A platform for simultaneous control of multiple genes at high throughput

Abstract

Disclosed herein are methods and systems for detecting high throughput transcriptional activation and / or transcriptional repression of target genes within a cell. Disclosed is a method for high throughput simultaneous transcriptional activation and / or transcriptional repression of target genes within a cell, comprising: introducing a multi-sgRNA cassette comprising two to six target gene sgRNAs in the cell, wherein each target gene sgRNA comprises a bacteriophage aptamer, wherein each of the two to six target gene sgRNAs is flanked by a Pol III promoter or tRNAs; and co-expressing a catalytically inactive nuclease with a transcriptional activator or a transcriptional repressor and an RNA binding protein, wherein the multi-sgRNA cassette controls the simultaneous transcriptional activation and transcriptional repression of two to six target genes in the cell.

Description

[0001] Docket No.10034-324WO1 A PLATFORM FOR SIMULTANEOUS CONTROL OF MULTIPLE GENES AT HIGH THROUGHPUT CROSS-REFERENCE TO RELATED APPLICATIONS This application claims priority to, and the benefit of, U.S. Provisional Patent Application No. 63 / 590,544, filed October 16, 2023, which is incorporated by reference herein in its entirety. STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH This invention was made with government support under DP2CA280622 awarded by the National Institutes of Health. The government has certain rights in the invention. REFERENCE TO SEQUENCE LISTING The sequence listing submitted on October, 16, 2024, as an .XML file entitled “10034-324WO1 2014_10_16 ST26 Sequence Listing” created on October, 15, 2024, and having a file size of 223,160 bytes is hereby incorporated by reference pursuant to 37 C.F.R. § 1.52(e)(5). FIELD Disclosed herein are methods and systems for detecting simultaneous transcriptional activation and / or transcriptional repression in a cell using multi-sgRNA cassette. BACKGROUND Cas protein is a programmable nuclease that can be targeted to specific genes by single guide RNAs (sgRNAs). CRISPR / dCas9 technologies have ushered in a new era of rapid genetic deletion screens and are unsurprisingly at the forefront of high-throughput screenings. The CRISPR (cluster regularly interspaced short palindromic repeats) / Cas system employs an RNA-targeted Cas protein with exquisite gene / DNA targeting capabilities. When endonuclease activity is abrogated from Cas9 (i.e., deactivated Cas), the DNA targeting functionality remains. CRISPR / Cas-mediated gene knockout studies gained momentum following small- scale experiments that used Cas protein paired with a single-guide RNA to mutate CAN1, an Docket No.10034-324WO1 arginine permease, and showed that Cas-induced DNA double-strand breaks allow for improved insertion of foreign DNA into the targeted region. It is also known that genome- wide deactivated Cas-based transcriptional inhibition (CRISPRi) screens rely on the deficient endonuclease’s ability to repress genes by interfering with RNA Pol II and repressors that usually bind to promoter DNA when targeting a 200 bp region immediately upstream of the transcription start site, as well as open chromatin regions. Still, no method exists to turn up and down the expression several genes at the same time at the level necessary to decipher complex phenotypes like how cells are able to resist stress (i.e., exploring genes of potential importance in millions of combinations). Therefore, a platform is needed to control the expression of several genes at once in a single cell at very large scale and for detecting simultaneous transcription activation and repression of different genes in the same cell. There is still a gap pertaining to better engineered cells to test survival, to screen for gene combinations that help cells resist diseases (such as protein aggregation-related neurodegenerative diseases), to search for gene combinations that can be employed to kill diseased cells or prevent of overcome resistance to therapeutics by diseased cells (like cancerous cells). Current high throughput methods to control gene expression can typically target one gene per cell. Controlling multiple genes (e.g. 2, 3, or even more) in a cell has been shown to enhance desired phenotypes, for instance, the ability to produce a desired chemical compound for a microbial cell. However, it is currently difficult to study the impact of modulating the expression of thousands (or millions) of gene combinations. Given the limitations described above, the system and methods disclosed herein address the need for a novel platform required as a response to the shortcomings of traditional screening platforms to simultaneously detect transcription activation and repression of different genes in the same cell at high throughput. SUMMARY Disclosed herein is a novel platform to detect the expression of several genes per cell at a large scale, i.e., millions of different combinations of genes in millions of different cells. Current high throughput methods to control gene expression can typically target one gene per cell. Controlling multiple genes (e.g. 2, 3, or even more) in a cell has been shown to enhance desired phenotypes, for instance, the ability to produce a desired chemical compound for a microbial cell. However, it is currently difficult to study the impact of modulating the expression of thousands (or millions) of gene combinations. For instance, it is possible to Docket No.10034-324WO1 study the impact of 100 genes individually in 100 cells (N = 100) and test the combinatorial impact of 3 genes in 1 cell (N = 1). However, it is not possible to study the impact of any 3 combinations of 100 genes. To address this limitation, combinatorial Cas9-mediated screens are developed at high throughput using new overlap-extension-PCR based techniques for creating multi-sgRNA constructs. This platform technology uses overlap-extension-PCR based techniques which also enables simultaneous activation and repression of gene expression for in the same cell for multiple genes per cell and can do this at the same large scale, i.e., millions of different combinations of genes in millions of different cells. Disclosed herein is a new platform technology, developed for use in the model organism Saccharomyces cerevisiae or ‘yeast,’ that allows sampling millions of different combinations of gene expression in a single experiment. As either activation or inhibition of a gene’s expression might impact how a cell responds to its environment, the platform is expanded to allow upregulating and downregulating gene expression in the same cell, instead of only allow upregulating or only allowing down regulating. The same scale of combinatorial perturbations are kept that could be attained at the highest level. The platform is developed in S. cerevisiae because it is a model system for human biology, has genes known to be important for resistance to human diseases, and is an important cell factory. S. cerevisiae has been a valuable tool to study other important human disease states characterized by gain-of-function protein aggregation that causes cell death, including Parkinson’s disease (via expression of aggregating a-synuclein), Huntington’s disease (through expression of aggregating poly-glutamine fragments), and amyotrophic lateral sclerosis (ALS; through expression of aggregating TDP-43 or FUS proteins or of super oxide dismutase 1 (SOD1) mutants). Yeast have also been used to study transcriptional changes that coincided with ROS stress. In yeast, both universal stress-resistance pathways and specific stressor-dependent factors mediate resistance to individual stressors. Human cells share this phenomenon and have orthologs of yeast stress-resistance proteins. Stress and stress resistance can be general markers of disease. In some aspects, disclosed herein is a system for simultaneous transcriptional activation or transcriptional repression in a cell comprising: a catalytically inactive nuclease; an RNA binding protein; at least two bacteriophage aptamers; a multi-sgRNA cassette, wherein the multi-sgRNA cassette comprises two to six target gene sgRNAs; and a transcriptional activator or a transcriptional repressor. In some embodiments, the RNA binding protein is fused to the transcriptional activator or the transcriptional repressor. Docket No.10034-324WO1 In some embodiments, the catalytically inactive nuclease is a deactivated Cas protein (dCas). In some embodiments, the deactivated Cas protein is a dCas9 or a dCas12. In some embodiments, the RNA binding protein comprises MS2 phage coat protein (MCP) or PP7 phage coat protein (PCP). In some embodiments, the at least two bacteriophage aptamers comprise MS2 stem loops and / or PP7 stem loops. In some embodiments, the transcriptional activator is a VPR protein. In some embodiments, the transcriptional repressor is an MXI1 protein. In some embodiments, the cell comprises a eukaryotic cell. In some embodiments, the eukaryotic cell is a Saccharomyces cerevisiae (S. cerevisiae) cell. In some aspects, disclosed herein is a method for high throughput transcriptional activation or transcriptional repression of target genes within a cell, comprising: introducing a multi-sgRNA cassette comprising two to six target gene sgRNAs in the cell, wherein each target gene sgRNA comprises a bacteriophage aptamer; and co-expressing a catalytically inactive nuclease with a transcriptional activator or a transcriptional repressor and an RNA binding protein, wherein the multi-sgRNA cassette controls the transcriptional activation or transcriptional repression of two to six target genes simultaneously in the cell. In some embodiments, the catalytically inactive nuclease is a deactivated Cas protein (dCas). In some embodiments, the deactivated Cas protein is a dCas9 or a dCas12. In some embodiments, the RNA binding protein comprises MS2 phage coat protein (MCP) or PP7 phage coat protein (PCP). In some embodiments, the bacteriophage aptamer comprises MS2 stem loop or PP7 stem loop. In some embodiments, the transcriptional activator is a VPR protein. In some embodiments, the transcriptional repressor is a MXI1 protein. In some embodiments, the cell comprises a eukaryotic cell. In some embodiments, the eukaryotic cell is a Saccharomyces cerevisiae (S. cerevisiae) cell. Docket No.10034-324WO1 In some aspects, disclosed herein is a method for high throughput simultaneous transcriptional activation and transcriptional repression of target genes within a cell, comprising: introducing a multi-sgRNA cassette comprising two to six target gene sgRNAs in the cell, wherein each target gene sgRNA comprises a bacteriophage aptamer, wherein each of the two to six target gene sgRNAs is flanked by a Pol III promoter; and co-expressing a catalytically inactive nuclease with a transcriptional activator or a transcriptional repressor and an RNA binding protein, wherein the multi-sgRNA