in luminescence in normal human serum. Wild type cells are treated with normal human serum and do not show significant change in luminescence. In contrast, PIGA null cells show a luminescence difference in healthy controls. Briefly, healthy control serum is added to LL HEK293 PIGA null cells and shows a deficit of metabolic activity (blue) compared to the heat inactivated control (red) (FIG.12A-12C). Luminescence difference is restored by either C5 inhibition or C1s inhibition (FIG.13A- 13B). Healthy control serum is titrated with eculizumab (left) or sutimlimab (right). Dose dependent effects of complement inhibition are observed restoring cell viability / metabolic health. aHUS serum results in rapid and sustained decrement in luminescence that is rescued by heat inactivation, C5 inhibition and C1s inhibition (FIG.14). Serum from a patient known to have aHUS is added to LL PIGA null HEK293 cells and shows a rapid and sustained decrement in luminescent activity. Luminescent activity is restored by either C5 inhibition or C1s inhibition. Bioluminescent mHAM shows similar luminescent changes for triple positive antiphospholipid antibody syndrome (FIG.15). Briefly, LL PIGA null cells are treated with serum from a patient with antiphospholipid antibody syndrome. Again, a rapid and sustained decrement in luminescent activity is observed. Traditional mHAM average of 11.4%, i.e., not positive (ran multiple times). Acute TTP produces luminescence difference similar to healthy controls (FIG.16A-16B). In patients known to be on eculizumab, luminescent signals overlap for serum and heat- inactivated control. Demonstrating ability to monitor effective complement blockade. Briefly, LL PIGA null HEK293 cells are treated with patient serum known to be on treatment with C5 inhibitor drugs (such as ravulizumab and eculizumab). Patient samples known to be on eculizumab overlap with heat inactivated controls. No additional restoration is observed by addition of exogenous complement inhibitors (FIG.17A-17B). LL CD46 null HEK293 cells are potentially more specific for complement activity (FIG. 20A-20C). LL CD46 null HEK293 cells treated with normal human serum cause no luminescent decrement in healthy controls but still significant activity in aHUS and primary APS. On right, the top tracing shows a healthy control and the bottom tracing shows an aHUS patient. Double CD46 / PIGA null Cells are extremely sensitive for ongoing complement activity and thus likely will be best cell line to monitor for effective complement blockade and complement deficiencies (FIG.21A-21B). Healthy control serum on PIGA null cells (left) vs double knock out cells (CD46 / PIGA) on right. Lack of complement regulators on the cell surface make them exquisitely sensitive to complement activity. As sown in FIG.22A, serum from a patient with suspected complement deficiency is ran on PIGA null cells and shows overlap of curves similar to complement inhibition. FIG.22B: Mixing the patient serum 50:50 with pooled normal human serum again shows no significant change on activity on PIGA null cells. If depletion of complement as opposed to deficiency, activity would have been restored. FIG.22C: Running the patient serum on double knock out cells again shows no significant change in luminescent activity relative to heat inactivated control suggesting a complement deficiency. Patients on effective complement blockade still show full blockade on double knockouts (FIG.23A-23B). Left shows a patient on effective complement inhibition. Right shows a patient who is not fully inhibited despite standard ravulizumab dosing. II. Cells A. Null Mutant Cells—PIGA, CR1 and / or CD46 In particular embodiments, the present invention utilizes cells that are (i) glycosylphosphatidylinositol-anchored protein (GPI-AP) deficient and (ii) have an autobioluminescent phenotype. In some embodiments, cells are biochemically treated to remove GPI-AP. In other embodiments, the plurality of GPI-AP deficient cells is a phosphatidylinositol glycan class A (PIGA) null mutant cell line. The present inventors previously established a PIGA mutant cell line derived from TF1 cells. PIGA is a gene required for the first step in the biosynthesis of glycosylphosphatidylinositol (GPI), a lipid moiety that anchors dozens of proteins to the cell surface. Two of the GPI-anchored proteins that are defective in the TF1 cell line are CD55 and CD59. The proteins both regulate complement. CD55 blocks C3 convertases and CD59 interferes with / blocks terminal complement activation. The present invention incorporates by reference the disclosures of U.S. Patent Application No.15 / 553,826 (U.S. Patent Application Publication No.2018 / 0246082) and U.S. Provisional Patent Application No.62 / 944,439, filed December 6, 2019. In other embodiments, the plurality of cells are CD46- / -. The cells can also be CR1- / -(e.g., HEK293 cells). In certain embodiments, the plurality of cells are PIGA- / -, CD46- / -and CR1- / -. In some embodiments, the plurality of cells are HEK293, HCT116, HeLa, MepG2, or MCF7 cells. In further embodiments, the plurality of cells comprise double PIGA / CD46 knockout HEK293 cells. B. Autobioluminescent Cells The terms “luminescent,” “bioluminescent,” and similar phrases may be used interchangeably. Further, “autonomously bioluminescent,” “autonomously luminescent,” “autobioluminescence,” and similar phrases may be used interchangeably. A cell is autonomously bioluminescent, or has autobioluminescence, when it self-synthesizes all of the substrates required for luminescent signal production, e.g., through expression of the luciferase (lux) cassette. That is, the mechanism for producing bioluminescence (also referred to as a luminescent or bioluminescent signal) operates autonomously and in real-time to indicate cellular and molecular mechanisms coupled to bioluminescent signal output. Certain embodiments of the present invention require thermostable expression of multigene pathways involved in bioluminescence in a host cell. In certain embodiments, host cell are capable of thermostable expression of bacterial luciferin / luciferase pathways. Functional bacterial luciferase requires expression of luxC, luxD, luxA, luxB, luxE, and frp. Cells (such as stem cells) including nucleic acids encoding each of luxA, luxB, luxC, luxD, luxE, and flavin reductase autonomously produce a bioluminescent signal via luxA, luxB, luxC, luxD, luxE, and flavin reductase working synergistically with endogenous myristic acid, endogenous flavin mononucleotide, and molecular oxygen to generate the bioluminescent signal. Nucleic acid cassettes can be designed to match this native gene order as generally discussed above. However, such an order is not required to maintain functionality of the such a system. For example, the order of the genes can be modified to place the luxC gene, which is traditionally the gene closest to the promoter, at the distal end of the cassette such that is arranged luxD, luxA, luxB, luxE, frp, luxC. Another embodiment permits thermostable expression of fungal luciferin / luciferase pathways. The luciferase in this system can be encoded by the luz gene. In addition, synthesis genes: hisps and h3h, work together to as a polyketide synthase and a 3-hydroxy benzoate 6-monooxygenase to supply the required luciferin, 3-hydroxyhispidin. For autonomous function in cells that do not naturally produce the supporting analyte, caffeic acid, this pathway can also be encoded with genes for tyrosine ammonia lyase, two 4-hydroxyphenylacetate 3-monooxygenase components and the 4’- phosphopantetheinyl transferase gene npgA (Kotlobay et al., 115(50) PROC. NATL. ACAD. SCI. USA 12728-32 (2018). The luciferase and / or luciferin processing proteins can be multimers formed by the products of multiple genes. Thus, in particular embodiments, the present invention utilizes a genetically engineered cell line configured to permit thermostable expression of a multigene system. Certain embodiments comprise a plurality of cells transformed with at least one polynucleotide encoding a protein, polypeptide, or fragment thereof involved in bioluminescence. In some embodiments, the protein, polypeptide, or fragment thereof is involved in the luciferin / luciferase pathway. Cells and methods of making and using cells having autobioluminescence are described in, for example, U.S. Patent No.7,300,792, entitled “Lux Expression in Eukaryotic Cells;” U.S. Patent No.11,046,962, entitled “Lux Expression in Cells and Methods of Use;” and International PCT Patent Application No. PCT / US2022 / 020370, entitled “System of Stable Gene Expression in Cell Lines and Methods of Marking and Using the Same,” all of which are incorporated by reference in their entireties. In some embodiments, the autobioluminescent cells are HEK293, HCT116, HeLa, MepG2, or MCF7 cells. III. Bioluminescent Modified Ham Assay In particular embodiments, the bioluminescent mHAM assay can generally comprise the following compositions and methods described below. There are numerous variations and combinations of reaction conditions, e.g., component concentrations, desired buffers, temperatures, and other reaction ranges and conditions that can be used to optimize the described process. Only reasonable and routine experimentation will be required to optimize such process conditions. Cell lines and tissue culture: Three cell lines are used in the assay including LiveLight (LL) PIGA- HEK293 cells, LiveLight (LL) CD46- / -HEK293 cells, and LiveLight (LL) PIGA- / CD46- / -HEK293 cells. PIGA null cells were generated by proaerolysin selection and lack GPI- anchored complement regulatory proteins CD55 (decay accelerating factor) and CD59 (protectin). CD46 null cells were generated by CRISPR / Cas9; single cell clones were created and knockout confirmed by a combination of genetic and phenotypic screening. Media: Cells are grown in sterile filtered Dulbecco’s Modified Eagle’s base medium (with L-glutamine, sodium pyruvate) and added fetal bovine serum (10%), 1x 1x penicillin / streptomycin. Maintenance: Cells are maintained at a density of 40,000-80,000 cells / cm2. Cells are passed the day prior to performing the bioluminescent mHam. Serum sample collecting and storage: Serums samples are collected in gold or red top tubes as per routine phlebotomy practices. Samples are processed within 3 hours of collection and either kept on melting ice and ran the same day or frozen at -80 ºC until they can be analyzed. A. Procedure Cell preparation: Media is removed and adherent cells washed once with phosphate buffered saline (PBS) without calcium or magnesium. Cells are treated with trypsin / EDTA (0.25% trypsin) for 3-5 minutes at room temperature. Trypsin is inactivated with the addition of culture media (~1 mL) and cells are resuspended with repeated pipetting to obtain a single cell suspension free of clumps (>95% single cells) when examined by light microscopy. Cells are diluted with PBS to a total volume of 10 μL and centrifuged at 1000 rpm for 10 minutes. Cells are resuspended in culture media and counted on a Denovix CellDrop cell counter with trypan blue to ensure adequate cell numbers and viability >93% prior to proceeding with the assay. Cells are maintained at 37 ºC until serum samples have been prepared. Once serum samples are thawed and heat inactivated controls prepared, the cells are centrifuged again at 1000 rpm for 10 minutes and resuspended in gelatin veronal buffer with calcium and magnesium (GVB++, CompTech) at a concentration of 2,000,000-3,000,000 cells / mL. Care is again taken to ensure no significant cell clumps remain in solution. Serum preparation: Serum previously frozen is rapidly thawed in a 37 ºC water bath for approximately 1 minute. Aliquots are frequently checked and once only a trace amount of ice remains, the samples are agitated with a vortex mixer to obtain the fully liquid sample. An aliquot (66 μL) of each sample is prepared and heated at 56 ºC for 30-45 minutes to obtain the heat inactivated control. The remainder of the sample and the heat-inactivated samples are kept on melting ice until analysis. If specific F inhibitors are used, they are added to the serum on ice and incubated for at least 30 minutes (time range 30-60 minutes). The serum samples (22 uL) per well are preplated in triplicate in a conical 96-well plate equilibrated on melting ice. Setting up the assay plate: To perform the assay, a white, opaque flat bottom 96-well plate is used. Depending upon the calculated cell concentration, an appropriate volume of diluent GVB++ is added to each well (typical range 60-70 μL) followed by an appropriate volume of cell suspension (typical range 10-20 μL) such that 40,000 cells are plated per well (500 cells / μL). Immediately prior to measurement a multichannel pipette is used to transfer the serum samples onto the cells. Samples are mixed with the repeated pipetting (x3) at time of transfer and plate is immediately transferred to the luminometer preequilibrated at 37 ºC for measurement. Luminescent measurement: A BMG clariostar luminometer is utilized. The sample is shaken in the luminometer for 60 seconds with the double orbital pattern at 300 rpm prior to initial reading. Spiral average, top-read luminescent measurements are taken of each well every 5 minutes for 2.5 hours and the results are graphed in Prism Graphpad. Positive assay determination: The relative luminescence of each sample at one hour is used to determine whether or not the sample is positive for significant complement activation. The relative luminescence of each sample is determined by comparison to its own heat inactivated control. A relative luminescence of <12.5% for the PIGA null line and <62% for the CD46 null line% at one hour is designated as positive based upon of the lower fifteenth percentile of the average luminescence of healthy control samples. Mixing studies to determine complement deficiency vs depletion: If an initial assay shows overlap of sample and heat inactivated curves, this typically represents one of three possibilities: (1) the patient is on complement inhibitor therapy (confirmed by chart review), (2) the patient has depletion of complement (low C3 and / or C4), or (3) the patient has a deficiency in complement that prevents activation. On the PIGA null cell line, a mixing study is subsequently performed. If mixing the serum in a 50:50 ratio with pooled normal human serum restores complement activity, the sample is depleted of complement. If the curves still overlap, the patient has a complement deficiency. As the most sensitive cell line for complement activity, the LiveLight (LL) PIGA- / CD46- / -HEK293 cells are used as a final confirmatory assay. On these cells, normal human serum typically results in 100% cell death. In a depleted state, complement activity is again typically observed, but in a deficiency state, there is again overlap of the sample and heat inactivated control. IV. Complement Inhibitors In particular embodiments, the present invention can be used to monitor therapy of disease where complement inhibitors are used. Generally, such inhibitors can include inhibitors of the classical, alternative, or lectin pathways. More specifically, the inhibitors include, but are not limited to, C5 inhibitors, C3 inhibitors and the like. A C5 inhibitor that can be used in the methods of the present invention include, but are not limited to, Eculizumab (Alexion); Ravulizumab (Alexion); Cemdisiran (Alnylam); LFG-316 (Novartis); SOBI005 (Sobi); SKY59 (RG6107 / RO7112689 (Chugai and Roche)); REGN3918 (Regeneron); TNX-558 (Tanox); Neutrazumab (G2 Therapies); Coversin (Nomacopan) (Akari Therapeutics); CCX168 (Avacopan) (ChemoCentryx); ABP959 (Amgen); GNR-45 (Generium); Zimura (Ophthotech); RA101495 (Ra Pharma); ISU305 (ISU ABXIS); and Mubodina (Adienne). In other embodiments, a C5a inhibitor can include IFX-1 (InflaRx) and Avacopan (CCX168 (Chemocentryx)). In further embodiments, a C5aR1 inhibitor can include ALS-205 (Alsonex); DF2593A (Dompe); and IPH5401 (Innate Pharma). In particular embodiments, a C3 inhibitor can be used with conjunction with a C5 inhibitor. Examples of C3 inhibitors include, but are not limited to, AMY-101 (Amyndas); APL- 1 (Apellis); APL-2 (Apellis); and APL-9 (Apellis). In other embodiments, Factor H can be used to treat activated APC in patients. The compositions and methods of the present invention can be used to assess therapeutic effect of a complement inhibitor. Examples of complement inhibitors generally include a protease inhibitor, a soluble complement regulator, a therapeutic antibody (monoclonal or polyclonal), complement component inhibitors, receptor agonists, or siRNAs. Protease inhibitors include, but are not limited to, plasma-derived C1-INH concentrates, for example CETOR® (Sanquin), BERINERT® (CSL Behring, Lev Pharma), and CINRYZE®; and recombinant human C1-inhibitors, for example RHUCIN® and RUCONEST® (Pharming). Soluble complement regulators include, but are not limited to, soluble complement receptor 1 (TP10) (Avant Immunotherapeutics); sCR1-sLeX / TP-20 (Avant Immunotherapeutics); MLN-2222 / CAB-2 (Millenium Pharmaceuticals); and Mirococept (Inflazyme Pharmaceuticals). Therapeutic antibodies include, but are not limited to, Eculizumab / Soliris (Alexion Pharmaceuticals); Pexelizumab (Alexion Pharmaceuticals); Ofatumumab (Genmab A / S); TNX- 234 (Tanox); TNX-558 (Tanox); TA106 (Taligen Therapeutics); Neutrazumab (G2 Therapies); Anti-properdin (Novelmed Therapeutics); and HuMax-CD38 (Genmab A / S). Complement component inhibitors include, but are not limited to, Compstatin / POT-4 (Potentia Pharmaceuticals); and ARC 1905 (Archemix). Receptor agonists include, but are not limited to, PMX-53 (Peptech Ltd.); JPE-137 (Jerini); JSM-7717 (Jerini). Others inhibitors include recombinant human MBL (rhMBL; Enzon Pharmaceuticals). In further embodiments, complement inhibitors include, but are not limited to, OMS721 (OMS 00620646) (Omeros); Ravulizumab (ALXN1210) (Alexion); Coversin (Nomacopan) (Akari Therapeutics); CCX168 (Avacopan) (ChemoCentryx); IFX1 (CaCP29 (InfaRx);AMY- 101 (Amyndas);APL-2 (Apellis); LNP023 (Novartis); Cemdisiran (ALN-CC5) (Alnylam); C1INH (Berinert) (CSL Behring); LFG-316 (Novartis). The compositions and methods of the present invention can utilize inhibitors of the classical pathway of complement including, but not limited to, C1q inhibitors (ANX005, ANX007 (Annexon)); C1s inhibitors (BIVV020 (Bioverativ)); C2 inhibitors (PRO-02 (Broteio / Argen-x)), as well as inhibitors of the lectin pathway including, but not limited to, MASP2 inhibitors (Narsoplimab (Omeros)). In certain embodiments, a Factor B inhibitor can be used including, but not limited to, LNP203 (Novartis (Basel, Switzerland); Schubert et al., 116(16) PROC. NATL. ACAD. SCI. USA 7926-31 (2019)), anti-FB SiRNA (Alnylam Pharmaceuticals, Cambridge, Mass.); TA106 (monoclonal antibody, Alexion Pharmaceuticals, New Haven, Conn.); SOMAmers (aptamers, SomaLogic, Boulder, Colo.); bikaciomab (Novelmed Therapeutics, Cleveland, Ohio); complin (see, Kadam et al., J. Immunol.2010, DOI: https: / / doi.org / 10.4049 / jimmunol.1000200); and Ionis-FB-LRx (ligand conjugated antisense drug, Ionis Pharmaceuticals, Carlsbad, Calif.) In some embodiments, the inhibitors of APC are Complement Factor D (CFD) inhibitors. Exemplary CFD inhibitors are described in e.g., U.S. Patent Nos. 9,598,446; 9,643,986; 9,663,543; 9,695,205; 9,732,103; 9,732,104; 9,758,537; 9,796,741; 9,828,396; 10,000,516; 10,011,612; 10,005,802; 10,081,645; 10,087,203; 10,092,584; 10,100,072; 10,106,563; 10,138,225; 10,189,869; 10,253,053; 10,287,301; 10,301,336; 10,370,394; 10,385,097; 10,428,095; 10,454,956; 10,550,140; 10,660,876; 10,662,175; 10,689,409; 10,807,952; 10,822,352; 10,906,887; 10,919,884, 11,084,800; International Publication No. WO 2020 / 041301, WO 2020 / 041301, and WO 2020 / 051532; and U.S. Patent Publication Nos.2019-0382376, 2020-0062790, and 2020-0262818, the contents of which are incorporated herein by reference in their entirety. In certain embodiments, a Factor D inhibitor can be used including ACH-4471 (Achillion), ACH-5528 (Achillion) and ACHI-5548 (Achillion). Other Factor D inhibitors from Achillion include those described in U.S. Patents No.10,464,956 (compounds claimed in claims 1-12); No.10,428,095 (compounds claimed in claims 1-2); No.10,428,094 (compounds claimed in claims 1-28); No.10,385,097 (compounds described in claims 1 and 20-27); No.10,370,394 (compounds described in claims 1 and 13-35); No.10,301,336 (compounds described in claims 1 and 3); No.10,287,301 (compounds claimed in claims 1-3); No.10,253,053; No.10,189,869 (compounds described in claims 1 and 12-36); No.10,138,225 (compounds described in claims 1 and 2-24); No.10,106,563 (compounds claimed in claims 1-20); No.10,100,072 (compounds claimed in claims 1-50); No.10,092,584 (compounds described in claims 1, 15-31 and 38-41); No.10,087,203 (compounds claimed in claims 1-21); No.10,081,645 (compounds claimed in claims 1-40); No.10,011,612 (compounds claimed in claims 1-3); No.10,005,802 (compounds claimed in claims 1-38); No.10,000,516 (compounds described in claims 1 and 13-20); No. 9,828,396 (compounds claimed in claims 1 and 12-40); No.9,796,741 (compounds claimed in claims 1 and 12-48); No.9,758,537 (compounds claimed in claims 1-39); No.9,732,104 (compounds claimed in claims 1-68); No.9,732,103 (compounds claimed in claims 1-29); No. 9,695,205 (compounds claimed in claims 1-56); No.9,663,543 (compounds claimed in claims 1- 49); No.9,643,986 (compounds claimed in claims 1-24); and No.9,598,446 (compounds claimed in claims 1-7). Another Factor D inhibitor includes Lampalizumab (Genentech). V. Kits The present invention also provides kits for performing the assays described herein. In particular embodiments, the kit comprises a plurality of cells that are (i) GPI-AP deficient and (ii) have an autobioluminescent phenotype. In other embodiments, the plurality of cells are CD46- / -. The cells can also be CR1- / -(e.g., HEK293 cells). In certain embodiments, the plurality of cells are PIGA- / -, CD46- / -and CR1- / -. In some embodiments, the plurality of cells are HEK293, HCT116, HeLa, MepG2, or MCF7 cells. In further embodiments, the plurality of cells comprise double PIGA / CD46 knockout HEK293 cells. The plurality of GPI-AP deficient cells can be biochemically treated to remove GPI-AP. Alternatively, the plurality of GPI-AP deficient cells is a phosphatidylinositol glycan class A (PIGA) null mutant cell line. In particular embodiments, the autobioluminescent cells stably express bacterial luciferase (lux) and flavin reductase (luxF). In certain embodiments, the plurality of cells are HEK293, HCT116, HeLa, MepG2, or MCF7 cells. In specific embodiments, the plurality of cells comprise double PIGA / CD46 knockout HEK293 cells. In another embodiment, the kit can also comprise growth media for the cells. The kit can further comprise a substrate or support for containing the cells. In other embodiments, the kit comprises a positive and negative control. The kit can also comprise the necessary buffers for preparing, washing, etc. of the samples and / or cells. Without further elaboration, it is believed that one skilled in the art, using the preceding description, can utilize the present invention to the fullest extent. The following examples are illustrative only, and not limiting of the remainder of the disclosure in any way whatsoever. EXAMPLES The following examples are put forth so as to provide those of ordinary skill in the art with a complete disclosure and description of how the compounds, compositions, articles, devices, and / or methods described and claimed herein are made and evaluated, and are intended to be purely illustrative and are not intended to limit the scope of what the inventors regard as their invention. Efforts have been made to ensure accuracy with respect to numbers (e.g., amounts, temperature, etc.) but some errors and deviations should be accounted for herein. Unless indicated otherwise, parts are parts by weight, temperature is in degrees Celsius or is at ambient temperature, and pressure is at or near atmospheric. There are numerous variations and combinations of reaction conditions, e.g., component concentrations, desired solvents, solvent mixtures, temperatures, pressures and other reaction ranges and conditions that can be used to optimize the product purity and yield obtained from the described process. Only reasonable and routine experimentation will be required to optimize such process conditions. EXAMPLE 1: The Bioluminescent Modified Ham Test Identifies the Classical Pathway As the Major Driver of Complement Activation in Atypical Hemolytic Uremic Syndrome and Primary Antiphospholipid Syndrome Introduction: The role of complement is increasingly recognized in disease pathogenesis, however diagnostic assays are limited by low predictive value, technical requirements, and inability to assess relative contributions of each pathway of complement (classical, alternative, or lectin). The traditional mHam was developed as a functional assay of complement-mediated eukaryotic cell death in atypical hemolytic uremic syndrome (a HUS). However, broader use of the assay has been limited by inter-operator dependence and technical requirements. The present inventors have developed a bioluminescent mHam that is robust and easily performed (no cell washes or exogenous reagent addition) and utilizes an autonomously bioluminescent HEK293 cell line to allow for real-time assessment of changes in metabolic health due to complement activation. Given both HEK293 and endothelial cells lack complement receptor 1 (CR1 ), a crucial regulator of the classical pathway (CP), this assay measures complement activity of greater relevance to disease pathogenesis. Methods: The bioluminescent mHam uses Livelight (LL) HEK293 cells (490 BioTech) engineered to stably express the bacterial luciferase (lux) and flavin reductase genes (luxF) to create autonomous bioluminescence. A PIGA null clone (LL P / GA- HEK293) was created through proaerolysin selection (removing GPl-anchored complement regulators CD55 and CD59). To perform the assay, 40,000 cells were harvested with trypsin / EDTA and plated as triplicates in gelatin veronal buffer (Gvs++, 80 ^L). Serum (20 ^L) was added after specified treatments (heat inactivation or inhibitor addition). Activity was monitored by serial luminescence measurements every 5 min at 37 °C. A relative luminescence of <25% at one hour is designated as positive based upon lowest replicate of any healthy control. Results: The bioluminescent mHam, unlike the original mHam, provides continuous measurement of complement activity (example tracing FIG.1). The complement specificity of the luminescent changes were demonstrated with heat inactivation, terminal complement blockade with eculizumab, and calcium / magnesium dependence. The relative contribution of CP to changes in luminescence was confirmed with the specific CP inhibitor sutimlimab as well as use of pathway specific buffers. Healthy control (HC) samples show a relative luminescence of 53.7% (95%CI 44.0-63.4) with no difference observed in acute thrombotic thrombocytopenic purpura (TTP) (mean 56.2%, 95%CI 41.2-71.2, p=>0.9999). The present inventors next utilized samples of aHUS patients known to be in remission, off complement inhibitor therapy. A large proportion of these patients have ongoing assay positivity even in the traditional mHam (9 of 13 in one unpublished cohort). The bioluminescent mHam shows that 5 of 6 aHUS patients in remission have ongoing positivity (mean 17.56%, 95%CI -10.5-45.6, p=0.0131 ). An acute a HUS sample showed similar results (17.8% after plasmapheresis). Unexpectedly, the relative luminescence is rescued by addition of either C1s or CS inhibitors, but use of alternative pathway (AP) inhibitors has no significant rescuing effect (FIGS.1-2). Of aHUS patients tested while on complement inhibition, 91 % (10 / 11) show greater than 88% blockade (FIG.2, aHUS on therapy). Finally, in one cohort, the traditional mHam was positive in 52% (14 / 27) of primary antiphospholipid syndrome (PAPS) cases and 15% (10 / 66) of secondary APS (SAPS) (unpublished data). Thus far, the bioluminescent mHam shows abnormal complement activity in 92% (12 / 13) of PAPS and 17% (2 / 12) of patients in SAPS (FIG.2). Again, complement inhibition with C1 s or CS inhibitors abrogated the effect in a dose dependent manner. Conclusions: The bioluminescent mHam test is an exquisitely sensitive real-time measure of abnormal complement activity. It is easy to perform, more closely approximates the complement regulators on renal endothelium, can be utilized for therapeutic monitoring, and has already offered novel disease insights through the use of specific pathway inhibitors. Although aHUS is traditionally categorized as a disorder of the AP, these results suggest the "trigger" mediating disease pathology is the classical pathway. Also, the present inventors show that a large proportion of primary APS patients have abnormal CP activation responsive to C1s and C5 inhibition, suggesting the disease may be responsive to complement-based therapeutics. EXAMPLE 2: Complement Biosensors Identify a Classical Pathway Stimulus in Complement- Mediated Hemolytic Uremic Syndrome Complement-mediated hemolytic uremic syndrome (CM-HUS) is a thrombotic microangiopathy characterized by variants in or acquired antibodies to complement proteins and regulators. Building upon our prior experience with the modified Ham (mHam) assay for ex vivo diagnosis of complementopathies, we have developed an array of cell-based complement “biosensors'' by selective removal of complement regulatory proteins (CD55 and CD59, CD46, or a combination thereof) in an autonomously bioluminescent HEK293 cell line. These biosensors can be used as a sensitive method for diagnosing CM-HUS and monitoring therapeutic complement blockade. Using specific complement pathway inhibitors, the assay identifies IgM-driven classical pathway stimulus during both acute disease and in many patients during clinical remission. This provides a potential explanation for ~50% of CM-HUS patients who lack an alternative pathway “driving” variant and suggests CM-HUS is characterized by a breakdown of IgM immunologic tolerance. It is understood that reference herein and throughout this disclosure to CM-HUS is also a reference to TMA in general. For example, the Figures and descriptions thereof can mean CM- HUS as well as TMA. Introduction Complement-mediated hemolytic uremic syndrome (CM-HUS) is a subset of thrombotic microangiopathy (TMA) driven by complement. As there is no diagnostic assay, CM-HUS remains a clinical diagnosis based on exclusion of other TMA syndromes. Establishing a prompt diagnosis of CM-HUS is critical as complement inhibition with C5 