cassette controls the simultaneous transcriptional activation and transcriptional repression of two to six target genes in the cell. In some embodiments, the Pol III promoter comprises SNR52, RPR1, or ZOD1. In some embodiments, the catalytically inactive nuclease is a deactivated Cas protein (dCas). In some embodiments, the deactivated Cas protein is a dCas9 or a dCas12. In some embodiments, the RNA binding protein comprises MS2 phage coat protein (MCP) or PP7 phage coat protein (PCP). In some embodiments, the bacteriophage aptamer comprises MS2 stem loop or PP7 stem loop. In some embodiments, the transcriptional activator is a VPR protein. In some embodiments, the transcriptional repressor is a MXI1protein. In some embodiments, the cell comprises a eukaryotic cell. In some embodiments, the eukaryotic cell is a Saccharomyces cerevisiae (S. cerevisiae) cell. In some aspects, disclosed herein is a biosensor for controlled expression of multi- sgRNA cassette within a cell, comprising: a cell for determining gene regulation; a multi- sgRNA cassette comprising two to six target gene sgRNAs; a transcriptional effector protein; an inducer to transcriptional effector protein; an expression vector; and a transcriptional activator or a transcriptional repressor with RNA binding proteins bound to dCas9. In some embodiments, the transcriptional activator is a VPR protein. In some embodiments, the transcriptional repressor is a MXI1protein. In some embodiments, each target gene sgRNA comprises a bacteriophage aptamer, In some embodiments, each of the two to six target gene sgRNAs is flanked by a Pol III promoter, Docket No.10034-324WO1 In some embodiments, the Pol III promoter is engineered with a DNA binding site In some embodiments, the Pol III promoters comprise SNR52, RPR1, or ZOD1. In some embodiments, the DNA binding site is Ben O gene site. In some embodiments, the transcriptional effector protein is Ben M. In some embodiments, the inducer to the transcriptional effector protein is a cis,cis- muconic acid (CCM). In some embodiments, the RNA binding proteins comprise MS2 phage coat protein (MCP) or PP7 phage coat protein (PCP). In some embodiments, the Pol III promoter further comprise TATA box- RNA Pol III binding region, TFIIIB protein binding region; and TFIIIC protein binding region. In some aspects, disclosed herein is a method for controlled expression of multi- sgRNA cassette within a cell, comprising: introducing two to six target gene sgRNAs in two to six base vectors; assembling the two to six base vectors using overlap-extension PCR (OE- PCR) into a multi-sgRNA cassette; inserting the multi-sgRNA cassette in an expression vector; expressing the multi-sgRNA cassette in the cell; blocking the DNA binding site of the Pol III promoter with a transcriptional effector protein; co-expressing the multi-sgRNA cassette with a transcriptional activator or a transcriptional repressor with RNA binding proteins bound to dCas9 in the cell. In some embodiments, the transcriptional activator is a VPR protein. In some embodiments, the transcriptional repressor is a MXI1protein. In some embodiments, the two to six target gene sgRNAs comprises at least two MS2 aptamers or at least two PP7 aptamers. In some embodiments, each target gene sgRNA in the multi-sgRNA cassette is flanked by a Pol III promoter. In some embodiments, the Pol III promoter is engineered with a DNA binding site. In some embodiments, the transcriptional effector protein blocks the DNA binding site in presence of a stressor, thereby regulating sgRNA targeted gene. In some embodiments, the Pol III promoter further comprise TATA box- RNA Pol III binding region, TFIIIB protein binding region; and TFIIIC protein binding region. In some embodiments, the transcriptional effector protein is Ben M or LysR-type. In some embodiments, the stressor to the transcriptional effector protein comprises fdeR, naringenin, cis,cis-muconic acid, or reactive oxygen species. In some embodiments, the Pol III promoters comprise SNR52, RPR1, or ZOD1. Docket No.10034-324WO1 In some embodiments, the RNA binding proteins comprise MS2 phage coat protein (MCP) or PP7 phage coat protein (PCP). BRIEF DESCRIPTION OF FIGURES The accompanying figures, which are incorporated in and constitute a part of this specification, illustrate several aspects described below. FIGS. 1A, 1B, 1C, 1D, 1E, and 1F show the different modes of gene manipulation with CRISPR / (d)Cas9 technology. FIG. 1A: CRISPR associated proteins and sgRNA scaffolds. FIG. 1B: Cas9 complexed to a sgRNA (black) targeting DNA next to a PAM site and cleaving the promoter of the targeted gene. FIG. 1C: Transcriptional activation of a targeted gene by dCas9-VPR and a sgRNA scaffold. FIG. 1D: Transcriptional repression of a targeted gene by dCas9-MXI1 and a sgRNA scaffold. FIG. 1E: Transcriptional activation of a targeted gene by dCas9 and a sgRNA (black) with a MS2 aptamer (blue) that has high specificity for the RNA binding protein, MCP bound by VPR. FIG. 1F: Transcriptional repression of a targeted gene by dCas9 and sgRNA (black) with a PP7 aptamer (orange) that has high specificity for the RNA binding protein, PCP bound by MXI1. FIGS. 2A, 2B, 2C and 2D show the Saccharomyces cerevisiae (BY4742) engineered to express CRISPR-associated proteins and fluorescent proteins. FIG. 2A: dCas9 and the tethered MXI1 transcription factor were regulated by an inducible pGAL1 promoter. The fluorescent reporters GFP, mTagBFP, and RUBY were under the control of constitutive pTDH3, pPGK, and pTEF, respectively. FIG. 2B: dCas9-MXI was driven by constitutive pTDH3. The two fluorescent reporters GFP and mTagBFP were also under the control of constitutive pagTEF (strong) and pHTA (weak), respectively. FIG. 2C: The fluorescent reporters in this strain are driven by the same promoters in strain FIG. 2B, with the difference being a change in the transcriptional regulator (VPR) tethered to dCas9. FIG. 2D: The fluorescent reporters are expressed in the same manner as in yeast strains FIG. 2B and FIG. 2C, with RNA-binding proteins connected to transcriptional regulators (pPGK-PCP-MXI1 and pTEF-MCP-VPR) under constitutive promoters. FIG. 3 shows the tRNA processing to generate functional sgRNAs. 3X multi-sgRNA array (promoter = black; sgRNA 1,2, and 3 = red, purple, and green, respectively; tRNA 1 = white / pink; tRNA 2 = white / orange; terminator = red) is interspaced by tRNAs ( RNA Pol III promoters) that are cleaved on their leading sequence by RNase P (brown) and lagging sequence by RNase Z (gray) to separate each sgRNA. Now, these functional sgRNAs can target three genes. Docket No.10034-324WO1 FIGS. 4A, 4B, 4C and 4D show the creation of tri-sgRNA cassettes with OE-PCR and tRNAs: OE-PCR overview. FIG. 4A: Base vectors with a replaceable dummy region serve as template for PCR amplification. Each base vector contains a sgRNA flanked by a promoter and tRNA (pUC19a), two tRNAs (pUC19b), or a tRNA and terminator (pUC19c). Fragments amplified from pUC19a and pUC19c contain approximately 1500bp upstream or down- stream priming regions. During OE-PCR assembly of promoter-sgRNA-tRNA-sgRNA- tRNA-sgRNA-terminator cassettes, tRNAs act as overlap regions for the initial primer-less PCR assembly step, and then a second PCR with primers that anneal to regions in the initial left and right fragments can amplify the assembled cassette. FIG. 4B: Libraries of sgRNA (brown, purple, and teal) can be inserted into base vectors. FIG. 4C: Amplification of the fragments from the base plasmid gradually becomes more efficient when the annealing primers are place >1000 (lane 5) away from the repetitive sgRNA elements. FIG. 4D: Pooled assembly of DNA fragments is inserted into yeast-expressible vectors to create combinatorial libraries of multi-sgRNA cassettes. FIGS. 5A, 5B and 5C show the order and sequence homology between tRNAs in multi-targeting sgRNA cassettes; thermal cycler conditions for multiplexing sgRNAs with OE-PCR. FIG. 5A: The platform with tRNAs scaled to allow control of six genes. In the 1X cassette, the SNR52 (yellow) promoter drives the expression of a sgRNA scaffold (white / green), which is followed by a terminator (black). In the 3X and 6X cassettes, pUC19 base vectors have sgRNA scaffolds flanked with tRNA pairs (pink, purple, orange, red, and blue), as well as the first and last vectors with priming regions. FIG. 5B: Five tRNA (brown) sequences were individually aligned to each other to determine the percentage of nucleotide homology, with the lowest homology observed between tRNA Arg and tRNA Gly, and the greatest homology between tRNA Thr and tRNA His. FIG. 5C: The thermal cycler conditions to assemble a 3X cassette (black) involve an initial PCR cycle without primers, with the first reaction serving as the template for the subsequent PCR reaction. In the second PCR reaction, forward (APC 64) and reverse primers (KH 136) are added to the PCR master mix, binding to characterized regions far away from the repetitive scaffold reg ions. The same method and primers are used to make a 6X cassette, with a difference in the annealing temperature and extension time during the initial PCR reaction. The expected fragments for the 3X and 6X cassettes, produced by digesting the second PCR fragment with restriction enzymes, are highlighted in green. FIGS. 6A and 6B show the unmodified and stem loop / aptamer containing sgRNA scaffolds. FIG. 6A: sgRNAs when combined with dCas9-MXI1 perform transcriptional Docket No.10034-324WO1 repression of the gene of interest (blue). FIG. 6B: PP7 (or MS2) aptamers can be inserted into sgRNA scaffolds. When dCas9 is co-expressed with PCP- MXI1 and MCP-VPR, this system can allow for up and down regulation of gene expression in the same cell. Direct fusion of dCas9 to MXI1 reduces eGFP expression, but the expression is decreased even more when using sgRNA scaffolds with PP7 aptamers to recruit two PCP- MXI1 fusions. FIGS. 7A and 7B show the confirmation of function for 1X, 3X, and 6X-sgRNA expression cassettes. FIG. 7A: In a dCas9-MXI1 expressing strain, 3X multi-sgRNA cassettes with sgRNAs targeting pTDH3 driving eGFP expression, in the 1st , 2nd , and 3rd, were compared to a 3X non-targeting 1 X targeting cassettes. Also, we demonstrated simultaneous repression of three fluorescent proteins: eGFP, RUBY, and mTagBFP, which were regulated by pTDH3 (green), pTEF1 (red), and pPGK1 (blue), respectively. FIG. 7B: A similar characterization schema was used to confirm functional 6X cassettes in the same yeast strain. The 3X and 6X cassettes reduced the fluorescence of all targets simultaneously, as well as each single sgRNA control. FIGS. 8A, 8B and 8C show the evaluating the stability of 1X, 3X and 6X sgRNAs, gauged by their ability repress fluorescent reporters over time. FIG. 8A: On day 1, the 1X and 3X cassettes are effectively repressing all fluorescent reporters. Unfortunately, on this day, the 6X cassettes showed instability in the 4thand 5thpositions. FIG. 8B: On day 7, the 1X cassettes remained stable, but the 1st position in the 3X cassettes started to fail. The same positions in the 6X cassettes remain dysfunctional. FIG. 8C: Again, the 1 X cassettes maintained their repressing potential, whereas the 3X and 6X cassettes showed an increase in positions with poor repression compared to the non-target (NT) controls. The cells were grown for two days in complete supplement media (Leu), and then diluted into fresh media. The change in fluorescent intensities of the cells were analyzed on the FAGS after 1, 7 and 15 days of culturing. The reduction in repression from the multi sgRNAs are hypothesized to occur due to the repetitive sgRNAs in the sgRNA scaffolds, as well as the inability of RNases to effectively cleave the leading and lagging sequences of the tRNAs. FIGS. 9A and 9B show the design flaw with multi-sgRNA consisting of all or multiple variations of aptamers. FIG. 9A: In a yeast strain with dCas9 and MCP-VPR / PCP- MXI1 protein complexes, 3X cassettes were designed with sgRNA scaffolds with all MS2 or PP7 aptamers for simultaneous upregulation or down regulation of fluorescent reporters driven by strong (pagTEG-eGFP) and weak (pHTA-mTagBFP) constitutive promoters. In both designs, all three positions did not active or repress the fluorescent reporter. FIG. 9B: The sgRNAs in the 3X cassette contained "two PP7 and one MS2 aptamer'' or “two MS2 and Docket No.10034-324WO1 one PP7” aptamers in positions 1-3. Results similar to those from the plasmids with all aptamers were observed with this setup, where two out of three positions simultaneously activated or repressed the fluorescent gene of interest. However, it is important to note that in this tRNA setup, with two functional positions in the 3X cassette (PP7-MS2-PP7), we demonstrated simultaneous upregulation and downregulation of proteins in the same cell. Yet, it is ideal to have all working positions. More importantly, the inability of all positions to function in the 3X cassettes with both aptamers is believed to be due to the recruitment of both RNA-binding proteins and RNases, which disrupt each other's functions. FIGS. 10A and 10B show the sizes of single and multi-targeting sgRNA libraries assembled by OE-PCR and ligated into yeast expression backbones. FIG. 10A: DNA fragments with a combination of 20 bp spacer sequences targeting the promoter of fluorescent reporters and genes responsible for increasing yeast resistance to external stressors (hydrogen peroxide and furfural) were treated with restriction enzymes (Hind III and EcoRI) and then ligated into digested yeast expression plasmids. The obtained library sizes in E.coli far exceeded the theoretical value for these 1 X libraries. FIG. 10B: OE-PCR assembled muti-sgRNA fragments with inserted 20bp spacer sequences for different purposes (i.e., CRISPRa, CRISPRi, or both) were ligated into digest yeast expression plasmids (3 insert: 1 backbone). Libraries sizes reached up to 10^6 transformants. The theoretical values were calculated by multiplying the number of sampled sgRNAs by the number of positions (i.e., for the 6X color library= 16^6 possible combinations). This generation of large libraries from multi-sgRNA cassettes is a huge success, given that these extensive combinatorial libraries are assembled in a one-pot reaction. FIGS. 11A, 11B, 11C and 11D show the fluorescence-activated cell sorting (FACS) plots of cells sorted based on changes in their fluorescent intensities, using a library (16 sgRNAs) of 1X, 3X,and 6X cassettes targeting the promoters of fluorescent reporters (pagTEF-eGFP and pHTA-mTagBFP). FIG.11A: Non-target plots of cells in a yeast strain with dcas9-MXI1, or VPR. On the X axis= FITC (GFP); Y axis= SSC (i.e. cell's granularity). Cells with activated or repressed expression are expected to appear in the 'sort grab GFP / BFP’ gates (next to the golden star). FIG. 11B: Cells appear in the “sort grab gate" for both yeast strains because plasmids contain spacers from the 16-gRNA color library that target the promoters driving eGFP and mTagBFP expression. FIG. 11C and FIG. 11D: Sorted the cells for one color after the combinatorial assembly of 3X and 6X multi-sgRNAs that contain spacers from the 16-gRNA color library. The increase in number of cells in both the "sort grab GFP and BFP" gates from 3X to6X could be a result of the increase in number of Docket No.10034-324WO1 sgRNAs targeting the promoters (i.e., 2 sgRNA targeting mTagBFP in the 3X cassettes vs. 2 or more targeting mTagBFP in the 6X cassettes). This hints at the notion that multi-sgRNA cassettes could demonstrate additive activating and repressing efficacy, depending on the number of sgRNAs in the cassettes (3X vs 6X}. >50K cells were collected during the sort and grown in appropriate supplemental media. These plasmids will be extracted and sequenced to determine the identities of the sequences responsible for the observed phenotypes. FIGS. 12A, 12B, 12C and 12D show the fluorescent activated cell sort (FACS) plots of cells sorted based on the simultaneous repression of two fluorescent reporters (pTDH3- eGFP and pPGK1-mTagBFP) by a library (16 sgRNAs) of 3X and 6X multi-targeting sgRNAs. FIG. 12A: Non-target plots of cells in a yeast strain with dcas9-MXI1. On the X axis a FITC (eGFP); Y axis an SSC (i.e., cell's granularity). Ideally, the 'sort grab GFP' gate should contain no cells. However, if cells appear in that gate, they will be found in the population next to the gold star (mTagBFP positive cells of the repressed eGFP cells). Nonetheless, these cells seem to be dead due to low SSC values. FIG. 12B: Since 1X (pink) cassettes are incapable of targeting more than one color per cell, few cells show up in the "sort grab GFP" gate (pink label). FIG. 12C-D: Sorted the cells for two colors a Her the combinatorial assembly of 3X (orange label) and 6X (purple label) multi-sgRNAs that contain spacers from the 16-gRNA color library. The increase in number of cells in both "sort grab GFP" (pink) gates from 3X to 6X could be a result of the increase in number of sgRNAs targeting the promoters (i.e., 2sgRNA targeting mTagBFP in the 3X cassettes vs. 2 or more in the 6X cassettes). Overall, it is shown that the platform, after the combinatorial assembly of multi-targeting sgRNAs, transcriptionally repressed two colors in one cell >50K cells were collected during the sort and grown in appropriate supplemental media. More importantly, these plasmids are extracted and sequenced to determine the identities of the sequences responsible for the observed phenotypes. FIGS. 13A, 13B and 13C show the order and sequence homology between Pol III promoters in multi-targeting sgRNA cassettes; thermal cycler conditions for multiplexing sgRNAs with OE-PCR (promoters replaced tRNAs). FIG. 13A: The platform with Pol III promoters scaled to allow control of six genes. In the 1X cassette, the SNR52 (yellow) promoter drives the expression of an sgRNA scaffold (white / green) that is followed by a terminator (black). In the 2X, 4X, and 6X cassettes, pUC19 base vectors have sgRNA scaffolds flanked with Pol III promoter pairs (pink, purple, orange, red, and blue), as well as the first and last vectors with priming regions. FIG. 13B: Sequences of Pol III promoters from different yeast species (blue and purple) were individually aligned to each other to Docket No.10034-324WO1 determine the percent homology between the nucleotides, with no pairs achieving a percent homology greater than 40%. Low sequence homology between the Pol III promoters is advantageous for stability characterization studies. FIG. 13C: The thermal cycler conditions to assemble a 2X cassette (orange) involve a first PCR cycler with no primers. With the first reaction serving as the template for the subsequent PCR reaction, forward (APC 64) and reverse (KH 136) primers are added to the PCR master mix, binding to characterized regions far away from the repetitive scaffold regions. The same method and primers are used to make 4X (purple) and 6X (red) cassettes, with decreased annealing times in the initial PCR and longer extension times for both 1stand 2ndPCR reactions. The expected fragments for 2X, 4X and 6X cassettes produced from digesting the second PCR fragment with restriction enzymes are highlighted in green. FIG. 14 shows the promoter characterization measured by dCas9-VPR transcriptional activation. Characterization of low-homology promoters from Saccharomyces cerevisiae (SC-yellow), Yarrowia lipolytica (YL-brown), Ashbya gossypii (AG-purple), Candida albicans (CA-red), and Kluyveromyces lactis (KL-orange) involved the transformation of single-targeting sgRNAs (promoter-sgRNA-terminator) transcribed by different Pol III promoters into a yeast strain expressing dCas9-VPR. This activation led to increased expression of mTagBFP, regulated by a weak Pol II promoter (pHTA). Green arrows points to the promoters used in single and multi-sgRNA cassettes. Non-targeting sgRNA=control. FIGS. 15A, 15B, 15C and 15D show the promoter characterization gauged by dCas9- VPR / MCP-VPR transcriptional activation and dCas9-MXI1 / PCP-MXI1 transcriptional repression. FIG. 15A: Characterization of low homology Pol III promoters SNR52 (CA-red, KL-green, YL-gray, SC-brown), ZOD1 (SC-burgundy), and RPR1 (KL-blue, SC-pink, YL- beige) involved the transformation of single-targeting sgRNAs (promoter-sgRNA-terminator) engineered with 20bp spacers (HTA A, B, and C) that targeted three different regions of the weak Pol II HTA promoter into a yeast strain expressing dCas9-VPR for one mode transcriptional activation. FIG. 15B: The same Pol III promoters were engineered with 20 bp spacers (agTEF E, F, and G) that targeted three different regions of a strong Pol II agTEF promoter, and then transformed into a yeast strain expressing dCas9-VPR for one mode of transcriptional repression. FIG. 15C and FIG. 15D: The single-targeting sgRNA scaffolds included MS2 or PP7 aptamers, targeting the same promoter regions in the weak HTA and strong agTEF promoters. The single targeting sgRNAs were transformed into a yeast strain expressing dCas9 and protein complexes that include RNA binding proteins attached to a transcriptional effector protein (MCP-VPR and PCP-MXI1). The addition of two aptamers to Docket No.10034-324WO1 the sgRNA scaffold significantly improved transcriptional activation and repression of the fluorescent reporters than the single-targeting sgRNAs that were transformed into the yeast strains with the transcriptional effort proteins tethered to dCas9 (FIG. 15A-B). Non targeting sgRNAs= control. FIGS. 16A, 16B, 16C and 16D show the characterization of single-and multi - targeting sgRNA cassettes, assessed through dCas9-VPR transcriptional activation. Transcriptional activation of mTagBFP fluorescent protein was mediated by single (FIG. 16A), 2X (FIG. 16B), 4X (FIG. 16C). and 6X (FIG. 16D) targeting sgRNAs complexed to dCas9-VPR. The order of the