inhibitors is highly effective therapy1. Before the introduction of complement inhibitory therapy, mortality approached ~15% in the acute phase and 26-34% of patients developed end-stage kidney disease2,3. In the post- eculizumab era, still ~15% of those with an identifiable alternative pathway (AP) variant develop ESKD at 5 years4. Complement-mediated HUS is thought to be a disorder of the alternative pathway as 50- 60% of patients harbor an identifiable variant or acquired autoantibody to a protein central to this complement pathway (e.g., C3, FH, FI, MCP / CD46, CFB)5,6. Numerous mechanistic studies show these pathogenic variants play a direct role in either cell surface expression, gain of function / resistance to regulation, cofactor activity, or decay accelerator activity7–9. However, these variants are neither necessary nor sufficient; 40-50% of patients do not carry any variant or autoantibody, and disease penetrance in those with a known pathogenic variant is only 20- 50%10,11. Thus, there is an unmet need for assays and / or biomarkers not only for diagnosis, but also to mechanistically explain disease in patients without variants and the low penetrance in those with known familial pathogenic variants. Two principal techniques for in vitro diagnosis have been proposed, including the modified Ham assay (mHam)12,13 and HMEC-1 staining for C5b-914–17, but neither is widely adopted. Both assays rely upon testing patient serum for abnormal cell-deposited complement activity. In the case of the mHam, TF-1 erythroblasts deficient in glycosylphosphatidylinositol (GPI)-linked complement regulators (DAF / CD55 and CD59) are used in an absorbance-based cell viability assay to assess for increased complement activity leading to cell death12. In most versions of the HMEC-1 C5b-9 assay, wild type HMEC-1 endothelial cells are stimulated with ADP, incubated with patient serum, and then assessed by indirect immunofluorescence microscopy for increased C5b-9 deposition15. Our experience with the mHam assay suggested an additional stimulus beyond the AP was required for complement activation. First, complement-mediated cell killing was typically greater in calcium and magnesium-containing buffer permissive of all pathways (classical, lectin, and alternative) than in an AP-specific buffer (MgEGTA)12. Second, patients with known pathogenic variants in membrane bound (versus soluble) complement regulators (e.g., CD46) were still positive when testing their serum in either the mHam or HMEC-1 C5b-9 assays16,18,19. Finally, both of these assays as well as sC5b-9 remain positive or elevated in a sizable proportion of patients without an identifiable AP driving variant, even in hematologic remission14,16,20. The initiation of the AP is hydrolysis of the thioester of C3 which occurs at a slow, fixed rate according to first order kinetics 21,22. Although enhanced tickover through contact activation or heme-induced activation has been proposed as a contributing mechanism, this would not explain ongoing complement activation in a CM-HUS patient in hematologic remission21,23–25. Taken together, these data suggest an additional mechanism of complement activation contributes to disease pathogenesis. To address these observations, we used an autonomously bioluminescent HEK293 cell line which allows for real time measurement of cellular metabolic health resulting from complement activation and obviates the need for washes or reagent addition26. As compared to the TF1 cell line used in the mHam, HEK293 cells lack complement receptor 1 (CR1), which strongly regulates both classical pathway (CP) and AP activity27 on cells of hematopoietic origin and renal podocytes28Therefore, HEK293 cells more closely approximate complement activation of relevance to the endothelium in CM-HUS. By removal of different membrane- bound complement regulatory proteins, we established three autonomously bioluminescent HEK293 biosensors with different susceptibilities to complement activation: an isolated MCP / CD46 knockout (CD46KO), a PIGA knockout (PIGAKO) which results in deficiency of DAF / CD55 and CD59, and a double PIGA and CD46 knockout line (DKO) deficient in all three regulators. Residual membrane level complement protection in the DKO is provided only from Factor H (FH) or related proteins. Here, we use these biosensors to probe the pathogenesis of CM-HUS and show the presence of abnormal CP activity driven by IgM. Materials and Methods Inclusion criteria and sample collection. This study was performed leveraging existing CM-HUS samples. SST / gold top samples were previously processed and stored at -80°C as part of the Hopkins Complement Associated Disorders Registry with samples collected from 2014- 2023 (NA_00090162). Samples were processed and frozen within 3 hours of collection and stored in multiple aliquots to avoid repeated freeze / thaws. All patients underwent written / informed consent. All samples from the registry were included to be ran on the bioluminescent mHam if they 1) have a clinical diagnosis of CM-HUS or aHUS by an inpatient or outpatient consulting hematologist, 2) had not yet received plasma exchange or eculizumab therapy, 3) sufficient sample remained in the biorepository to run the sample. Given an abundance of samples for patients already on eculizumab or ravilizumab in the registry, these samples were selected at random for inclusion. TTP was diagnosed by an ADAMTS13 activity level less than 10%. STEC-HUS was excluded in patients who presented with diarrhea. Samples were defined as acute if they were collected within 14 days of initial manifestations, 2) had not yet received either plasmapheresis / plasma exchange, C5 inhibitory therapy or caplacizumab, and 3) had not yet achieved hematologic remission (defined as Hgb >11 g / dL or recovery to baseline, LDH within normal limits and platelet count >150x103 / ^L). Samples from patients with renal- limited TMA (i.e., without systemic or hematologic manifestations) were excluded. Healthy controls were non-hospitalized, non-pregnant, healthy volunteers aged 18-65. Description of Key Reagents. Livelight HEK293 cell line was from 490 BioTech (Knoxville, TN). Proaerolysin was obtained from Peter Howard (University of Ottawa, Saskatoon, Canada). Sutimlimab and eculizumab were obtained from hospital pharmaceutical waste. Factor D inhibitors ACH-5548 and ACH-4471 were obtained from Alexion Pharmaceuticals (Boston, MA). Factor B inhibitor iptacopan was from MedChemExpress (Monmouth Junction, NJ). All inhibitors were tested for activity in the Wieslab AP or CP activity kits from Eagle Biosciences / Svar (Amherst, NH). Iptacopan, ACH-4471, ACH-5548 were dissolved in DMSO (10 mM for iptacopan and ACH-4471 or 20 mM for ACH-5548) for storage. Any subsequent dilutions for all inhibitors were in PBS. Long-term storage was at –80 °C and short-term storage of working aliquots was at –20 °C. Unsensitized sheep erythrocytes, GVB++, GVB0, VBS, MgEGTA were from Complement Technologies (Tyler, TX). Pooled NHS were from both Complement Technologies (Tyler, TX) and QuidelOrtho (Athens, OH). Antibodies included: monoclonal mouse anti-human C4d (QuidelOrtho, cat #A213), rabbit polyclonal FITC-conjugated C3c (abcam, cat# ab4212), AF647- conjugated goat anti-Human IgG (H+L) (Thermo fisher, cat# A21445), AF488-conjugated goat anti-Human IgM (Heavy chain) (Thermo fisher, cat#A21215), PE-conjugated mouse anti-human CD46 (molecular probes, cat#A-15776, clone MEM-258), and BV421-conjugated mouse anti-human CD55 (BD optibuild, clone IA10), and BV510-conjugated mouse anti-human CD59 (BD optibuild, clone H19). Secondary for C4d was AF488-conjugated goat anti-Mouse IgG (H+L) (cat# A32723). Polyclonal IgG (cat#AG711), myeloma IgG1 (cat# 400120), and myeloma IgM (cat#401108) were from EMD Millipore, and native polyclonal IgM was from BioRad (cat# 5275-5504). IdeS proteases was from Promega (cat#V7511). Anti-sheep red blood cell stroma antibody produced in rabbit was from Sigma-Aldrich (cat#S1389). Purified cas9 protein and sgRNA sequences were from Synthego (Redwood City, CA). CD46 sgRNA sequences were CD46 target#1: CAATTGTGTCGCTGCCATCGAGG (SEQ ID NO:1) and CD46 target#: CGATTTCCAGTAGTCGAAAATGGG (SEQ ID NO:2). Check primers were left- ATCTTGCATTCCATTCCTTGTC (SEQ ID NO:3) and right- TTAAGACACTTTGGAACTGGG (SEQ ID NO:4). All designed with CHOPCHOP76. AP Buffer. Alternative pathway buffer (GVB-MgEGTA) was prepared fresh for each assay by diluting 650 uL MgEGTA (0.1 M MgCl2, 0.1 M EGTA, pH 7.3) to 5 mL with GVB0 (both from Complement Technologies). Final concentration 13 mM Mg and EGTA. pH was adjusted to 7.30-7.45 with dropwise addition of HCl (6 M). Cell culture and propagation. Each cell line was cultured and maintained in DMEM with 9% FBS, 90 ^g / mL penicillin / streptomycin, 1x glutaMAX). Cells were maintained in log phase growth by passage every 2-3 days. Cell lines were replaced with an early passage line approximately every 3 months. Cells were either passed the day prior to the assay (preferred) or rarely cells were utilized for the assay after passage two days prior running the assay if cell density was still <80% with good cell morphology and viability after washing was >92% (as a minimum requirement for utilizing the cells in the bioluminescent mHam). Wash buffer was Hank’s Balanced Salt Solution without calcium or magnesium unless otherwise indicated. Cell lines were tested periodically to be mycoplasma free using PCR based Venor GEM Mycoplasma detection kit (Sigma-Aldrich, MO). Viability was assessed by trypan blue staining using a Denovix celldrop cytometer. Cell line Engineering. A PIGAKO HEK293 clone was selected by treatment of ~10 million Livelight HEK293 cells with 0.5 nM proaerolysin in DMEM (9% FBS, 1x penicillin / streptomycin, 1x glutaMAX). Media was exchanged following the first 24 hours of treatment to remove nonadherent cytolytic cell fragments and cells were allowed to propagate for an additional 2-3 weeks with ongoing proaerolysin selection. Following 2-3 weeks of treatment individual adherent colonies were carefully removed and propagated separately. CD55 and CD59 negativity were confirmed by flow cytometry and a final treatment with 1 nM proaerolysin. A CD46 knockout line (CD46KO, LL HEK293 PIGAwt / CD46- / -), or double knockout (DKO, LL PIGA- / CD46- / -) were created by nucleofection of preformed RNP with two separate sgRNA sequences on the WT cell line or PIGAKO cell line. Briefly for each cell line, Cas9-RNP complex was preformed by mixing 3 ^L sgRNA target#1 (100 pmol / ^L in TRIS- EDTA), 3 ^L sgRNA target#2 (100 pmol / ^L in TRIS-EDTA), and 5 ^L spCas9 (20 ^M from synthego) in Lonza nucleofection solution plus supplement (6 ^L) and incubated on ice for 10-15 minutes. Cells (800k per condition) were harvested with trypsin / EDTA, neutralized with DMEM with 9% FBS, washed in HBSS with careful removal of excess buffer, and then resuspended in prewarmed nucleofection buffer plus supplement (100 ^L). Cells were added to preformed RNP complex, transferred to a 100 ^L nucleovette, and nucleofection performed on a Lonza 4D (program CM-130). Immediately following nucleofection cells were transferred to a pre-warmed media in a 25 cc tissue culture flask. Following approximately one week of propagation, the mixed polyclonal population was single cell sorted by selection on the CD46 negative population (CD46-PE Ab at 1:25 dilution) at the JHH Bloomberg School of Public Health cell sorting facility. Following propagation, CD46 negativity was confirmed by flow cytometry and PCR with check primers to demonstrate expected fragment length differences. Bioluminescent mHam. Cells were harvested after rinsing with PBS and brief treatment with trypsin 0.25% / EDTA 2.21 mM (~3 min treatment at room temp until detached). Trypsin was neutralized with FBS containing media and cells diluted in HBSS (10 mL). Cells were pelleted by centrifugation (1000 rpm for 7 min) and resuspended in culture media and kept at 37 °C until ready for use in the assay (typically used within 1-3 hours). Following cell harvest, serum samples were prepared by rapid thaw at 37 °C until only a trace quantity of ice remained and then allowed to finish thawing on ice. Aliquots of 66 uL (for untreated or inhibitor treated samples) or 70 uL (for heat inactivation) were created. Heat inactivated samples were treated in a 56 °C water bath for 30 min and then placed on ice. Inhibitors were diluted in PBS to 100x final assay concentration and added to serum aliquots at 5x final reaction concentration, e.g., 3.47 ^L of 100 ^M ACH-4471 was added to 66 ^L of serum, and a 20 ^L aliquot of the inhibitor treated sample is added to 40,000 cells in GVB++ (80 ^L) as the final step in assay preparation. Final inhibitor concentrations (unless otherwise indicated in figure legends) were eculizumab (50 ^g / mL), sutimlimab (30 ^g / mL), ACH-4471 (1 ^M), ACH-5548 (1 ^M), iptacopan (1.5 ^M), compstatin (18 ^M), DTT (0.6 mM). Pretreatment of serum with DTT (3 mM) occurred at room temperature for 30 minutes and then sample was again placed on ice to slow ongoing reduction. Following serum preparation, the previously harvested cells were washed with HBSS, pelleted by centrifugation, and resuspended in prewarmed GVB++ at a concentration of 2000-3000 cells / ^L with final recount on a DeNovix celldrop cytometer. Final assay plate (96-well, white opaque flat-bottom) is prepared in triplicate for each condition by addition to each well by multichannel pipette of 1) 40,000 cells, 2) appropriate amount of prewarmed GVB++ to bring volume up to 80 ^L, and finally 3) addition of serum (20 ^L) that has been allowed to sit at room temperature for 10-15 minutes. Polyclonal IgG, polyclonal IgM, or myeloma IgG1 or myeloma IgM were used as supplied or reconstitution as per manufacturer's instructions. When immunoglobulin was added to the assay, it was added to healthy control sera known to have “low activity” on that cell line. The volume of GVB++ was reduced as appropriate (typical quantities ranged 5-60 ^g with final concentrations shown in the figure legend). After assembling the microtiter plate, luminescence was monitored by serial luminescence measurements (every 5 min at 37 °C) on a BMG ClarioStar luminometer. The 1 h relative luminescence was used as a standardized timepoint to compare complement activity. Relative luminescence was calculated as the ratio of the average of serum or inhibitor treated-serum to that of heat-inactivated control. “Positive” assay is defined as the lower 85th percentile on both lines: 12% for the PIGAKO and 62% for the CD46KO line. Descriptive and comparative statistics were performed in GraphPad Prism. P values were calculated using one-way ANOVA for Dunnett’s multiple-comparisons test. IdeS treatment of serum or IgG fractions. IdeS was obtained from Promega and reconstituted per manufacturer's instructions. Healthy control sera was used to optimize IdeS cleavage at either 3.6 or 7.1 U / ^L at 37 °C. At predefined timepoints (0, 15, 30, 45, 60, 120, 180 min), 0.5 uL of this solution was diluted with 24.5 uL of ice-cold PBS. Samples were kept on ice until immediately prior to running SDS-PAGE gel at which point the sample (10.4 ^L) was treated 4x non-reducing loading buffer (3.5 ^L) and heated to 70 °C for 10 min prior to loading of entire sample on NuPage 4-12% Bis-Tris precast gradient gel and ran in NuPage MOPS running buffer followed by Coomassie staining. Following