promoters in the multi-sgRNAs cassettes is the same as they are listed in the 1X targeting graph (FIG. 16A). For example, in 2X cassette the order of the promoter goes as follows: (1stposition: SC-SNR52, 2ndposition: SC-RPR1). Each position of the multi-targeting sgRNA cassettes demonstrated successful activation of mTagBFP, with the last position showing the least efficiency. NT=non-target; control. FIG. 17 shows the characterization of multi-targeting sgRNA cassettes with Pol III promoter as the overlapping regions and all PP7 / MS2 aptamers in the scaffolds. Single and multi-targeting sgRNAs with the order of the promoters as follows: (1stposition: SC-SNR52, 2ndposition: SC-RPR1, 3rdposition: YL-SNR52, 4thposition: SC-ZOD1) were transformed into a yeast strain with dCas9, MCP-VPR, and PCP-MXI1. The single-targeting plasmids, when driven by the SC-SNR52 and RPR1 promoters, significantly activated or repressed mTagBFP or eGFP reporters, respectively. On the other hand, the sgRNAs driven by YL- SNR53 and SC-ZOD1 were only efficient at activating the weak mTagBFP expression and not repressing the strong eGFP signal. The same behavior can be observed in the multi- sgRNA cassettes with four Pol III promoters. In the cassette with all PP7 aptamers, the first two positions significantly reduced the eGFP expression, but the same can not be deduced for the last two positions. Additionally, in the cassette with all MS2 aptamers, all positions activated the expression of the weak mTagBFP reporter, which suggested that the 3rdposition: YL-SNR52 and 4thposition: SC-ZOD1 Pol III promoters are capable of transcriptional activation but not repression the strong eGFP signal when multiplexed. NT=non-target; control. FIGS. 18A and 18B show the simultaneous activation and repression of fluorescent reporters in a cell transformed with 2X and 4X multitargeting cassettes assemble via OE- PCR. FIG. 18A: Single targeting and 2X (1stposition: SC-SNR52, 2ndposition: SC-RPR1) multi-targeting cassettes were transformed into a yeast strain with dCas9-MCP-VPR / PCP- MXI1. The position ofthe aptamers in the 2X cassettes were switch in both configurations to Docket No.10034-324WO1 determine if placement matters for transcriptional activation and repression. In the 2X cassettes, the position of the aptamers did not matter as there were significant activation and repression of the two fluorescent reporters when compared to the 1 X cassettes and NT control. FIG. 18B: In the 4X cassettes the optimal positioning of the aptamers in the sgRNA scaffold went as follows: 1st: PP7, 2nd: PP7, 3rd: MS2, 4th: MS2. This setup allowed for significant activation and repression of the mTagBFP and eGFP from all four positions when compared to the 1X cassettes and NT control. In the 4X cassettes. sgRNAs from 1stand 3rdpositions achieved 64% repression and 3X activation of the reporters, respectively. Additionally, sgRNAs from 2ndand 4thpositions achieved 50% repression and 2X activation of the reporters, respectively. This data demonstrates that the platform is capable of simultaneously activating and repressing multiple genes in a cell at one time using multi- targeting sgRNAs assembled by OE-PCR paving the way for future high-throughput combinatorial gene perturbation studies. FIGS. 19A and 19B evaluate the stability of 1X, 2X and 4X sgRNAs, gauged by their ability individually or simultaneously activated / repress fluorescent reporters over time. FIG. 19A: On day 1, the 1X and 2X cassettes are effectively repressing and activating both fluorescent reporters. Fortunately, this trends over the 31-days of growing and running the yeast cells on the FACS. FIG. 19B: The 1X and 4X cassettes remained stable for 31 days, representing a significant improvement in stability compared to the multi-targeting cassettes in the tRNA setup. This could be due to the exclusion of tRNA processing and the independent recognition of each Pol III promoter by the RNA polymerase, which allows for the production of immediately active sgRNAs. The cells were grown for two days in complete supplement media (Leu), and then diluted into fresh media. The change in fluorescent intensities of the cells were analyzed on the FAGS after 1, 7 , 15, and 31 days of culturing. FIGS. 20A, 20B and 20C show the fluorescent activated cell sort (FACS) plots of cells sorted based on the simultaneous activation and repression of two fluorescent reporters (pagTEF-eGFP and pHTA-mTagBFP) by a library (16sgRNAs) of 2X, and 6X multi- targeting sgRNAs. FIG. 20A: Non-target and single-targeting plots of cells in a yeast strain with dcas9-MCP / VPR-PCP / MXI1. FIGS. 20B and 20C: Cells were sorted for two colors after the combinatorial assembly of 2X and 4X multi-sgRNAs that contain spacers from the 16-gRNA color library. The decrease in number of cells in "sort grab GFP" (pink) gates from 2X to 4X could be due to the weak activation potential of the last two Pol III promoters. Based on data from our Pol III promoter characterization study, the last two promoters in the Docket No.10034-324WO1 4X cassette are capable of transcriptional activation, but not to the same degree as the SC- SNR52 and RPR1 Pol III promoters. Overall, it is demonstrated that the platform, after the combinatorial assembly of multi-targeting sgRNAs, can simultaneously activate and repress two colors in one cell >50K cells were collected during the sort and grown in appropriate supplemental media. More importantly, these plasmids will be extracted and sequenced to determine the identity of the sequences responsible for the observed phenotypes. FIGS. 21A, 21B and 21C show the expressing crRNA and tracrRNA of a native sgRNA scaffold on separate yeast expression plasmids. FIG. 21A: Yeast expression plasmids with the configurations: PY122-Pol III Promoter-spacer(crRNA)-terminator and PY128-Pol III promoter-tracRNA-terminator were co-transformed into two separate yeast strains expression dCas9-VPR or dCas9-MCP / VPR-PCP / MXI1. Both yeast strains were engineered to express mTagBFP under the weak HTA Pot II promoter. FIGS. 21B-21C: In both yeast strains, the two co-transformed plasmids successfully activated the mTagBFP expression compared to the NT controls. This setup, which involves splitting and expressing the components of the sgRNA scaffold (crRNA and tracrRNA) allows for a reduction in the repetitive sgRNA scaffold in potential OE-PCR assembled multi-sgRNA cassettes. Separating the crRNA (express on plasmid) and tracrRNA (integrate into the genome) could improve the stability of the multi-targeting plasmids in the tRNA setup by ridding them of repetitive DNA elements (i.e., tracrRNA with and without aptamers). crRNA=CRISPR RNA; tracrRNA=trans activating CRISPR RNA; NT=non-target control. FIGS. 22A and 22B show yeast as a system to study resistance. FIG. 22A: Exogenous ROS stress. Exposure to increasing concentrations of hydrogen peroxide resulted in yeast death. FIG. 22B: Positive control-cell death caused by hydrogen peroxide was reduced in Ras2 deletion strain. FIGS. 23A and 23B show the engineering Pol III promoters with transcriptional regulators as switches for activation or repression of targeted genes regulated by Pol II promoters with CRISPR technology. FIG. 23A: A schematic of the native SNR52 (black / gold) and its key characterized DNA elements which are recognized by proteins in the cellular environment for the transcription of downstream DNA into mRNA. The TATA box (purple) is a promoter sequence recognized by the RNA Pol III. Also, box A (orange) and box B (blue) elements are necessary for transcription because other protein complexes such as TFIIIB and TFIIIC bind to these regions in addition to RNA Pol III (gray, white) binding. FIG. 23B: The setup involves an engineered SNR52 promoter designed to express DNA- binding site(s) (BenO, red), which, when inserted, enable regulatory transcriptional Docket No.10034-324WO1 perturbation functionality. BenM, a transcriptional effector protein from Acinetobacter sp. ADP1, which responds to and changes conformation in the presence of its cognate inducer, cis, cis-muconic acid (CCM), binds to the BenO site(s) in the SNR52 promoters. This binding interferes with RNA Pol III, TFIIIB, and TFIIIC binding, thereby affecting subsequent DNA transcription. Single or multiple BenO recognition sites are placed in the promoters to increase the chances of observing significant changes in gene expression based on the presence of the inducer (CCM). This enables a novel biosensor in yeast through the controlled expression of sgRNAs regulated by responsive Pol III promoters. FIG. 23C: Engineered SNR52 promoters with BenO sites placed in different regions (i.e., before the TATA box or transcription start site (orange star)) were transformed into a yeast strain expressing dCas9-MCP / VPR-PCP / MXI1 (No BenM) to determine if the addition of that 73bp recognition sequence disrupts its promoter activity. sgRNA scaffolds contained spacers that targeted weak HTA promoter upstream of the mTagBFP gene for transcriptional activation. Positive (no BenO sites) and non-target controls were included in this experiment as well. FIG. 24 shows the 6X-multi-sgRNA cassettes. Platform was scaled to allow control of six genes. Base vectors (pUCl9a - pUC19f). Vectors pUC19b to pUC19e have sgRNAs flanked by tRNA pairs (yellow, green, red, purple, and blue), and vectors pUCl9a and pUC19f contain priming regions, sgRNA sites, and tRNAs. Similar designs were used for 2X, 4X and 5X cassettes. The tRNAs were replaced with promoters in a design that remained consistent across each plasmid. DETAILED DESCRIPTION The following description of the disclosure is provided as an enabling teaching of the disclosure in its best, currently known embodiment(s). To this end, those skilled in the relevant art will recognize and appreciate that many changes can be made to the various embodiments of the invention described herein, while still obtaining the beneficial results of the present disclosure. It will also be apparent that some of the desired benefits of the present disclosure can be obtained by selecting some of the features of the present disclosure without utilizing other features. Accordingly, those who work in the art will recognize that many modifications and adaptations to the present disclosure are possible and can even be desirable in certain circumstances and are a part of the present disclosure. Thus, the following description is provided as illustrative of the principles of the present disclosure and not in limitation thereof. Docket No.10034-324WO1 Reference will now be made in detail to the embodiments of the invention, examples of which are illustrated in the drawings and the examples. This invention may, however, be embodied in many different forms and should not be construed as limited to the embodiments set forth herein. Terminology Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood to one of ordinary skill in the art to which