optimization, typical IdeS cleavage conditions were 7.1 U / ^L (10 ^L of 50 U / ^L IdeS added to 60 ^L serum) for 30 min at 37 °C, or if cleaving IgG alone typical conditions were 3.6 U / ^L (final concentration IdeS) for 60-90 min at 37 °C. An untreated sample of serum was similarly kept at 37 °C without the addition of protease as a temperature control, but in no case did incubation of serum for 30 min at 37 °C result activity decrement on the bioluminescent mHam. Pre-sensitization of cells with bioluminescent mHam. A pool of 2-3 healthy controls with low activity on the DKO cell line was created to act as a source of complement for the assay and designated as “HC mix” and all patient samples were heat-inactivated prior to incubation with the PIGAKO or DKO cell lines to prevent complement deposition during the presensitization step. PIGAKO or DKO cells were harvested, washed, and resuspended in DMEM without FCS (360,000 cells in 80 ^L DMEM). Heat-inactivated sera (30 min at 56 °C) from acute CM-HUS (n=2), CM-HUS in remission (n=7), or HC (n=3) was added and incubated for 45 min at 37 °C in a CO2 controlled environment. Cells are diluted to 250 uL in HBSS, centrifuged (7 min at 1000 rpm). Cells are then washed 1x with HBSS (250 uL) and resuspended in GVB++ (160 uL). After a final cell count, cells are run in the bioluminescent mHam as previously described with low activity “HC mix” serum. Curve tracings are compared to that of HC mix and included for reference on each figure tracing. Protein G spin column IgG purification. Spin columns and centrifugal protein concentrators were used for rapid purification of immunoglobulin with the aim of preserving complement activity in both the eluate and flow through fractions. Protein G spin columns (0.2 mL size), Zebaspin desalting columns (0.5 mL, 7k MWCO), wash buffers, binding buffer, and elution buffers were obtained from Thermo scientific (Rockford, Il). Vivaspin 5005KDa MWCO centrifugal protein concentrators were from Cytiva (Uppsala, Sweden); all used per manufacturer’s instructions. CM12, CM04 or HC sera (20 ^L for each expected well with no more than 60 ^L per column, 120-240 ^L total) was diluted to 500 ^L in binding buffer and loaded onto a protein G spin column to purify IgG (protein G eluate, GE) or isolate flow-through (protein G flow-through, GF). GE and GF underwent centrifugal concentration (as required) with Cytiva centrifugal protein concentrators, and finally desalting / buffer exchanged into PBS with a Zebaspin desalting column. Protein concentration was approximated on a nanodrop spectrophotometer. Quality of preparation was evaluated by SDS-PAGE; given known residual IgG in the flow through, these fractions were also treated with IdeS (3.6 U / ^L for 2 h at 37 °C). For CM04, GF samples were also pretreated with 3 mM DTT for 30 min at room temperature. GE or GF samples were added to HC sera by equal distribution of volume (as opposed to protein amount), such that 20 uL of input volume was added per well. Samples were kept at 4 °C and used immediately after preparation on the same day. Sheep erythrocyte sensitization and CH50. A custom, in house CH50 assay was designed based upon the methods of Mayer52 and Morgan77to allow for sensitization with fractionated antiserum to sheep RBC stroma containing principally IgG as opposed to IgM sensitizing reagents. The fractionated antiserum was resuspended as per manufacturer’s instructions. Briefly, unsensitized sheep erythrocytes (E) were obtained from CompTech. They were washed twice with VBS immediately prior to use in the assay with all centrifugations occurring at 1000g for 5 min. The E concentration was adjusted so that final OD490 ranged 0.5-0.7 with water lysis of 50 ^L of E with 200 ^L water. Appropriate hemolysin concentration to obtain near 100% lysis was obtained by titration of hemolysin reagent: 50 ^L E were incubated with 25 ^L of serial diluted hemolysis (1:10, 1:20, 1:30, 1:40, 1:50, and 1:100) and 25 ^L of a 1:25 dilution of serum (1:50 final) in VBS at 37 °C with intermittent agitation for 30 min. Following incubation, wells were diluted with 150 ^L ice cold VBS and absorbance read at OD490; concentration of hemolysin selected for use was the next more concentrated dilution after the dilution at which a 100% lysis plateau was achieved (typically 1:30-1:40). To perform the assay, E were sensitized with hemolysin at the concentration determined above in VBS for 30 min at 37 °C with intermittent agitation. Sensitized erythrocytes were washed twice with VBS and resuspended in the original volume of VBS and used immediately in the assay. HC sera was incubated with or without 3 mM or 0.6 mM DTT for 30 minutes and then subsequently diluted 1:50 in VBS. In the wells of a 96 well microtiter plate, a further series of dilutions in VBS of each 1:50 diluted serum sample was made: 1:10; 1:5; 1:4; 1:3: 2:5; 1:2; 5:2; 3:1; 4:1; 5:1; 10:1; 10:0; 50 uL / well. EA (50 ^L) were added to each well. Control wells for each assay in duplicate included 100% lysis and cell blank in VBS. In addition to pretreated serum, DTT was also added in replace of VBS to achieve a final assay concentration of either 0.6 or 3 mM DTT. The plate was incubated at 37 °C for 30 min with intermittent agitation, control well lysed with addition of water to final volume of 250 uL. Ice-cold VBS to a final volume of 250 ^L was added to the remainder of the wells; the plate was centrifuged and 200 ^L supernatant placed in a new 96 well microtiter plate for final OD read at 515 nM. Percent hemolysis for each well was calculated based upon blank corrected data. A linear graph of the log of diluted serum volume in uL (x) vs log of [(y / (1-y)] was created and solved for log(x) when y=0, converted from logarithmic base to find K (CH50 unit), corrected for original 1:50 dilution (multiply by 50), and then converted to CH50 units per mL. The experiment was repeated on two separate days to ensure consistency and averaged. These CH50 units are distinct from those typically reported in standardized assays. Flow Cytometry. C3c and C4d: All cells were harvested and washed as described for the bioluminescent mHam. 300-360k WT, PIGAKO, CD46KO in GVB++ (80 ^L) were treated with eculizumab-spiked, healthy control or CM-HUS serum (20 ^L, final eculizumab 100 ^g / mL in 100 ^L total volume) for 30 min at 37 °C. Additional conditions included heat inactivation (56 °C water bath for 30 min), sutimlimab (30 ^g / mL), and ACH-5548 (1 ^M, FDi). Cells were washed with FACS staining buffer (HBSS w / o calcium or magnesium, with 1% BSA), pelleted, split 50:50, and resuspended in ice-chilled FACS staining buffer (50 ^L) and stained for either C3c (1:100-1:200 dilution) or C4d (1:200 dilution) on ice for 30 min in the dark. Cells were washed twice with FACS staining buffer (250-300 ^L each wash) and either kept on ice (for C3c) or stained with secondary antibody (for C4d) on ice for 30 min (1:1000 dilution) in 50 ^L. Secondary stained samples were washed two additional times, resuspended in ~280 ^L FACS buffer and kept on ice until analysis. Samples were run on a Beckman Coulter Cytoflex S flow cytometer. After gating on single cells, a minimum of 10,000 events were collected for each sample. All cytometry data analysis was performed in Flow Jo (V10). Cells were evaluated for percent positivity by setting a gate at the histogram upper limit of the stained, heat-inactivated healthy control sample with the least histogram shift for each marker compared to the FMO control. Median fluorescence intensity (MFI) was calculated for each sample by subtracting raw MFI for each sample from the MFI for that marker on its own heat inactivated control. MFI could not be evaluated in some C4d stained samples due to inconsistent amounts of secondary antibody. Percent positivity was preferred for C4d given its role as a complement initiator and MFI for C3c given its role in amplification. The same healthy control (n=4) and CM-HUS (n=4 for WT, n=5 for PIGAKO and CD46KO) samples were used across all cell types. IgG and IgM: Flow cytometry for IgG and IgM deposition was similar to that of C3c and C4d with some notable differences. Briefly, 200k wild type cells were treated with heat- inactivated serum for 45 min at 37 °C. The only additional condition included DTT treatment of heat-inactivated serum (3 mM DTT pretreatment for 30 min at RT, 0.6 mM final concentration) of two CM-HUS samples. Cells were not split, but rather dual stained with AF647- conjugated goat anti-Human IgG or AF488-conjugated goat anti-Human IgM (Heavy chain) at a dilution of 1:100 for 30 min on ice. of IgG (HC n=9, CM-HUS n=17) or IgM (HC n=7, CM-HUS n=15). Relative median fluorescence intensity was calculated as ratio of sample MFI compared to average of 4 healthy controls ran with each experiment. P values were calculated using unpaired, two-tailed t test with Welch’s correction. Results Cohort characteristics. We utilized 41 biobanked sera specimens from the Johns Hopkins Complement Associated Disease Registry with a diagnosis of CM-HUS or TTP (Table 1). TTP was diagnosed by ADAMTS13 activity <10% and the diagnosis of CM-HUS was determined by a consulting hematologist. Samples were defined as acute if they were collected within 14 days of initial manifestations, 2) had not yet received either plasmapheresis / plasma exchange or infusion, C5 inhibitory therapy or caplacizumab, and 3) had not yet achieved hematologic remission (defined as Hgb >11 g / dL or recovery to baseline, LDH within normal limits and platelet count >150x103 / ^L). Patients with renal-limited TMA were excluded. Three of 6 (50%) acute CM-HUS samples and 7 of 15 (47%) remission samples had a known pathogenic variant or variant of uncertain significance (VUS) in a complement regulatory protein or factor H autoantibody (FHAA). Fourteen CM-HUS samples were included from patients on C5 inhibitors (either eculizumab or ravulizumab). Moreover, we included sera from 19 non-pregnant, healthy adults and 6 acute TTP patients. Biosensors detect range of normal complement activity among healthy controls. We exploited the use of an autonomously bioluminescent LiveLight HEK293 cell line (490 BioTech) to allow for real time measurement of metabolic health26. As for the traditional mHam, a PIGA knockout cell line (PIGAKO) devoid of all GPI-anchored proteins, including complement regulators CD55 and CD59, was established by proaerolysin selection13 To generate a range of biosensors with different susceptibilities to complement, CRISPR / Cas9 was used to establish an isolated MCP / CD46 knockout cell line (CD46KO) as well as a double knockout cell line (DKO) devoid of all three membrane bound complement regulators, CD55, CD59, and CD46. To perform the bioluminescent modified Ham assay, these biosensors are incubated with sera for 2.5 hours and a real time tracing of autonomous bioluminescence is compared to heat- inactivated sera (FIG.24A-24E). Heating serum is a well-established method for inactivating complement29, and the cell luminescent signal has been shown to correlate with metabolic health and overall cell viability26,30. Thus, by comparing the luminescent signal of untreated and heat-inactivated sera from the same patient, the effects of complement-mediated cell cytotoxicity can be measured. Given the maximal effect is typically observed at ~1 h, this time point was selected to report a “percent relative luminescence” where 100% relative luminescence represents no significant metabolic effect of complement and zero percent indicates total loss of the cell population. As shown in FIG.24B-24F using healthy control sera, the relative luminescence at 1 h decreased as complement regulators were removed: wild type (WT) cells 90.3 (95% CI, 86.9-93.8), CD46KO cells 78.8 (95% CI, 67.9-89.7), PIGAKO cells 47.2 (95% CI 34.4-59.9), and DKO 20.9 (95% CI 7.9-33.9) (FIG.24F). One healthy control was excluded as an outlier given significant killing on wild type cells with further studies ongoing but possibly due to a specific antibody to the HEK293 cells (FIG.24F). A relative 1 h luminescence of ^12% bioluminescence for the PIGAKO and ^62% for the CD46KO line was used to establish a “positive” threshold for abnormal complement activity, corresponding to the lower 85th percentile on both cell lines. Bioluminescent mHam on PIGAKO and CD46KO biosensors differentiates acute CM- HUS from TTP and healthy control sera. Having established a normal range of activity for healthy control serum, we activity observed in thrombotic microangiopathy samples, including CM-HUS (acute or remission) and acute TTP. Both acute and remission CM-HUS samples are significantly different than healthy controls or acute TTP, and all acute CM-HUS have significant activity on both the PIGAKO and CD46KO biosensors (FIG.25A-25B, 25D-25E). In remission, 54% (7 / 13) of samples remain positive on the CD46KO and 57% (8 / 14) on the PIGAKO (FIG.25B, 25E). Among patients with a complement variant or FHAA, 67% (4 / 6) were positive on CD46KO as compared to 43% (3 / 7) without. Use of classical pathway C1s inhibitor sutimlimab but not AP inhibitors mitigates cell- directed complement activation in CM-HUS. To investigate the contribution of each complement pathway, we utilized a selection of complement inhibitors: AP inhibitors- factor D inhibitors (FDi) ACH-4471 and ACH-5548, factor B inhibitor (FBi) iptacopan, C3 inhibitor compstatin; CP inhibitor- C1s inhibitor sutimlimab; terminal pathway- C5 inhibitor eculizumab. Activity for these inhibitors was confirmed in the AP or CP Wieslab assays (FIG.30). As expected, the terminal pathway inhibitor eculizumab rescued the bioluminescent signal to a mean of 80% on CD46KO and 87% on PIGAKO (FIG.25C, 25F), but unexpectedly, AP inhibitors offered only minimal protection from complement-mediated cell death. With FDi, there was mean recovery of 8.8% on CD46KO and 6.8% on PIGAKO (FIG.25A-25G, 25I). This was confirmed with a FBi on a limited number of samples (FIG.25B-25C, 25J). In contrast, the CP inhibitor sutimlimab offered significant protection and was comparable to eculizumab with a mean recovery of 73% on CD46KO and 78% on PIGAKO (FIG.25C, 25F). The sutimlimab findings were confirmed by running the assay in MgEGTA, a buffer permissive of only the alternative pathway (FIG.25G-25H). These effects were consistently observed in both acute and remission samples, regardless of the presence of an AP variant or not (compare FIG.25A-25B, 25E, 25I, 25K). Furthermore, pathologic complement activation in sera from patients with variants in membrane bound regulators (e.g., CD46) was blocked by sutimlimab but not AP inhibitors in both acute and remission samples (FIG.25A, 25D, 25G). “Triple” AP blockade targeting FB, FD, and C3 did not offer significant protection (FIG.25B-25C, 25K). Finally, the sera of a patient with C3 glomerulopathy (Table 3) with undetectable C3 (<15 mg / dL) showed reduced bioluminescence comparable to CM-HUS (FIG.25L). Given that complement activity persists with either C3 depletion or triple AP blockade, the “C3 bypass mechanism” may lead to membrane attack complex (MAC) deposition. This supports observations of others that in the presence of strong CP stimulus on membrane surfaces, there is a more limited role for AP amplification31,32. These findings suggest that regardless of AP dysregulation, there is a CP stimulus in CM-HUS. Classical pathway stimulus drives C4d deposition in CM-HUS even on wild type cells, and MCP / CD46 as opposed to CD55 is a more significant regulator of that stimulus. Of the membrane associated complement regulators, only variants in MCP (CD46) and Factor H are associated with CM-HUS9,33. In addition to AP regulation, these proteins are C4b binding proteins and regulate CP activity with variable efficiency depending upon the model system and degree of sensitization34–38. Aside from CR1, they are the only membrane associated regulators with cofactor activity to control CP-stimulated C4b deposition at the cell surface 28,36. DAF (CD55) regulates deposition of both CP and AP convertases but possesses only decay accelerator activity9,39. To mechanistically study the role of CD46 and CD55 in CM-HUS, we performed flow cytometry to assess C3c and C4d deposition in CM-HUS compared to healthy control sera (FIG. 26). Eculizumab was utilized across all samples to preserve cell viability. Given CD59 functions only at the level of MAC insertion (i.e., downstream of C3c and C4d deposition), differential deposition on WT, PIGAKO, and CD46KO will be driven by either the lack of DAF / CD55 (for PIGAKO line) or MCP / CD46 (for CD46KO line). As shown in FIG.26A-26C, there is increased C3c and C4d in CM-HUS compared to healthy controls across all three cell lines. Deficiency of CD46 but not PIGA increases C4d deposition as compared to wild type cells (FIG.26A). The significant change in bioluminescence on the CD46KO line in samples from CM-HUS, as compared to the relative absence of change in healthy control samples, supports differential regulation of the CP in CM-HUS and identifies specificity of the CD46KO line for this disease. The critical role for CP vs AP control was further confirmed by examining the ability of sutimlimab or FDi (ACH-5548) to control either C3 or C4 deposition. Across all cell lines, both C3 and C4 are more consistently blocked by sutimlimab than FDi, suggesting a critical role for the CP (FIG.26D-26L). Furthermore, the changes in complement deposition pattern (increased C4d and C3c) are consistent between wild type cells and the knockout cell lines lacking complement regulators. In summary, these results suggest CD46 is more important than CD55 in regulation of the CP in CM-HUS, and this assay identifies a physiologic stimulus inherent to the disease as opposed to creating an artifactual finding. PIGAKO and DKO biosensors can be used to identify patients who may benefit from increased dosing of C5 inhibitors or C1-INH. There are no standardized assays to evaluate are protected once complement inhibition is initiated40–43. The ability of the PIGAKO and DKO lines to identify a range of “normal” complement activity means these biosensors are potentially useful in monitoring therapeutic complement blockade. As shown in FIG.27A-27B, when on therapeutic complement inhibition, patient serum yields similar cell killing to that of heat inactivated samples on either the PIGAKO or DKO lines. Evaluating 14 samples from patients on eculizumab or ravulizumab showed an average 1 h relative luminescence of 91.7% (95th% CI 82.9-100.4) with only one patient with relative luminescence less than 88% (CM21 at 40.3%) (FIG.27C). Addition of either sutimlimab or eculizumab (but not FDi) to CM21 sera shows that additional cell protection could be offered by increasing complement inhibition (FIG.27D). We also confirmed a dose dependent response for classical pathway inhibitors for sutimlimab, eculizumab, and C1-inhibitor (FIG.27E-27G). Finally, we show that patient sera can be diluted with NHS to give a “titer” required to overcome the complement inhibition and show an activating stimulus even when on complement inhibitor therapy (FIG.27H). IgM is the immunoglobulin fraction contributing to CM-HUS complement activation. Having shown a predominant role for CP, we hypothesized this stimulation would be mediated by immunoglobulin. We relied upon cleavage of IgG with IdeS (FIG.31) or selective reduction of IgM with 3 mM dithiothreitol (DTT) to investigate the contributions of IgG or IgM, respectively. IdeS is an IgG specific endopeptidase which cleaves human IgG into F(abƍ)2 and Fc fragments; although F(ab’)2 is still available to bind to antigen, the loss of the complement- fixing Fc domain will prohibit any IgG-mediated complement activity44. Treatment of serum with DTT is a commonly used method to differentiate IgM mediated complement activation45– 47. We confirmed selective reduction of IgM on a non-reducing, non-heated SDS-PAGE gel with minimal effect on IgG (FIG.28A) and showed dose-dependent effects on complement inhibition in normal healthy control sera (FIG.32). Given DTT is known to have nonspecific effects on complement activation48, we also performed fractionated antisera (principally IgG) sensitization of sheep erythrocytes followed by quantification of CH50 with or without the presence of DTT. Under these conditions, there was an average CH50 reduction of ~35% at either pretreatment (3 mM DTT) or final concentrations of DTT (0.6 mM DTT) utilized in the bioluminescent mHam (Table 2). Additionally, demonstrating the strength of the assay in understanding complement activation pathways relevant to an individual’s disease presentation, we identified a patient with acute fatty liver of pregnancy and HELLP (Table 3) where activation is blocked with heat or eculizumab but not sutimlimab or DTT (FIG.28B). Taken together these results demonstrate that DTT inhibitory effect in the assay is driven principally by reduction of IgM as opposed to nonspecific effects on serum or complement. Isolation of CM-HUS IgG with protein G spin columns followed by addition to healthy control serum consistently showed increased activity in the flow-through as opposed to the IgG eluate fraction (FIG.28C). Treatment of flow-through with DTT or sutimlimab partially blocks these effects whereas IdeS treatment does not (FIG.28D). Moreover, pretreatment of CM-HUS sera with DTT but not IdeS results in almost complete blockade of observed activity (FIG.28E- 28F) with a mean 1 h relative luminescence of 85.4% (mean 95% CI 74.5-96.3%) vs 8.3% (mean 95% CI -6.7%-23.3%) for DTT and IdeS respectively. We next investigated the ability of commercial preparations of polyclonal IgG, polyclonal IgM, monoclonal IgG, and monoclonal IgM to activate complement when spiked into healthy control sera across all three cell lines. For the DKO line, a pool of healthy control sera was carefully selected for low basal activity. As seen in FIG.28G, polyclonal IgM cannot stimulate activation on the CD46KO line. There is a trend towards activating on the PIGAKO line (FIG.28H), but the effect is clearest on the DKO line (FIG.28I), where there is a dose dependent response with IgM but not monoclonal IgG / IgM or polyclonal IgG. This activation is again blocked by both eculizumab and sutimlimab (FIG.33). Innate, polyreactive IgM is known to have affinity for phospholipid membrane surfaces. The ability of polyclonal IgM and healthy control sera to activate complement on a physiologic membrane surface provides evidence that this is the culprit immunoglobulin species. However, there is a clear difference in relative affinity of the polyreactive IgM for the cell surface even among healthy controls as evidenced by a range of activity on the PIGAKO line from 0% to 100% and that some healthy controls show only minimal complement activity even on the DKO cell line–but can be stimulated with the addition of polyclonal IgM preparations. Furthermore, unlike the activity observed in CM-HUS, neither healthy controls nor polyclonal IgM preparations have significant activity on the CD46KO line suggesting a difference in total complement fixing avidity. As a preliminary evaluation of this concept, we examined the degree of IgG and IgM binding in a selection of CM-HUS and healthy control samples. There was a trend towards increased IgG and IgM staining in CM-HUS compared to healthy controls (FIG. 29A). Using a relative MFI of >95th percentile of healthy controls (>2.05 for IgG and >1.36 for IgM) as a positive threshold, there was no difference in IgG staining (0 of 9 for HC vs 3 of 17 for CM-HUS, p = >0.53, Fisher’s exact test), but significantly more positive samples for IgM in CM-HUS compared to HC (0 of 7 for HC vs 8 of 15 for CM-HUS, p = 0.0225, Fisher’s exact test). Furthermore, in the CM-HUS samples increased IgM staining is more frequently seen in acute (4 of 6) as opposed to remission samples (4 of 9). Finally, IgM but not IgG staining can be reduced by treatment with DTT (FIG.29B-29C). Pre-sensitization of PIGA or DKO cells with CM-HUS sera and then assessing ability to cause activation in healthy control sera demonstrates cell-bound IgM alone is sufficient to stimulate complement activation. As a final method to explore the differential complement- fixing avidity of CM-HUS sera, we pre-sensitized either DKO or PIGAKO cells with the heat- inactivated CM-HUS or healthy control sera. The cells were washed and then incubated with healthy control sera (a pool selected for low basal activity). As shown in figure 6 (and FIG.34), pre-sensitization with acute CM-HUS serum (n=2) significantly increased complement activity of the healthy control sera whereas only 1 of 7 CM-HUS remission samples similarly tested was positive. The positive remission sample was CM21 which also had incomplete blockade on ravulizumab. Along with the trend of increased IgM binding in acute compared to remission CM-HUS samples (vide supra, FIG.28), these results suggest a shift in the IgM pool in the acute setting of CM-HUS that resolves once in remission. Importantly, given heat inactivation, washing, and use of healthy control serum in the assay, this also demonstrated that IgM alone was sufficient to stimulate pathologic complement activity in some cases of CM-HUS. Together these results suggest a role for both “natural, polyreactive” and “autoreactive” IgM in the disease, but additional studies are needed to further characterize IgM reactivity from patient samples.49 Discussion We have developed complement biosensors capable of detecting surface-directed complement activation in real time. In contrast to fluid phase markers of complement (sC5b-9, Bb or Ba), cell-directed complement activation is more specific to CM-HUS disease pathogenesis13,14,50. These biosensors are unique among complement diagnostics in that they allow for detection of a range of complement activity without antibody sensitization51,52 or cell stimulation14 allowing for easy discrimination of activity coming from patient serum as opposed to the sensitization technique. We show the bioluminescent mHam can rapidly distinguish between CM-HUS and TTP and monitor complement blockade from inhibitors. Given the ease of the assay without need for specialized equipment, this should potentially change CM-HUS to a diagnosis of inclusion as opposed to exclusion. Next, by incubating CM-HUS sera with the specific C1s inhibitor, sutimlimab, we show that the predominant stimulus of complement activity in both the acute setting and in remission is from the classical pathway, addressing the mystery of why 40% of CM-HUS lack complement specific variants or autoantibodies. We demonstrate this finding even in patients with pathogenic variants in cell surface complement regulators such as membrane cofactor protein (MCP, CD46). Finally, we show that CP activity comes from polyclonal IgM as opposed to IgG. Taken together, these data suggest a breakdown in IgM immunologic tolerance as a key driver of CM-HUS and should stimulate the development of novel approaches to treat the disease. Since 1974 depression of C3 more than C4 in CM-HUS has been noted, and even at that time in accordance with our own observations it was shown that the “C3-splitting activity” was greater in all pathway buffer and suggested a classical pathway stimulus in the disease53. A CP stimulus from a polyreactive IgM profile provides a mechanistic explanation for both disease activity, even in those without variants in complement regulatory proteins, and the variable penetrance of the disorder in carriers of known pathogenic variants. It also explains the common propensity for C1q, C4d, and IgM deposition in histologic specimens of thrombotic microangiopathy54–58. These tissue findings contrast with what is seen in aHUS plasma where C3 is depressed in ~22-32% of samples compared to only 6.7% for C459. The reason for a higher incidence of low C3 is likely explained by the role for C4 as a complement initiating protein versus C3 as an amplifying protein; this is confirmed in quantitative radioisotopic studies which show that after CP stimulus, 30x more molecules of C3 than C4 are deposited on the cell surface60. Prior studies have shown that 80% of complement activity comes from alternative amplification on a solid surface61,62. Our data showing ongoing CP activity even in a patient with C3 depletion as well as activity with triple AP blockade provides further evidence that in the face of overwhelming CP stimulus, the role for AP amplification is less significant 31,32,63. Our study highlights further relevance to many important observations on the role of complement and IgM in disease pathophysiology. Most importantly, FH and CD46 are regulators of both the alternative and classical pathways34–38,64,65. Our data suggest that in CM-HUS the role of CD46 in regulating classical activity is more important than its role in controlling the amplification loop. Interestingly, in C3 glomerulopathy, another disorder characterized by alternative pathway variants, the disease can rarely present or even transition from dense deposit disease with predominantly C3-containing deposits to immune complex deposits66–68. There is also well-known interplay between polyreactive IgM and FH. In mice, FH is suspected of functioning more akin to CR1 in primates and has been shown to be crucial to controlling immune complexes injury in the glomerulus69,70. Furthermore, FH deficiency in mice exacerbates the ability of polyclonal and monoclonal IgM recognizing phospholipids to deposit on kidney mesangial cells, leading to complement activation and cell damage71. In human studies, low C4 and elevated C4d in an aHUS cohort with FHAA correlated with anemia and IgM on kidney biopsy58. In lupus nephritis, IgM independently contributes to C3 deposition, and those with the highest IgM staining and lowest FH levels show exacerbated proteinuria and depressed systemic C3 levels72. Additionally, IgM as opposed to IgG has been shown to be a more important complement stimulus in xenotransplantation73,74. Lastly, in COVID-19, a disorder with known abnormal complement activation, polyclonal IgM has been implicated in disease severity75. In summary, our data with biosensors reveals that CM-HUS is predominantly a disease of the CP. Variants in complement regulatory genes (FH, CD46, FB, C3, FI) lower the threshold for disease but are not necessary or sufficient to cause disease. CP activation in the disease is driven by polyreactive or autoreactive IgM and is readily inhibited by DTT or inhibition at C1s or C5. Lastly, we show that the bioluminescent mHam provides a rapid assay to distinguish CM- HUS from TTP and can be used to monitor complement inhibition with complement inhibitors such as sutimlimab, eculizumab and ravulizumab. +p6s8msuH-teseuo ouF suF gyscoi su rgF 1RleoH CoHzo Hog,Aytn2.a c tis ,Agyiz,1 yzC-3F dgH4 yz -3gyCz-1retH0 yTe r 59zo > 53r 6aA4 eDciA l Ho RomHreRHCRF oRA mFA DomRHh otcnlD D D DreGt40syV N CpsF+oh F tCeh F dH CnaCoH M A H CHFN NoHF dCnaaFG.pM M M M N N N NeH1.c C.p / detcel)lyo(c peul-pwmolalo4 4 4 5 31<11 5 9 4 2 1S F / 0 / 0 / 0 / 0 / 0 / 0 / 4 / 3 / 4 / 1 / 1 / 1sisongaidtaxeeSg / )F / F F F F F F F F F7 / 4M / / 3M / / 9 / 6 / 2 / 2 / 1 / 6 / Ay( 2 1 9 2 1 5 4 2 2 3 242noiet1020304 5 6 ssi7 8 9 0 1 2u0 0 0 0 0 0 1 1 1cmAMCMCMCMCMCMCeRMCMCMCMCMCMC Table 2. Fractionated anti-sera sensitized sheep erythrocytes CH50. Day 1 CH50 Day 2 CH50 Average CH50 (U / mL) (U / mL) (U / mL) . . Patient Age at Sample collected / Variant Overall Trigger Therapy Clinical identification diagnosis (y) / Follow-up (y) classification outcome g nt References 1. Legendre, C. M. et al. Terminal complement inhibitor eculizumab in atypical hemolytic-uremic syndrome. N. Engl. J. Med.368, 2169–2181 (2013). 