this disclosure belongs. The term “comprising” and variations thereof as used herein is used synonymously with the term “including” and variations thereof and are open, non-limiting terms. Although the terms “comprising” and “including” have been used herein to describe various embodiments, the terms “consisting essentially of” and “consisting of” can be used in place of “comprising” and “including” to provide for more specific embodiments and are also disclosed. As used in this disclosure and in the appended claims, the singular forms “a”, “an”, “the”, include plural referents unless the context clearly dictates otherwise. The following definitions are provided for the full understanding of terms used in this specification. Ranges can be expressed herein as from “about” one particular value, and / or to “about” another particular value. When such a range is expressed, another embodiment includes from the one particular value and / or to the other particular value. Similarly, when values are expressed as approximations, by use of the antecedent “about,” it will be understood that the particular value forms another embodiment. It will be further understood that the endpoints of each of the ranges are significant both in relation to the other endpoint, and independently of the other endpoint. It is also understood that there are a number of values disclosed herein, and that each value is also herein disclosed as “about” that particular value in addition to the value itself. For example, if the value “10” is disclosed, then “about 10” is also disclosed. It is also understood that when a value is disclosed that “less than or equal to” the value, “greater than or equal to the value” and possible ranges between values are also disclosed, as appropriately understood by the skilled artisan. For example, if the value “10” is disclosed the “less than or equal to 10”as well as “greater than or equal to 10” is also disclosed. It is also understood that throughout the application, data is provided in a number of different formats, and that this data, represents endpoints and starting points, and ranges for any combination of the data points. For example, if a particular data point “10” and a particular data point 15 are disclosed, it is understood that greater than, greater than or equal to, less than, less than or equal to, and equal to 10 and 15 are considered disclosed as Docket No.10034-324WO1 well as between 10 and 15. It is also understood that each unit between two particular units are also disclosed. For example, if 10 and 15 are disclosed, then 11, 12, 13, and 14 are also disclosed. “Optional” or “optionally” means that the subsequently described event or circumstance may or may not occur, and that the description includes instances where said event or circumstance occurs and instances where it does not. An "increase" can refer to any change that results in a greater amount of a symptom, disease, composition, condition, or activity. An increase can be any individual, median, or average increase in a condition, symptom, activity, composition in a statistically significant amount. Thus, the increase can be a 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100%, or more, increase so long as the increase is statistically significant. A "decrease" can refer to any change that results in a smaller amount of a symptom, disease, composition, condition, or activity. A substance is also understood to decrease the genetic output of a gene when the genetic output of the gene product with the substance is less relative to the output of the gene product without the substance. Also, for example, a decrease can be a change in the symptoms of a disorder such that the symptoms are less than previously observed. A decrease can be any individual, median, or average decrease in a condition, symptom, activity, composition in a statistically significant amount. Thus, the decrease can be a 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100% decrease so long as the decrease is statistically significant. "Inhibit," "inhibiting," and "inhibition" mean to decrease an activity, response, condition, disease, or other biological parameter. This can include but is not limited to the complete ablation of the activity, response, condition, or disease. This may also include, for example, a 10% reduction in the activity, response, condition, or disease as compared to the native or control level. Thus, the reduction can be a 10, 20, 30, 40, 50, 60, 70, 80, 90, 100%, or any amount of reduction in between as compared to native or control levels. By “reduce” or other forms of the word, such as “reducing” or “reduction,” means lowering of an event or characteristic (e.g., gene expression). It is understood that this is typically in relation to some standard or expected value, in other words it is relative, but that it is not always necessary for the standard or relative value to be referred to. For example, “reduces gene expression” means reducing or lowering the production of a gene product relative to a standard or a control. Docket No.10034-324WO1 The terms “treat,” “treating,” and grammatical variations thereof as used herein, include partially or completely delaying, alleviating, mitigating or reducing the intensity of one or more attendant symptoms of a disorder or condition and / or alleviating, mitigating or impeding one or more causes of a disorder or condition. Treatments according to the disclosure may be applied preventively, prophylactically, palliatively or remedially. Treatments are administered to a subject prior to onset (e.g., before obvious signs of disease), during early onset (e.g., upon initial signs and symptoms of disease), or after an established development of disease. By “prevent” or other forms of the word, such as “preventing” or “prevention,” is meant to stop a particular event or characteristic, to stabilize or delay the development or progression of a particular event or characteristic, or to minimize the chances that a particular event or characteristic will occur. Prevent does not require comparison to a control as it is typically more absolute than, for example, reduce. As used herein, something could be reduced but not prevented, but something that is reduced could also be prevented. Likewise, something could be prevented but not reduced, but something that is prevented could also be reduced. It is understood that where reduce or prevent are used, unless specifically indicated otherwise, the use of the other word is also expressly disclosed. As used herein, “enhance”, “enhanced”, “enhancement”, “enhancing”, and any grammatical variations thereof as used herein, refers to an act of intensifying, increasing, or further improving the quality, value, or extent of a biological function, composition, compound, cell, or tissue. The term “subject” refers to any individual who is the target of administration or treatment. The subject can be a vertebrate, for example, a mammal. In one aspect, the subject can be human, non-human primate, bovine, equine, porcine, canine, or feline. The subject can also be a guinea pig, rat, hamster, rabbit, mouse, or mole. Thus, the subject can be a human or veterinary patient. The term “patient” refers to a subject under the treatment of a clinician, e.g., physician. “Composition” refers to any agent that has a beneficial biological effect. Beneficial biological effects include both therapeutic effects, e.g., treatment of a disorder or other undesirable physiological condition, and prophylactic effects, e.g., prevention of a disorder or other undesirable physiological condition. The terms also encompass pharmaceutically acceptable, pharmacologically active derivatives of beneficial agents specifically mentioned herein, including, but not limited to, a vector, polynucleotide, cells, salts, esters, amides, reagents, active metabolites, isomers, fragments, analogs, and the like. Docket No.10034-324WO1 When the term “composition” is used, then, or when a particular composition is specifically identified, it is to be understood that the term includes the composition per se as well as pharmaceutically acceptable, pharmacologically active vector, polynucleotide, salts, esters, amides, reagents, conjugates, active metabolites, isomers, fragments, analogs, etc. "Comprising" is intended to mean that the compositions, methods, etc. include the recited elements, but do not exclude others. "Consisting essentially of'' when used to define compositions and methods, shall mean including the recited elements, but excluding other elements of any essential significance to the combination. Thus, a composition consisting essentially of the elements as defined herein would not exclude trace contaminants from the isolation and purification method and pharmaceutically acceptable carriers, such as phosphate buffered saline, preservatives, and the like. "Consisting of'' shall mean excluding more than trace elements of other ingredients and substantial method steps for administering the compositions provided and / or claimed in this disclosure. Embodiments defined by each of these transition terms are within the scope of this disclosure. Reference also is made herein to peptides, polypeptides, proteins, and compositions comprising peptides, polypeptides, and proteins. As used herein, a polypeptide and / or protein is defined as a polymer of amino acids, typically of length≥100 amino acids (Garrett & Grisham, Biochemistry, 2nd edition, 1999, Brooks / Cole, 110). A peptide is defined as a short polymer of amino acids, of a length typically of 20 or less amino acids, and more typically of a length of 12 or less amino acids (Garrett & Grisham, Biochemistry, 2nd edition, 1999, Brooks / Cole, 110). The peptides, polypeptides, and proteins disclosed herein may be modified to include mutations or non-amino acid moieties. Modifications may include but are not limited to carboxylation, PEGylation (e.g., N-terminal or C-terminal PEGylation via additional of polyethylene glycol), acylation (e.g., O-acylation (esters), N-acylation (amides), S-acylation (thioesters)), acetylation (e.g., the addition of an acetyl group, either at the N-terminus of the protein or at lysine residues), formylation lipoylation (e.g., attachment of a lipoate, a C8 functional group), myristoylation (e.g., attachment of myristate, a C14 saturated acid), palmitoylation (e.g., attachment of palmitate, a C16 saturated acid), alkylation (e.g., the addition of an alkyl group, such as an methyl at a lysine or arginine residue), isoprenylation or prenylation (e.g., the addition of an isoprenoid group such as farnesol or geranylgeraniol), glycosylation (e.g., the addition of a glycosyl group to either asparagine, hydroxylysine, serine, or threonine, resulting in a glycoprotein). The phrases “percent identity” and “% identity,” as applied to polypeptide sequences, Docket No.10034-324WO1 refer to the percentage of residue matches between at least two polypeptide sequences