2. Schieppati, A. et al. Renal function at hospital admission as a prognostic factor in adult hemolytic uremic syndrome. The Italian Registry of Haemolytic Uremic Syndrome. J. Am. Soc. Nephrol.2, 1640–1644 (1992). 3. Taylor, C. M., Chua, C., Howie, A. J., Risdon, R. A. & British Association for Paediatric Nephrology. Clinico-pathological findings in diarrhoea-negative haemolytic uraemic syndrome. Pediatr. Nephrol.19, 419–425 (2004). 4. Brocklebank, V. et al. Atypical haemolytic uraemic syndrome in the era of terminal complement inhibition- An observational cohort study. Blood (2023) doi:10.1182 / blood.2022018833. 5. Maga, T. K., Nishimura, C. J., Weaver, A. E., Frees, K. L. & Smith, R. J. H. Mutations in alternative pathway complement proteins in American patients with atypical hemolytic uremic syndrome. Hum. Mutat.31, E1445-60 (2010). 6. Osborne, A. J. et al. Statistical Validation of Rare Complement Variants Provides Insights into the Molecular Basis of Atypical Hemolytic Uremic Syndrome and C3 Glomerulopathy. J. Immunol.200, 2464–2478 (2018). 7. Roumenina, L. T. et al. A prevalent C3 mutation in aHUS patients causes a direct C3 convertase gain of function. Blood 119, 4182–4191 (2012). 8. Martín Merinero, H. et al. Functional characterization of 105 factor H variants associated with aHUS: lessons for variant classification. Blood 138, 2185–2201 (2021). 9. Liszewski, M. K., Leung, M. K., Schraml, B., Goodship, T. H. J. & Atkinson, J. P. Modeling how CD46 deficiency predisposes to atypical hemolytic uremic syndrome. Mol. Immunol.44, 1559–1568 (2007). 10. Ardissino, G. et al. Risk of Atypical HUS Among Family Members of Patients Carrying Complement Regulatory Gene Abnormality. Kidney Int Rep 6, 1614–1621 (2021). 11. Kavanagh, D., Goodship, T. H. & Richards, A. Atypical hemolytic uremic syndrome. Semin. Nephrol.33, 508–530 (2013). 12. Yuan, X. et al. Ex vivo assays to detect complement activation in complementopathies. Clin. Immunol.221, 108616 (2020). 13. Gavriilaki, E. et al. Modified Ham Test Distinguishes aHUS from TTP and Predicts Response to Eculizumab. Blood 126, 103–103 (2015). 14. Noris, M. et al. Dynamics of complement activation in aHUS and how to monitor eculizumab therapy. Blood 124, 1715–1726 (2014). 15. Gastoldi, S. et al. An ex vivo test to investigate genetic factors conferring susceptibility to atypical haemolytic uremic syndrome. Front. Immunol.14, 1112257 (2023). 16. Galbusera, M. et al. An Ex Vivo Test of Complement Activation on Endothelium for Individualized Eculizumab Therapy in Hemolytic Uremic Syndrome. Am. J. Kidney Dis.74, 56–72 (2019). 17. Meuleman, M.-S., Duval, A., Fremeaux-Bacchi, V., Roumenina, L. T. & Chauvet, S. Ex Vivo Test for Measuring Complement Attack on Endothelial Cells: From Research to Bedside. Front. Immunol.13, 860689 (2022). 18. Chaturvedi, S. et al. Complement activity and complement regulatory gene mutations are associated with thrombosis in APS and CAPS. Blood 135, 239–251 (2020). 19. Piras, R. et al. Molecular Studies and an ex vivo Complement Assay on Endothelium Highlight the Genetic Complexity of Atypical Hemolytic Uremic Syndrome: The Case of a Pedigree With a Null CD46 Variant. Front. Med.7, 579418 (2020). 20. Merrill, S. A. et al. Eculizumab cessation in atypical hemolytic uremic syndrome. Blood 130, 368–372 (2017). 21. Pangburn, M. K. Initiation of the alternative pathway of complement and the history of “tickover.” Immunol. Rev.313, 64–70 (2023). 22. Abramson, N., Alper, C. A., Lachmann, P. J., Rosen, F. S. & Jandl, J. H. Deficiency of C3 inactivator in man. J. Immunol.107, 19–27 (1971). 23. Nilsson, B. & Nilsson Ekdahl, K. The tick-over theory revisited: is C3 a contact-activated protein? Immunobiology 217, 1106–1110 (2012). 24. Frimat, M. et al. Complement activation by heme as a secondary hit for atypical hemolytic uremic syndrome. Blood 122, 282–292 (2013). 25. Fromell, K. et al. Assessment of the Role of C3(H2O) in the Alternative Pathway. Front. Immunol.11, 530 (2020). 26. Conway, M. et al. Real-time tracking of stem cell viability, proliferation, and differentiation with autonomous bioluminescence imaging. BMC Biol.18, 79 (2020). 27. Krych-Goldberg, M. & Atkinson, J. P. Structure-function relationships of complement receptor type 1. Immunol. Rev.180, 112–122 (2001). 28. Java, A., Liszewski, M. K., Hourcade, D. E., Zhang, F. & Atkinson, J. P. Role of complement receptor 1 (CR1; CD35) on epithelial cells: A model for understanding complement-mediated damage in the kidney. Mol. Immunol.67, 584–595 (2015). 29. Tissot, M. J. Inactivation of serums by the heat. The alexin or complement is made up by the union of two complexes, one made up by the sodium soaps of the serum united to globulin ( median portion of the complement) and the other by the cholesterine soaps united to albumin (terminal portion of the complement). Comptes rendus hebdomadaires des séances de l’Académie des sciences.158, 1525–1528 (1914). 30. Xu, T., Gilliam, M., Sayler, G., Ripp, S. & Close, D. Screening for androgen agonists using autonomously bioluminescent HEK293 reporter cells. Biotechniques 71, 403– 415 (2021). 31. Mannes, M. et al. Complement inhibition at the level of C3 or C5: mechanistic reasons for ongoing terminal pathway activity. Blood 137, 443–455 (2021). 32. de Boer, E. C. et al. The contribution of the alternative pathway in complement activation on cell surfaces depends on the strength of classical pathway initiation. Clin Transl Immunology 12, e1436 (2023). 33. Schramm, E. C. et al. Mapping interactions between complement C3 and regulators using mutations in atypical hemolytic uremic syndrome. Blood 125, 2359–2369 (2015). 34. Zwarthoff, S. A. et al. Functional Characterization of Alternative and Classical Pathway C3 / C5 Convertase Activity and Inhibition Using Purified Models. Front. Immunol. 9, 1691 (2018). 35. Ollert, M. W., David, K., Bredehorst, R. & Vogel, C. W. Classical complement pathway activation on nucleated cells. Role of factor H in the control of deposited C3b. J. Immunol.155, 4955–4962 (1995). 36. Barilla-LaBarca, M. L., Liszewski, M. K., Lambris, J. D., Hourcade, D. & Atkinson, J. P. Role of membrane cofactor protein (CD46) in regulation of C4b and C3b deposited on cells. J. Immunol.168, 6298–6304 (2002). 37. Devaux, P., Christiansen, D., Fontaine, M. & Gerlier, D. Control of C3b and C5b deposition by CD46 (membrane cofactor protein) after alternative but not classical complement activation. Eur. J. Immunol.29, 815–822 (1999). 38. Kojima, A. et al. Membrane cofactor protein (CD46) protects cells predominantly from alternative complement pathway-mediated C3-fragment deposition and cytolysis. J. Immunol.151, 1519–1527 (1993). 39. Medof, M. E., Kinoshita, T. & Nussenzweig, V. Inhibition of complement activation on the surface of cells after incorporation of decay-accelerating factor (DAF) into their membranes. J. Exp. Med.160, 1558–1578 (1984). 40. Cugno, M. et al. Complement functional tests for monitoring eculizumab treatment in patients with atypical hemolytic uremic syndrome. J. Thromb. Haemost.12, 1440–1448 (2014). 41. Cataland, S. et al. Discordance between Free C5 and CH50 Complement Assays in Measuring Complement C5 Inhibition in Patients with aHUS Treated with Ravulizumab. Blood 134, 1099–1099 (2019). 42. Jodele, S. et al. Complement blockade for TA-TMA: lessons learned from a large pediatric cohort treated with eculizumab. Blood 135, 1049–1057 (2020). 43. Berger, M., Baldwin, W. M., 3rd & Jordan, S. C. Potential Roles for C1 Inhibitor in Transplantation. Transplantation 100, 1415–1424 (2016). 44. Jordan, S. C. et al. IgG Endopeptidase in Highly Sensitized Patients Undergoing Transplantation. N. Engl. J. Med.377, 442–453 (2017). 45. Okuno, T. & Kondelis, N. Evaluation of dithiothreitol (DTT) for inactivation of IgM antibodies. J. Clin. Pathol.31, 1152–1155 (1978). 46. Bryan, C. F. et al. IgM antibodies identified by a DTT-ameliorated positive crossmatch do not influence renal graft outcome but the strength of the IgM lymphocytotoxicity is associated with DR phenotype. Clin. Transplant.15 Suppl 6, 28–35 (2001). 47. Angeretti, A., Merlino, C., Ferrara, B., Cavallo, R. & Negro Ponzi, A. [Effect of mercaptans on serum IgA]. Boll. Ist. Sieroter. Milan.65, 380–385 (1986). 48. Press, E. M. Fixation of the first component of complement by immune complexes: effect of reduction and fragmentation of antibody. Biochem. J 149, 285–288 (1975). 49. Amendt, T. & Yu, P. TLR7 and IgM: Dangerous Partners in Autoimmunity. Antibodies (Basel) 12, (2023). 50. Cole, M. A., Gerber, G. F. & Chaturvedi, S. Complement biomarkers in the antiphospholipid syndrome - Approaches to quantification and implications for clinical management. Clin. Immunol.257, 109828 (2023). 51. Liszewski, M. K. & Atkinson, J. P. Membrane cofactor protein (MCP; CD46). Isoforms differ in protection against the classical pathway of complement. J. Immunol.156, 4415–4421 (1996). 52. Mayer, M. M. Complement and Complement Fixation. in Experimental Immunochemistry (ed. Elvin A. Kabat and Manfred M. Mayer) 133–240 (Charles C. Thomas, 1961). 53. Stühlinger, W., Kourilsky, O., Kanfer, A. & Sraer, J. D. HÆMOLYTIC- URÆMIC SYNDROME: EVIDENCE FOR INTRAVASCULAR C3 ACTIVATION. Lancet 304, 788–789 (1974). 54. Chua, J. S. et al. Complement Factor C4d Is a Common Denominator in Thrombotic Microangiopathy. J. Am. Soc. Nephrol.26, 2239–2247 (2015). 55. Drachenberg, C. B. et al. Epidemiology and Pathophysiology of Glomerular C4d Staining in Native Kidney Biopsies. Kidney Int Rep 4, 1555–1567 (2019). 56. Lusco, M. A., Fogo, A. B., Najafian, B. & Alpers, C. E. AJKD Atlas of Renal Pathology: Thrombotic Microangiopathy. Am. J. Kidney Dis.68, e33–e34 (2016). 57. Koitabashi, Y., Rosenberg, B. F., Shapiro, H. & Bernstein, J. Mesangiolysis: an important glomerular lesion in thrombotic microangiopathy. Mod. Pathol.4, 161–166 (1991). 58. Song, D. et al. The clinical and laboratory features of Chinese Han anti-factor H autoantibody-associated hemolytic uremic syndrome. Pediatr. Nephrol.32, 811–822 (2017). 59. Noris, M. et al. Relative role of genetic complement abnormalities in sporadic and familial aHUS and their impact on clinical phenotype. Clin. J. Am. Soc. Nephrol.5, 1844–1859 (2010). 60. Ollert, M. W. et al. Antibody-mediated complement activation on nucleated cells. A quantitative analysis of the individual reaction steps. J. Immunol.153, 2213–2221 (1994). 61. Harboe, M., Ulvund, G., Vien, L., Fung, M. & Mollnes, T. E. The quantitative role of alternative pathway amplification in classical pathway induced terminal complement activation. Clin. Exp. Immunol.138, 439–446 (2004). 62. Harboe, M. et al. The down-stream effects of mannan-induced lectin complement pathway activation depend quantitatively on alternative pathway amplification. Mol. Immunol.47, 373–380 (2009). 63. Zhang, L. et al. Absence of complement component 3 does not prevent classical pathway-mediated hemolysis. Blood Adv 3, 1808–1814 (2019). 64. Thurman, J. M., Frazer-Abel, A. & Holers, V. M. The Evolving Landscape for Complement Therapeutics in Rheumatic and Autoimmune Diseases. Arthritis Rheumatol 69, 2102–2113 (2017). 65. Wieser, M. et al. CD46 knock-out using CRISPR / Cas9 editing of hTERT immortalized human cells modulates complement activation. PLoS One 14, e0214514 (2019). 66. Servais, A. et al. Heterogeneous pattern of renal disease associated with homozygous factor H deficiency. Hum. Pathol.42, 1305–1311 (2011). 67. Durey, M.-A. D., Sinha, A., Togarsimalemath, S. K. & Bagga, A. Anti- complement-factor H-associated glomerulopathies. Nat. Rev. Nephrol.12, 563–578 (2016). 68. Smith, R. J. H. et al. C3 glomerulopathy - understanding a rare complement- driven renal disease. Nat. Rev. Nephrol.15, 129–143 (2019). 69. Alexander, J. J., Pickering, M. C., Haas, M., Osawe, I. & Quigg, R. J. Complement factor h limits immune complex deposition and prevents inflammation and scarring in glomeruli of mice with chronic serum sickness. J. Am. Soc. Nephrol.16, 52–57 (2005). 70. Bao, L., Haas, M. & Quigg, R. J. Complement factor H deficiency accelerates development of lupus nephritis. J. Am. Soc. Nephrol.22, 285–295 (2011). 71. Panzer, S. E. et al. IgM exacerbates glomerular disease progression in complement-induced glomerulopathy. Kidney Int.88, 528–537 (2015). 72. Wang, F. et al. Clinical relevance of glomerular IgM deposition in patients with lupus nephritis. BMC Immunol.22, 1–10 (2021). 73. Parker, W., Bruno, D., Holzknecht, Z. E. & Platt, J. L. Characterization and affinity isolation of xenoreactive human natural antibodies. J. Immunol.153, 3791–3803 (1994). 74. Kuwaki, K. et al. Heart transplantation in baboons using alpha1,3- galactosyltransferase gene-knockout pigs as donors: initial experience. Nat. Med.11, 29–31 (2005). 75. Wong, A. K. H. et al. Broad auto-reactive IgM responses are common in critically ill patients, including those with COVID-19. Cell Rep Med 2, 100321 (2021). 76. Labun, K. et al. CHOPCHOP v3: expanding the CRISPR web toolbox beyond genome editing. Nucleic Acids Res.47, W171–W174 (2019). 77. Morgan, B. P. Measurement of complement hemolytic activity, generation of complement-depleted sera, and production of hemolytic intermediates. Methods Mol. Biol. 150, 61–71 (2000). EXAMPLE 3: Isolated AP bioluminescent mHam Assay We have created autonomously bioluminescent cell lines lacking complement regulators, so-called “complement biosensors” that can be used in a bioluminescent modified Ham assay to aid in diagnosis of complementopathies, complement deficiencies, detect autoreactive IgM / immune complexes, and monitor therapeutic efficacy of complement inhibitors. In combination with specific complement inhibitors these biosensors can be used to identify the most active complement stimulus in a given patient and help predict expected response to therapy. Most currently available complement diagnostics focus on diagnosing deficiencies of complement; this assay is unique in its ability to also diagnose overactivity and even show a range of “physiologic” complement activation in healthy controls. Additionally, complement activation lies on a spectrum between fluid phase and membrane directed, aka solid phase; fluid phase diagnostics (e.g., ELISAs for sC5b-9, Bb, C4d) are nonspecifically elevated in many disorders and membrane directed activity is known to be more specific to disease activity in complementopathies (https: / / doi.org / 10.1182 / blood-2014- 02-558296). This diagnostic assay only identifies membrane-directed complement activity. Next, a suitable test for monitoring efficacy of complement therapeutics is currently lacking. CH50 to monitor for deficiency in complement activity is commonly used to monitor efficacy of C5 inhibitor eculizumab, but such testing has proven ineffective for a similar complement inhibitor (ravulizumab) (https: / / doi.org / 10.1016 / j.jim.2020.112944). Specialized testing is required to either measure a “drug level” or effect of the drug, e.g., free C5 level for C5 inhibitors. This assay can show that a patient on therapeutic complement inhibition protects extremely susceptible membrane surfaces, e.g., the double knockout cell line lacking major complement regulators (CR1, CD46, CD55, and CD59). Finally, perhaps the main advantage of this test is its ease of performance. It can be performed in a matter of hours and does not require specialized reagents or equipment. The complement system can be activated through three principal mechanisms, including the classical pathway, lectin pathway, and alternative pathway. With appropriate selection of cell lines, buffers, and inhibitors the bioluminescent modified Ham assay can be used to diagnose dysregulation in all three pathways. In particular, genetic testing is routinely performed to look for variants in “alternative pathway” genes to aid in the diagnosis of atypical HUS. However, detection of a variant of uncertain significance (VUS), does not prove relevance to disease, as only 20-50% of patients with known pathogenic variants ever have disease manifestations. Additionally, in the absence of a genetic variants a Factor H autoantibody (FHAA) can also lead to isolated AP dysregulation but although ELISAs can detect the presence of a FHAA, they do not demonstrate their functional significance. The bioluminescent modified Ham assay in alternative pathway buffer offers a facile approach to show functional relevance of an identified mutation. Pathway specific buffers are well established techniques to evaluate the role of alternative pathway vs all pathways in complement immunobiology. Gelatin veronal buffer with calcium and magnesium (GVB++) allows all pathway activation to occur. Calcium is required for C1q to antibody interactions (classical pathway) as well as MBL to MASP interactions (lectin pathway). Magnesium is required for formation of C3 / C5 convertases. Gelatin veronal buffer with MgEGTA (also referred to as AP buffer) provides a buffer that will simultaneously chelate calcium (preventing CP and lectin pathway activation) but allow for ongoing alternative pathway activation by providing a source of magnesium. The CD46KO, PIGAKO, and DKO can be used in GVB++to diagnose complementopathies, complement deficiencies, and monitor therapeutic efficacy of inhibitors. To highlight some of the best identified uses in GVB++, the CD46KO cell line provides the greatest specificity, the PIGAKO cell line distinguishes a range of physiologic complement activity among healthy controls, and the DKO cell line can be used to evaluate for complement deficiencies or monitor efficacy of therapeutic complement blockade. If a sample is incompletely blocked by sutimlimab (a classical pathway inhibitor) in all pathway buffer, the serum can be spiked with a MASP-2 inhibitor in combination with a C1s inhibitor to isolate the contributions of the lectin pathway (FIG.39). Utilizing the bioluminescent mHam on CD46KO cells in GVB++in combination with the isolated AP assay can phenotype the dysregulation observed in complementopathies including aHUS / CM-TMA, antiphospholipid antibody syndrome, and C3 glomerulopathy. Results The isolated AP bioluminescent modified Ham assay is performed using the DKO cell line in GVB with MgEGTA. Healthy control sera in AP buffer (GVB-MgEGTA) on the DKO line showed that the cytolytic effects of the alternative pathway can be isolated and appropriately blocked by FDi but not by sutimlimab (FIG.38A), and there was dose- dependent inhibition of this activity with increasing concentrations of eculizumab, factor D inhibitor, factor B inhibitor, and C3 inhibitor (cp40) (FIG.38D-38G). Further evaluation of sera from CM03 with a known factor H autoantibody level of 57,104 arbitrary units (<200 AU normal) in isolated alternative pathway buffer showed significant killing of the DKO cell line (FIG.40B), but cytolytic activity was completely inhibited on the CD46KO cell line (FIG.38C). These results emphasize the relative strength of the classical and alternative pathways of complement, i.e., the classical pathway has cytolytic activity even on cells with intact regulators, whereas the cytolytic effects in AP buffer are observed only after rendering the cells almost completely devoid of complement regulators (i.e., the double knockout cell line). Although utilizing an isolated AP buffer ensures effectiveness of AP inhibitors (e.g., cp40, danicopan, or iptacopan), this assay also allows us to analyze the contributions of the classical pathway or even lectin pathway to identified complement dysregulation (FIG.40A- 40B). Finally, we have utilized the isolated AP bioluminescent modified Ham assay in establishing a normal range of AP activity in healthy controls and identifying AP-specific complement dysregulation in some patients even when a significant stimulus is not detected in all pathway buffer (GVB++). As shown in FIG.41, the mean relative luminescence at 1 hour for healthy controls (n=21) was 56.9% (mean 95% CI 50.9-62.9%). The lower 5th percentile (relative luminescence of 39.3% at t=1 h) for the AP activity of healthy controls can be used as a threshold to diagnose AP dysregulation. In patients with a known or likely diagnosis of aHUS-CM-TMA (n=18), 7 of 8 patients show alternative pathway dysregulation in the acute setting regardless of whether or not they have a VUS or FHAA (FIG.41 and Table 1). Whereas in remission only those with known FHAA or VUS have ongoing AP dysregulation. In patients with a history of a possible thrombotic microangiopathy or renal disease in which complement genetic testing was performed (n=16), only 3 patients have isolated AP dysregulation (Table 2 and Table 3). Table 1. Patients with suspected diagnosis of CM-TMA results on isolated AP assay and CD46KO cell line in all pathway buffer. Likely DiagnosisAP CD46KO sC5b-9CM TMA(ng / mL) V ri nt( ) Remission CM-TMA45.7 78.5 TNPNo variant and CD46KO cell line in all pathway buffer. Systemic TMAAP CD46KOsC5b-9 (ng / mL) Variant(s)n Acute94.2 111.6 337NFKB1 VUS on whole exome detected. Renal disease + / - TMAAP CD46KOsC5b-9 (ng / mL) Variant(s)17f 3 . Conclusions The isolated AP version of the assay can be used to evaluate for AP complement dysregulation and monitor for therapeutic efficacy. As for the bioluminescent mHam, the primary advantage of the assay is ease of performing the assay (speed, no special reagents or kits). This is an adjunctive measure for diagnosis of aHUS / CM-TMA and will allow phenotyping of CM-TMA into CP-driven, AP-driven, or both. Although more data is required, we suspect utilization of these assays will predict response to C5 inhibitory therapy in undifferentiated TMA / secondary HUS, help predict risk of relapse long-term, and guide therapy. Materials and Methods Complement inhibitors that can be therapeutically monitored in all pathway or isolated AP bioluminescent modified Ham assay. Therapeutic efficacy of any drug targeting CP or AP protein can be monitored whose direct or indirect inhibition would result in decreased insertion of MAC into cell membranes. This list includes, but is not limited to, C1q (e.g., ANX005 / ANX009), C1s (e.g., sutimlimab) or C1sa (e.g., riliprubart), C2 (e.g., ARGX-117), C3 (e.g., compstatin or its analogues, APL-2 or pegcetacoplan, AROC3), C3b / C5 (KP104), Factor B (e.g., iptacopan), Factor D (e.g., danicopan), MASP-3 (e.g., OMS906), or C5 (e.g., eculizumab, ravulizumab, crovalimab, tesidolumab, cemdisiran). Isolated Alternative Pathway Bioluminescent modified Ham assay protocol. Cell lines and tissue culture: The LiveLight (LL) PIGA- / CD46- / -HEK293 aka DKO cells are utilized. Reagent storage / preparation. Gelatin Veronal Buffer-Magnesium Ethylene Glycol Tetraacetic Acid (GVB0with 13 mM MgEGTA), aka AP buffer or MgEGTA, is prepared from GVB0(Complement Technologies #B103) and MgEGTA (Complement Technologies #B106) and used within one week. Working aliquot stored at 4 °C between use. Preparation of 5 mL is described below and can be scaled up as appropriate (typically 20-30 mL prepared at a time). 650 uL MgEGTA (0.1 M MgCl2, 0.1 M EGTA, pH 7.3) is diluted to 5 mL with GVB0. Final concentration 13 mM Mg and EGTA. pH is adjusted to 7.35-7.45 at 25 °C with dropwise addition of HCl (6 M)—approximately 3-4 uL. 0.25% trypsin / EDTA (Corning #25-053-C1) is stored at -20 °C in 10-15 mL aliquots. Working aliquots are stored at 4 °C. Complement inhibitors (eculizumab and sutimlimab) are stored at -80 °C. Working aliquots are stored at -20°C and thawed on ice prior to use. Serum sample collection and storage. Serums samples are collected in gold or red top tubes as per routine phlebotomy practices. Serum is separated immediately after clotting for 30 minutes (gold top) or 50 min (red top). Serum is aliquoted and frozen at -80 ºC until they can be analyzed. Significant delays in separation of serum or processing can result in a false negative result. Make note of complement levels to ensure they are not depleted. Make note of whether or not the patient is on C5 inhibitor therapy. If curves overlap in assay, can consider running adjunctive Wieslab assay to evaluate for deficiency or depletion that could have resulted from delayed processing. Assay Procedure Prior to starting: turn on two temperature-controlled waterbaths to 37 °C and 56 °C. Allow media and GVB++ to warm to 37 °C. Allow inhibitors (if used) to thaw on melting ice. Cell preparation: See cell culture growth and maintenance protocol for more detail. 1. Media is removed and adherent cells washed once with phosphate buffered saline (PBS without calcium or magnesium, Quality Biological #114-058-101) 2. Cells are treated with trypsin / EDTA (400 uL; 0.25% trypsin / EDTA, Corning #25-053-C1) for 3-5 minutes at room temperature. 3. Trypsin is inactivated with the addition of culture media (~1 mL) and cells are resuspended with repeated pipetting to obtain a single cell suspension free of clumps (>95% single cells) when examined by light microscopy. 4. Cells are diluted with HBSS (no calcium and magnesium, Gibco #14175-095) to a total volume of 11.4 mL and centrifuged at 1000 rpm (125g) for 7 minutes. 5. Cells are resuspended in culture media and counted on a Denovix CellDrop fluorescent cell counter with trypan blue or AO / PI to ensure adequate cell numbers and viability >91% prior to proceeding with the assay. 6. Cells are maintained at 37 ºC / 5% CO2 in media until test serum samples have been prepared. 7. Once serum samples are thawed and heat inactivated controls prepared (see below), the cells are washed with an additional 10 mL of HBSS (no calcium or magnesium) and centrifuged at 1000 rpm / 125 g for 7 minutes; cells are subsequently resuspended in prewarmed (to 37 °C) Mg-EGTA (AP buffer) at a concentration of 2,000,000-3,000,000 cells / mL. Care is again taken to ensure no significant cell clumps remain in solution. Note: the concentration of cells selected should allow pipetting of 40k cells with a P20 pipette at a volume of 10-20 uL per well. In our hands higher dilutions and using a P200 pipette results in greater well to well variability. Using P200 and higher volume does allow for the use of a larger reservoir and pipetting 12-wells at a time for more rapid plate preparation but there is a tradeoff in regards to precision. Note: do not leave cells in GVB++ for prolonged periods of time prior to setting up the assay (e.g., >1 h) Serum preparation: 1. Serum samples are moved from -80 °C and rapidly thawed in a 37 ºC water bath for ~1 min. Aliquots are frequently checked and once only a trace amount of ice remains, the samples are agitated with a vortex mixer to obtain the fully liquid sample and placed in ice bath. 2. An aliquot (70 μL) of each sample is prepared and heated at 56 ºC for 30 minutes to obtain the heat inactivated control. Once heat-inactivated place back on ice. 3. If specific complement inhibitors are used, they are added to the serum on ice and incubated for at least 30 minutes (time range 30-60 minutes). Ensure mixing by vortex of inhibitor prior to addition and then once added to serum ensure mixing by repeated pipetting. Failure to mix can result in incomplete inhibition. 4. Pooled normal human sera from Complement Technology or a healthy control sample of known activity (preferred) are used as a negative control. Sera known to be positive in the assay should be aliquoted and saved by the lab to use as a positive control. 5. Serum samples (total volume either 66 or 70 uL) are preplated in 4 columns of a 96 well U- (corning #3788) or V- bottom (thermos fisher # 249662). After plate is prepared it is kept on ice in same order to be used in assay. Setting up the assay plate: To perform the assay, a white, opaque flat bottom 96-well plate (TC treated, Costar #3917) is used. 1. Depending upon the calculated cell concentration and volume required for 40,000 cells per well (typically 10-20 μL), an appropriate volume of prewarmed MgEGTA is added to each well (typical range 60-70 μL) 2. DKO cells in MgEGTA (see preparation above) are gently mixed by repeated pipetting and added to a reservoir. Given volume is 1-2 mL the reservoir is a short reservoir that allows pipetting of just 4 wells at a time to fill the plate. See note above on use of larger volumes and larger reservoirs. 3. An appropriate volume of cell suspension (typical range 10-20 μL) is added such that 40,000 cells are plated per well (4 wells at a time). Mix with 5-6 pipettes with each draw to ensure reservoir suspension remains uniform. 4. At this point test prepared sera is taken off ice and allowed to equilibrate to room temperature for ~10 minutes. Immediately prior to measurement a multichannel pipette is used to transfer 20 uL of each serum samples onto the cells (20 ul serum + 80 uL total cell suspension in each well) in triplicate. Samples are mixed with the repeated pipetting (x3-5) at time of transfer and plate is immediately transferred to the luminometer preequilibrated at 37 ºC for measurement. Luminescence measurement: A BMG clariostar luminometer is utilized. Following appropriate focal length and gain adjustment, the sample is shaken in the luminometer for 60 seconds with the double orbital pattern at 300 rpm prior to initial reading. Spiral average, top-read luminescent measurements are taken of each well every 5 minutes for 2.5 hours and the results are graphed in Prism Graphpad. Positive assay determination: In certain embodiments, the relative luminescence of each sample at one hour is used to determine whether or not the sample is positive for significant complement activation. The relative luminescence of each sample is determined by comparison to its own heat inactivated control and converted to a percentage. A relative luminescence of <39.3% (lower 5% percentile of healthy controls) at one hour is positive for AP dysregulation—although cutoff may eventually change with addition of more healthy controls. Given a slightly higher common variance than with the all pathway bioluminescent mHam, an average of two runs is recommended for samples for which the first run lies between 25 and 45%.