aligned using a standardized algorithm. Methods of polypeptide sequence alignment are well-known. Some alignment methods consider conservative amino acid substitutions. Such conservative substitutions generally preserve the charge and hydrophobicity at the site of substitution, thus preserving the structure (and therefore function) of the polypeptide. Percent identity for amino acid sequences may be determined as understood in the art. (See, e.g., U.S. Pat. No. 7,396,664, which is incorporated herein by reference in its entirety). A suite of commonly used and freely available sequence comparison algorithms is provided by the National Center for Biotechnology Information (NCBI) Basic Local Alignment Search Tool (BLAST) (Altschul, S. F. et al. (1990) J. Mol. Biol. 215:403410), which is available from several sources, including the NCBI, Bethesda, Md., at its website. The BLAST software suite includes various sequence analysis programs including “blastp,” that is used to align a known amino acid sequence with other amino acids sequences from a variety of databases. Percent identity may be measured over the length of an entire defined polypeptide sequence or may be measured over a shorter length, for example, over the length of a fragment taken from a larger, defined polypeptide sequence, for instance, a fragment of at least 15, at least 20, at least 30, at least 40, at least 50, at least 70 or at least 150 contiguous residues. Such lengths are exemplary only, and it is understood that any fragment length may be used to describe a length over which percentage identity may be measured. Fusion proteins and fusion polynucleotides are also contemplated herein. A “fusion protein” refers to a protein formed by the fusion of at least one peptide, polypeptide, protein or variant thereof as disclosed herein to at least one molecule of a heterologous peptide, polypeptide, protein or variant thereof. The heterologous protein(s) may be fused at the N- terminus, the C-terminus, or both termini. A fusion protein comprises at least a fragment or variant of the heterologous protein(s) that are fused with one another, preferably by genetic fusion (i.e., the fusion protein is generated by translation of a nucleic acid in which a polynucleotide encoding all or a portion of a first heterologous protein is joined in-frame with a polynucleotide encoding all or a portion of a second heterologous protein). The heterologous protein(s), once part of the fusion protein, may each be referred to herein as a “portion”, “region” or “moiety” of the fusion protein. A fusion polynucleotide refers to the fusion of the nucleotide sequence of a first polynucleotide to the nucleotide sequence of a second heterologous polynucleotide (e.g., the 3′ end of a first polynucleotide to a 5′ end of the second polynucleotide). Where the first and second polynucleotides encode proteins, the fusion may be such that the encoded proteins are Docket No.10034-324WO1 in-frame and results in a fusion protein. The first and second polynucleotide may be fused such that the first and second polynucleotide are operably linked (e.g., as a promoter and a gene expressed by the promoter as discussed below). The term “variant” means a polypeptide derived from a parent polypeptide by one or more (several) alteration(s), i.e., a substitution, insertion, and / or deletion, at one or more (several) positions. A substitution means a replacement of an amino acid occupying a position with a different amino acid; a deletion means removal of an amino acid occupying a position; and an insertion means adding 1 or more, such as 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10, preferably 1-3 amino acids immediately adjacent an amino acid occupying a position. In relation to substitutions, ‘immediately adjacent’ may be to the N-side (‘upstream’) or C-side (‘downstream’) of the amino acid occupying a position (‘the named amino acid’). Therefore, for an amino acid named / numbered ‘X,’ the insertion may be at position ‘X+1’ (‘downstream’) or at position ‘X−1’ (‘upstream’). A “variant” of a particular polypeptide sequence may be defined as a polypeptide sequence having at least 50% sequence identity to the particular polypeptide sequence over a certain length of one of the polypeptide sequences using blastp with the “BLAST 2 Sequences” tool available at the National Center for Biotechnology Information's website. (See Tatiana A. Tatusova, Thomas L. Madden (1999), “Blast 2 sequences—a new tool for comparing protein and nucleotide sequences”, FEMS Microbiol Lett. 174:247-250). In some embodiments a variant polypeptide may show, for example, at least 60%, at least 70%, at least 80%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% or greater sequence identity over a certain defined length relative to a reference polypeptide. A variant polypeptide may have substantially the same functional activity as a reference polypeptide. For example, a variant polypeptide may exhibit one or more biological activities associated with binding a ligand and / or binding DNA at a specific binding site. A “nucleotide” is a compound consisting of a nucleoside, which consists of a nitrogenous base and a 5-carbon sugar, linked to a phosphate group forming the basic structural unit of nucleic acids, such as DNA or RNA. The four types of DNA nucleotides are adenine (A), cytosine (C), guanine (G), and thymine (T), each of which are bound together by a phosphodiester bond to form a nucleic acid molecule. A “nucleic acid” is a chemical compound that serves as the primary information- carrying molecules in cells and make up the cellular genetic material. Nucleic acids comprise nucleotides, which are the monomers made of a 5-carbon sugar (usually ribose or Docket No.10034-324WO1 deoxyribose), a phosphate group, and a nitrogenous base. A nucleic acid can also be a deoxyribonucleic acid (DNA) or a ribonucleic acid (RNA). A chimeric nucleic acid comprises two or more of the same kind of nucleic acid fused together to form one compound comprising genetic material. The terms “percent identity” and “% identity,” as applied to polynucleotide sequences, refer to the percentage of residue matches between at least two polynucleotide sequences aligned using a standardized algorithm. Such an algorithm may insert, in a standardized and reproducible way, gaps in the sequences being compared in order to optimize alignment between two sequences, and therefore achieve a more meaningful comparison of the two sequences. Percent identity for a nucleic acid sequence may be determined as understood in the art. (See, e.g., U.S. Pat. No. 7,396,664, which is incorporated herein by reference in its entirety). A suite of commonly used and freely available sequence comparison algorithms is provided by the National Center for Biotechnology Information (NCBI) Basic Local Alignment Search Tool (BLAST) (Altschul, S. F. et al. (1990) J. Mol. Biol. 215:403410), which is available from several sources, including the NCBI, Bethesda, Md., at its website. The BLAST software suite includes various sequence analysis programs including “blastn,” that is used to align a known polynucleotide sequence with other polynucleotide sequences from a variety of databases. Also available is a tool called “BLAST 2 Sequences” that is used for direct pairwise comparison of two nucleotide sequences. “BLAST 2 Sequences” can be accessed and used interactively at the NCBI website. The “BLAST 2 Sequences” tool can be used for both blastn and blastp (discussed above). Percent identity may be measured over the length of an entire defined polynucleotide sequence or may be measured over a shorter length, for example, over the length of a fragment taken from a larger, defined sequence, for instance, a fragment of at least 20, at least 30, at least 40, at least 50, at least 70, at least 100, or at least 200 contiguous nucleotides. Such lengths are exemplary only, and it is understood that any fragment length may be used to describe a length over which percentage identity may be measured. A “full length” polynucleotide sequence is one containing at least a translation initiation codon (e.g., methionine) followed by an open reading frame and a translation termination codon. A “full length” polynucleotide sequence encodes a “full length” polypeptide sequence. A “variant,” “mutant,” or “derivative” of a particular nucleic acid sequence may be defined as a nucleic acid sequence having at least 50% sequence identity to the particular nucleic acid sequence over a certain length of one of the nucleic acid sequences using blastn Docket No.10034-324WO1 with the “BLAST 2 Sequences” tool available at the National Center for Biotechnology Information's website. (See Tatiana A. Tatusova, Thomas L. Madden (1999), “Blast 2 sequences—a new tool for comparing protein and nucleotide sequences”, FEMS Microbiol Lett. 174:247-250). In some embodiments a variant polynucleotide may show, for example, at least 60%, at least 70%, at least 80%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% or greater sequence identity over a certain defined length relative to a reference polynucleotide. A "promoter," as used herein, refers to a sequence in DNA that mediates the initiation of transcription by an RNA polymerase. Transcriptional promoters may comprise one or more of a number of different sequence elements as follows: 1) sequence elements present at the site of transcription initiation; 2) sequence elements present upstream of the transcription initiation site and; 3) sequence elements down- stream of the transcription initiation site. The individual sequence elements function as sites on the DNA, where RNA polymerases and transcription factors facilitate positioning of RNA polymerases on the DNA bind. “Expression” as used herein refers to the process by which information from a gene is used in the synthesis of a functional gene product that enables it to produce a peptide / protein end product, and ultimately affect a phenotype, as the final effect. As used herein, the term “genetically modified” refers to a living cell, tissue, or organism whose genetic material has been altered using genetic engineering techniques. The genetical modification results in an alteration that does not occur naturally by mating and / or natural recombination. Modified genes can be transferred within the same species, across species (creating transgenic organisms), and across kingdoms. New, exogenous genes can be introduced, or endogenous genes can be enhanced, altered, or knocked out. As used herein, the term, “deletion,” also called gene deletion, deficiency, or deletion mutation, refers to part of a chromosome or a sequence of DNA being left out during DNA replication. Deletion, or gene deletions can cause any number of nucleotides to be deleted from a single base to an entire piece of chromosome. Variants comprising deletions relative to a reference amino acid sequence or nucleotide sequence are contemplated herein. A “deletion” refers to a change in the amino acid or nucleotide sequence that results in the absence of one or more amino acid residues or nucleotides relative to a reference sequence. A deletion removes at least 1, 2, 3, 4, 5, 10, 20, 50, 100, or 200 amino acids residues or nucleotides. A deletion may include an internal Docket No.10034-324WO1 deletion or a terminal deletion (e.g., an N-terminal truncation or a C-terminal truncation or both of a reference polypeptide or a 5′-terminal or 3′-terminal truncation or both of a reference polynucleotide). Variants comprising a fragment of a reference amino acid sequence or nucleotide sequence are contemplated herein. A “fragment” is a portion of an amino acid sequence or a nucleotide sequence which is identical in sequence to but shorter in length than the reference sequence. A fragment may comprise up to the entire length of the reference sequence, minus at least one nucleotide / amino acid residue. For example, a fragment may comprise from 5 to 1000 contiguous nucleotides or contiguous amino acid residues of a reference polynucleotide or reference polypeptide, respectively. In some embodiments, a fragment may comprise at least 5, 10, 15, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 40, 50, 60, 70, 80, 90, 100, 150, 250, or 500 contiguous nucleotides or contiguous amino acid residues of a reference polynucleotide or reference polypeptide, respectively. Fragments may be preferentially selected from certain regions of a molecule, for example the N-terminal region and / or the C- terminal region of a polypeptide or the 5′-terminal region and / or the 3′ terminal region of a polynucleotide. The term “at least a fragment” encompasses the full-length polynucleotide or full-length polypeptide. Variants comprising insertions or additions relative to a reference sequence are contemplated herein. The words “insertion” and “addition” refer to changes in an amino acid or nucleotide sequence resulting in the addition of one or more amino acid residues or nucleotides. An insertion or addition may refer to 1, 2, 3, 4, 5, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 150, or 200 amino acid residues or nucleotides. As used herein, a “transcription terminator” or a “terminator” refers to a segment of a nucleic acid sequence that marks the end of gene in genomic DNA during the transcription process, or gene expression. This sequence mediates or signals the end of transcription by providing signaling nucleotides in newly synthesized RNA transcripts that trigger an RNA polymerase to release the DNA and newly synthesized RNA. A “genome” refers to a complete set of genes or genetic material present within a cell, tissue, or organism. A genome can be nuclear (found within the cell nucleus) or mitochondrial (found with the cell mitochondria). As used herein, a “mutation” refers to changing the structure of a gene, resulting in a variant form that may be transmitted to later generations. A mutation is caused by the alteration of single nucleotides in DNA, or the deletion, insertion, or rearrangement of larger Docket No.10034-324WO1 sections of genes. A mutation can lead to the expression of a protein that has been changed physically or functionally leading to lethality, non-lethal dysfunction effects, or no effects. “Recombinant” used in reference to a gene refers herein to a sequence of nucleic acids that are not naturally occurring in the genome of the bacterium. The non-naturally occurring sequence may include a recombination, substitution, deletion, or addition of one or more bases with respect to the nucleic acid sequence originally present in the natural genome of the bacterium. A "vector" is a composition of matter which comprises an isolated nucleic acid and which can be used to deliver the isolated nucleic acid to the interior of a cell. Numerous vectors are known in the art including, but not limited to, linear polynucleotides, polynucleotides associated with ionic or amphiphilic compounds, plasmids, and viruses. Thus, the term "vector" includes an autonomously replicating plasmid or a virus. The term should also be construed to include non-plasmid and non-viral compounds which facilitate transfer of nucleic acid into cells, such as, for example, polylysine compounds, liposomes, and the like. Examples of viral vectors include, but are not limited to, adenoviral vectors, adeno-associated virus vectors, retroviral vectors, and the like. “CRISPR” (Clustered Regularly Interspaced Short Palindromic Repeats) loci refers to certain genetic loci encoding components of DNA cleavage systems, for example, used by bacterial and archaeal cells to destroy foreign DNA (Horvath and Barrangou, 2010, Science 327: 167-170; W02007025097, published 01 March 2007). A CRISPR locus can consist of a CRISPR array, comprising short direct repeats (CRISPR repeats) separated by short variable DNA sequences (called spacers), which can be flanked by diverse Cas (CRISPR-associated) genes. As used herein, an “effector” or “effector protein” is a protein that encompasses an activity including recognizing, binding to, and / or cleaving or nicking a polynucleotide target. An effector, or effector protein, may also be an endonuclease. The “effector complex” of a CRISPR system includes Cas proteins involved in crRNA and target recognition and binding. Some of the component Cas proteins may additionally comprise domains involved in target polynucleotide cleavage. A nuclease is an enzyme capable of cleaving the phosphodiester bonds between nucleotides of nucleic acids. Nuclease can possess properties to cause double or single stranded breaks to target nucleic acids. Nucleases are commonly used in CRISPR technology to modify a host genome to express or inhibit a target gene. Docket No.10034-324WO1 The term “Cas protein” refers to a polypeptide encoded by a Cas (CRISPR- associated) gene. A Cas protein includes proteins encoded by a gene in a Cas locus and includes adaptation molecules as well as interference molecules. An interference molecule of a bacterial adaptive immunity complex includes endonucleases. A Cas endonuclease described herein comprises one or more nuclease domains. Contemplated herein are any Cas molecules that comprise a Rec3 clamp, as described below. A Cas endonuclease may also include a multifunctional Cas endonuclease. The term “multifunctional Cas endonuclease” and “multifunctional Cas endonuclease polypeptide” are used interchangeably herein and includes reference to a single polypeptide that has Cas endonuclease functionality (comprising at least one protein domain that can act as a Cas endonuclease) and at least one other functionality, such as but not limited to, the functionality to form a complex (comprises at least a second protein domain that can form a complex with other proteins). In one aspect, the multifunctional Cas endonuclease comprises at least one additional protein domain relative (either internally, upstream (5’), downstream (3’), or both internally 5’ and 3’, or any combination thereof) to those domains typical of a Cas endonuclease. As used herein, the term “guide polynucleotide”, relates to a polynucleotide sequence that can form a complex with a Cas endonuclease, including the Cas endonuclease described herein, and enables the Cas endonuclease to recognize, optionally bind to, and optionally cleave a DNA target site. The guide polynucleotide sequence can be an RNA sequence, a DNA sequence, or a combination thereof (a RNA-DNA combination sequence). The terms “single guide RNA” and “sgRNA” are used interchangeably herein and relate to a synthetic fusion of two RNA molecules, a crRNA (CRISPR RNA) comprising a variable targeting domain (linked to a tracr mate sequence that hybridizes to a tracrRNA), fused to a tracrRNA (trans-activating CRISPR RNA). The term “administer,” “administering”, or derivatives thereof refer to delivering a composition, substance, inhibitor, or medication to a subject or object by one or more the following routes: oral, topical, intravenous, subcutaneous, transcutaneous, transdermal, intramuscular, intra-joint, parenteral, intra-arteriole, intradermal, intraventricular, intracranial, intraperitoneal, intralesional, intranasal, rectal, vaginal, by inhalation or via an implanted reservoir. The term “parenteral” includes subcutaneous, intravenous, intramuscular, intra- articular, intra-synovial, intrasternal, intrathecal, intrahepatic, intralesional, and intracranial injections or infusion techniques. Docket No.10034-324WO1 System for Simultaneous Transcriptional Activation and / or Transcriptional Repression Clustered regularly interspaced short palindromic repeats (CRISPR)–CRISPR- associated (Cas) systems are based on RNA-guided sequence-specific genome editing and regulation. The CRISPR–Cas systems discovered are categorized into two major classes and six types using bioinformatics methods. In particular, the type II CRISPR–Cas9 systems have been used in a variety of organisms including microbes, fungi, plants , and animals. In the type II CRISPR–Cas systems, a Cas9 endonuclease and a guide RNA, which consists of a DNA-targeting CRISPR-associated RNA (crRNA) and the trans-activating crRNA (tracrRNA), establish a functional guide RNA–Cas9 complex. The CRISPR–Cas9 complex is recruited to the target DNA site by its guide RNA, which has a ~20 nucleotide sequence complementary to its target. crRNA and tracrRNA can be engineered into a chimeric single guide RNA (sgRNA), which is easily programmable and portable. In one aspect, disclosed herein is a system for simultaneous transcriptional activation or transcriptional repression in a cell comprising: a catalytically inactive nuclease; an RNA binding protein; at least two bacteriophage aptamers; a multi-sgRNA cassette, wherein the multi-sgRNA cassette comprises two to six target gene sgRNAs; and a transcriptional activator or a transcriptional repressor. As used herein, a “bacteriophage aptamer” refers to short, single-stranded nucleic acid sequences including, but not limited to DNA or RNA, derived from a bacteriophage virus. In general, aptamers comprise high affinity and specificity to interact with a desired target, such as for example the MCP protein. Further, a “bacteriophage” refers to a virus that infects and replicates within bacteria and archaea but display minimal harmful effects in humans. As used herein “a multi-sgRNA cassette” refers to two to six target gene sgRNAs joined together by yeast promoter sequences or tRNA linkers. The “target genes” further refers to various genes in the same cell bound to specific sgRNAs of a multi-sgRNA cassette. In some embodiments, the catalytically inactive nuclease comprises a deactivated Cas 9 (dCas9) or a deactivated Cas12 (dCas12). As used herein “a catalytically inactive nuclease” refers to Cas nucleases mutated within the catalytic domains to be inactive, such that the Cas nuclease lacks endonuclease activity. In some embodiments, the RNA binding protein is fused