Claims

That Which Is Claimed:

1. A method for detecting complement activation in a patient sample comprising the steps of: (a) contacting the patient sample with a plurality of cells that (i) are glycosylphosphatidylinositol-anchored protein (GPI-AP) deficient and (ii) have an autobioluminescent phenotype; (b) measuring luminescence continuously or serially over a period of time; wherein a significant decrease in luminescence relative to a negative control indicates complement activation in the patient sample and wherein no significant decrease in luminescence relative to a negative control indicates no complement activation in the patient sample.

2. The method of claim 1, wherein complement activation is associated with a complement-mediated disease comprising atypical hemolyetic syndrome (aHUS); post- transplant thrombotic microangiopathy (TMA); drug-associated TMA; malignant hypertension; scleroderma renal crisis; Hemolysis, elevated liver enzymes, low platelet count (HELLP) syndrome; antiphospholipid antibody syndrome / CAPS; or C3 glomerulopathy disease.

3. The method of claim 1, the negative control comprises heat-inactivated patient sample or healthy control.

4. The method of claim 1, wherein the patient sample is serum, whole blood or plasma.

5. The method of claim 1, wherein the comparison of luminescence relative to the negative control is performed using a particular time point or a series of time points within the period of time of step (b).

6. The method of claim 1 or 5, wherein the period of time of step (b) is about 1 to about 5 hours.

7. The method of claim 5, wherein particular time point is between about 1 and about 2 hours.

8. The method of claim 5, wherein the series of time points is about five minutes.

9. The method of claim 1, wherein the plurality of GPI-AP deficient cells is biochemically treated to remove GPI-AP.

10. The method of claim 1, wherein the plurality of GPI-AP deficient cells is a phosphatidylinositol glycan class A (PIGA) null mutant cell line.

11. The method of claim 1, wherein the plurality of cells are CD46- / -.

12. The method of claim 1, wherein the plurality of cells are CR1- / -.

13. The method of claim 1, wherein the plurality of cells are PIGA- / -, CD46- / -and CR1- / -.

14. The method of claim 1, wherein the autobioluminescent cells stably express bacterial luciferase (lux) and flavin reductase (luxF).

15. The method of claim 1, wherein the plurality of cells are HEK293, HCT116, HeLa, MepG2, or MCF7 cells.

16. The method of claim 1, wherein the plurality of cells comprise double PIGA / CD46 knockout HEK293 cells.

17. A method for monitoring complement inhibitor therapy in a patient being treated for a disease or condition associated with complement activation comprising the steps of: (a) contacting a sample obtained from the patient being treated with a complement inhibitor therapy with a plurality of cells that (i) are PIGA- / -and CD46- / -and (ii) have an autobioluminescent phenotype; (b) measuring luminescence continuously or serially over a period of time; (c) determining relative luminescence compared to a negative control using a particular time point or a series of time points within the period of time of step (b);wherein a significant decrease in luminescence relative to a negative control indicates complement activation and wherein no significant decrease in luminescence relative to a negative control indicates complement inhibition.

18. The method of claim 17, the negative control comprises heat-inactivated patient sample or healthy control.

19. The method of claim 17, wherein the patient sample is serum, whole blood or plasma.

20. The method of claim 17, wherein the period of time of step (b) is about 1 to about 5 hours.

21. The method of claim 17, wherein the particular time point of step (c) is between about 1 and about 2 hours.

22. The method of claim 17, wherein the series of time points of step (c) is about five minutes.

23. The method of claim 17, wherein the autobioluminescent cells stably express bacterial luciferase (lux) and flavin reductase (luxF).

24. The method of claim 17, wherein the plurality of cells are HEK293, HCT116, HeLa, MepG2, or MCF7 cells.

25. The method of claim 17, wherein the plurality of cells are CR1-.

26. A method for determining whether a patient has a complement deficiency or a depletion of complement, wherein a sample from the patient has been previously tested and complement activation has been confirmed, comprising the steps of: (a) mixing the patient sample with normal human serum and contacting the mixed sample with a plurality of autobioluminescent PIGA- cells; and (b) measuring luminescence continuously or serially over a period of time, wherein a significant decrease in luminescence relative to a negative control indicates complement activity restoration and that the patient sample is depleted of complement, andwherein no significant decrease in luminescence relative to a negative control indicates the patient has a complement deficiency.

27. The method of claim 26, wherein steps (a) and (b) are repeated with a plurality of autobioluminescent PIGA- / CD46- / CR1- cells, wherein a significant decrease in luminescence relative to a negative control indicates complement activity restoration and that the patient sample is depleted of complement, and wherein no significant decrease in luminescence relative to a negative control indicates the patient has a complement deficiency.

28. The method of claim 27, wherein the cells are HEK293 cells.

29. The method of claim 26, wherein the patient sample is mixed with normal human serum in about a 50:50 ratio.

30. The method of claim 26, wherein the autobioluminscent PIGA- cells are CR1- or CD46-.

31. The method of claim 26 or 27, the negative control comprises heat-inactivated patient sample or healthy control.

32. The method of claim 26, wherein the patient sample is serum, whole blood or plasma.

33. The method of claim 26, wherein the comparison of luminescence relative to the negative control is performed using a particular time point or a series of time points within the period of time of step (b).

34. The method of claim 26 or 33, wherein the period of time of step (b) is about 1 to about 5 hours.

35. The method of claim 33, wherein particular time point of step (c) is between about 1 and about 2 hours.

36. The method of claim 33, wherein the series of time points of step (c) is about five minutes.

37. The method of claim 26, wherein the autobioluminescent cells stably express bacterial luciferase (lux) and flavin reductase (luxF).

38. The method of claim 26, wherein the plurality of cells are HEK293, HCT116, HeLa, MepG2, or MCF7 cells.

39. A method for identifying which complement pathway is activated in a patient comprising the steps of: (a) contacting in a first reaction a patient sample separately with a classical pathway inhibitor, an alternative pathway inhibitor and a lectin pathway inhibitor; (b) contacting each of the first reactions with a plurality of autobioluminescent PIGA- / CD46- / CR1- cells; (c) measuring luminescence continuously or serially over a period of time; and (d) determining for each of the first reactions relative luminescence compared to a negative control using a particular time point or a series of time points within the period of time of step (c), wherein no significant decrease in luminescence relative to a negative control in one of the three first reaction indicates activation of that specific complement pathway, and wherein a significant decrease in luminescence relative to a negative control in one of the three first reactions indicates no activation of that specific complement pathway.

40. The method of claim 39, wherein the plurality of cells are HEK293 cells.

41. The method of claim 39, the negative control comprises heat-inactivated patient sample or healthy control.

42. The method of claim 39, wherein the patient sample is serum, whole blood or plasma.

43. The method of claim 39, wherein the period of time of step (b) is about 1 to about 5 hours.

44. The method of claim 39, wherein particular time point of step (c) is between about 1 and about 2 hours.

45. The method of claim 38, wherein the series of time points of step (c) is about five minutes.

46. The method of claim 39, wherein the autobioluminescent cells stably express bacterial luciferase (lux) and flavin reductase (luxF).

47. The method of claim 39, wherein the plurality of cells are HEK293, HCT116, HeLa, MepG2, or MCF7 cells.

48. A method for detecting dysregulation of the alternative pathway of complement in a patient comprising the steps of: (a) contacting serum obtained from a patient with a composition comprising double CD46 / PIGA knockout (DKO) cells suspended in MgEGTA buffer; and (b) measuring luminescence continuously or serially over a period of time, wherein a lower luminescence related to a control indicates dysregulation of the alternative pathway of complement in the patient.

49. The method of claim 48, wherein DKO cells are CR1-.

50. The method of claim 48, wherein the alternative pathway buffer comprises Gelatin Veronal Buffer with Magnesium Ethylene Glycol Tetraacetic Acid.

51. The method of claim 48, wherein the control is a heat-inactivated patient sample or healthy control.

52. A method for monitoring alternative pathway complement inhibition in a patient comprising the steps of: (a) contacting a sample obtained from the patient being treated with an alternative pathway complement inhibitor with a plurality of cells that (i) are PIGA- / -, CD46- / -and CR1- / -and (ii) have an autobioluminescent phenotype, wherein the plurality of cells are suspended in alternative pathway buffer;(b) measuring luminescence continuously or serially over a period of time; and (c) determining relative luminescence compared to a negative control using a particular time point or a series of time points within the period of time of step (b); wherein a significant decrease in luminescence relative to a negative control indicates complement activation and wherein no significant decrease in luminescence relative to a negative control indicates complement inhibition.

53. The method of claim 52, the negative control comprises heat-inactivated patient sample or healthy control.

54. The method of claim 52, wherein the patient sample is serum, whole blood or plasma.

55. The method of claim 52, wherein the period of time of step (b) is about 1 to about 5 hours.

56. The method of claim 53, wherein the particular time point of step (c) is between about 1 and about 2 hours.

57. The method of claim 52, wherein the series of time points of step (c) is about five minutes.

58. The method of claim 52, wherein the autobioluminescent cells stably express bacterial luciferase (lux) and flavin reductase (luxF).

59. The method of claim 52, wherein the plurality of cells are HEK293, HCT116, HeLa, MepG2, or MCF7 cells.

60. The method of claim 52, wherein the alternative pathway buffer comprises Gelatin Veronal Buffer with Magnesium Ethylene Glycol Tetraacetic Acid.

61. A method for monitoring alternative pathway complement inhibition in a patient comprising the steps of: (a) contacting a sample obtained from the patient being treated with an alternative pathway complement inhibitor with a plurality of cells that (i) are PIGA- / -, CD46- / -and CR1- / -and (ii) have an autobioluminescent phenotype, wherein the plurality of cells are suspended in alternative pathway buffer; (b) measuring luminescence continuously or serially over a period of time; and (c) determining relative luminescence compared to a positive control using a particular time point or a series of time points within the period of time of step (b); wherein no significant increase in luminescence relative to a positive control indicates complement activation and wherein a significant increase in luminescence relative to a negative control indicates complement inhibition.

Images