to the transcriptional activator or the transcriptional repressor. In some embodiments, the transcriptional activator is a VPR protein. In some embodiments, the transcriptional repressor is an MXI1 protein. The “transcriptional repression” refers to when CRISPR–dCas9 interferes with the transcription of the targeted genes by sterically hindering the elongation of RNA polymerase or inhibiting the Docket No.10034-324WO1 initial binding of RNAP to the promoter. Transcriptional repression can be multiplexed and control many genes using multiple sgRNAs. Simultaneous transcriptional repression of multiple genes in a cell helps interrogate the function of various genes for their roles in growth, death, drug resistance, and morphology control. As used herein, “transcriptional repressor” refers to proteins or protein domains that, when targeted to a specific genomic locus by guide RNAs (sgRNAs), inhibit the transcription of the target gene. These repressors can be fused to a catalytically inactive Cas9 (dCas9). In some embodiments the transcriptional repressors can be MXI1, KRAB, MeCP2, or HDAC. As used herein, transcriptional repressors in combination with dCas9 and multi-sgRNA cassettes leads to efficient and flexible transcriptional repression can be achieved across multiple targets or at various loci of a single gene. The “transcriptional activation” refers to when dCas9–VPR system (transcription activator) bound to RNA binding protein on multi sgRNA cassette exhibits improved activation of endogenous coding and non-coding genes. This system can be used to detect gene expression of various genes in the same cell using multiple sgRNAs against each target gene. As used herein, the transcriptional activation is achieved through the use of engineered CRISPR-based systems, such as the dCas9–VPR system, where a catalytically inactive Cas9 (dCas9) is fused to a strong transcriptional activator domain. The VPR fusion comprises three potent activation domains—VP64, p65, and Rta—that work synergistically to enhance gene expression. The dCas9–VPR system enables targeted transcriptional activation of specific endogenous genes by guiding the dCas9 protein to the desired loci via single guide RNAs (sgRNAs). As used herein, “transcriptional activator” refers to proteins used to augment transcriptional activation multiple different activators can be tethered to the dCas9. For example, dCas9 can be fused with a tripartite transactivator composed of VP64, p65AD, or Epstein–Barr virus R transactivator (Rta) (VPR). In some embodiments, the transcriptional activator or transcriptional repressor is brought to a location through fusion to an RNA binding protein. In some embodiments, the RNA binding protein comprises MS2 phage coat protein (MCP) or PP7 phage coat protein (PCP). As used herein, “RNA binding protein” refers to a protein that specifically recognizes and binds to RNA molecules through interactions with RNA sequences or secondary structures. As used herein, the RNA binding protein binds to MS2 hairpin or PP7 hairpin bacteriophage aptamers on sgRNAs In some embodiments, the cell comprises a eukaryotic cell. As used herein, the cell can be a yeast cell or a mammalian cell. Docket No.10034-324WO1 In some embodiments, the yeast cell is selected from Saccharomyces cerevisiae (S. cerevisiae), Kluyveromyces lactis (K. lactis), Kluyverimyces marxianus (K. marxianus), Scheffersomyces stipitis (S. stipites), Yarrowia lipolytica (Y. lipolytica), Hansenula polymorpha (H. polymorpha), Pichia pastoris (P. pastoris), Komagataella pastoris (K. pastoris), Ashbya gossypii (A. gossypii), Streptomyes noursei (S. noursei), Candida albicans (C. albicans), and Schizosaccharomyces pombe (S. pombe). Method for High Throughput Simultaneous Transcriptional Activation and / or Transcriptional Repression In some aspects, disclosed herein is a method for high throughput transcriptional activation or transcriptional repression of target genes within a cell, comprising: introducing a multi-sgRNA cassette comprising two to six target gene sgRNAs in the cell, wherein each target gene sgRNA comprises a bacteriophage aptamer; and co-expressing a catalytically inactive nuclease with a transcriptional activator or a transcriptional repressor and an RNA binding protein, wherein the multi-sgRNA cassette controls the transcriptional activation or transcriptional repression of two to six target genes simultaneously in the cell. In some embodiments, the RNA binding protein comprises MS2 phage coat protein (MCP) or PP7 phage coat protein (PCP). In some embodiments, the bacteriophage aptamer comprises MS2 stem loop or PP7 stem loop. In some embodiments, the transcriptional activator is a VPR protein. In some embodiments, the transcriptional repressor is a MXI1 protein. In some embodiments, the cell comprises a eukaryotic cell. As used herein, the cell can be a yeast cell or a mammalian cell. In some embodiments, the yeast cell is selected from Saccharomyces cerevisiae (S. cerevisiae), Kluyveromyces lactis (K. lactis), Kluyverimyces marxianus (K. marxianus), Scheffersomyces stipitis (S. stipites), Yarrowia lipolytica (Y. lipolytica), Hansenula polymorpha (H. polymorpha), Pichia pastoris (P. pastoris), Komagataella pastoris (K. pastoris), Ashbya gossypii (A. gossypii), Streptomyes noursei (S. noursei), Candida albicans (C. albicans), and Schizosaccharomyces pombe (S. pombe). In some aspects, disclosed herein is a method for high throughput simultaneous transcriptional activation and transcriptional repression of target genes within a cell, comprising: introducing a multi-sgRNA cassette comprising two to six target gene sgRNAs in the cell and co-expressing a catalytically inactive nuclease with a transcriptional activator Docket No.10034-324WO1 or a transcriptional repressor and an RNA binding protein, wherein the multi-sgRNA cassette controls the simultaneous transcriptional activation and transcriptional repression of two to six target genes in the cell. As used herein, each target gene sgRNA comprises a bacteriophage aptamer. Herein, each of the two to six target gene sgRNAs is flanked by a Pol III promoter. The “RNA polymerase III (Pol III) promoters” are responsible for the transcription of small non-coding RNAs, such as transfer RNA (tRNA) and other small nuclear RNAs. As used herein, these promoters express sgRNAs. In some embodiments, the promoter is a yeast tRNA promoter, such as tRNA^Leu or tRNA^Gly, are employed in CRISPR systems to express sgRNAs. These promoters are efficient in producing short RNA transcripts and have been adapted to produce functional sgRNAs in yeast systems. For example, tRNA promoters, such as tRNA^Leu, are adapted to express sgRNAs in a Pol III-driven manner for CRISPR-mediated gene editing in yeast In some embodiments, the Pol III promoter comprises SNR52, RPR1, or ZOD1. In some embodiments, the Pol III promoter can from a yeast cell, comprising any one organism including, but is not limited to Saccharomyces cerevisiae (S. cerevisiae), Kluyveromyces lactis (K. lactis), Kluyverimyces marxianus (K. marxianus), Scheffersomyces stipitis (S. stipites), Yarrowia lipolytica (Y. lipolytica), Hansenula polymorpha (H. polymorpha), Pichia pastoris (P. pastoris), Komagataella pastoris (K. pastoris), Ashbya gossypii (A. gossypii), Streptomyes noursei (S. noursei), Candida albicans (C. albicans), and Schizosaccharomyces pombe (S. pombe). In some embodiments, the catalytically inactive nuclease is a deactivated Cas protein (dCas). In some embodiments, the deactivated Cas protein is a dCas9 or a dCas12. Composition for Controlled Expression of Multi-sgRNA Cassette In some aspects, disclosed herein is a biosensor for controlled expression of multi- sgRNA cassette within a cell, comprising: a cell for determining gene regulation; a multi- sgRNA cassette comprising two to six target gene sgRNAs; a transcriptional effector protein; an inducer to transcriptional effector protein; an expression vector; and a transcriptional activator or a transcriptional repressor with RNA binding proteins bound to dCas9. In some embodiments, the transcriptional activator is a VPR protein. In some embodiments, the transcriptional repressor is a MXI1 protein. In some embodiments, each target gene sgRNA comprises a bacteriophage aptamer. In some embodiments, each of the two to six target gene sgRNAs is flanked by a Pol III Docket No.10034-324WO1 promoter. In some embodiments, the Pol III promoter comprises SNR52, RPR1, or ZOD1, or a combination thereof. In some embodiments, the Pol III promoter is engineered with a DNA binding site. In some embodiments, the Pol III promoter is engineered to include a DNA binding site to allow for the recruitment of transcriptional regulators. The inclusion of such a site enables more precise control over the promoter's activity in response to specific transcriptional effectors. For example, in some embodiments, the DNA binding site is a Ben O gene site, which can bind to specific transcriptional effectors such as Ben M, enhancing or repressing transcription based on the presence or absence of an inducer. In some embodiments, the inducer to the transcriptional effector protein is a cis,cis- muconic acid (CCM). In some embodiments, the RNA binding proteins comprise MS2 phage coat protein (MCP) or PP7 phage coat protein (PCP). In some embodiments, the Pol III promoter is further enhanced by the inclusion of specific RNA Pol III regulatory elements. The regulatory elements can include: a TATA Box, a conserved sequence that facilitates the binding of RNA Polymerase III and ensures the correct initiation of transcription; TFIIIB protein binding region, a sequence that allows for the recruitment of the TFIIIB transcription factor, which is essential for Pol III transcription initiation; TFIIIC protein binding region, a sequence that facilitates the binding of the TFIIIC protein, which aids in the assembly of the transcriptional machinery. The biosensor can also be used to reprogram the fate of cancer cells by converging oncogenic signaling into an anti-oncogenic pathway. More sophisticated circuits with layered regulatory mechanisms can be made to control Cas9-based transcriptional repression / activation machinery in mammalian cells. In some embodiments, the expression vector comprises a plasmid or a virus or viral vector. A plasmid or a viral vector can be capable of extrachromosomal replication or, optionally, can integrate into the host genome. As used herein, the term "integrated" used in reference to an expression vector (e.g., a plasmid or viral vector) means the expression vector, or a portion thereof, is incorporated (physically inserted or ligated) into the chromosomal DNA of a host cell. As used herein, a “viral vector” refers to a virus-like particle containing genetic material which can be introduced into a eukaryotic cell without causing substantial pathogenic effects to the eukaryotic cell. A wide range of viruses or viral vectors can be used for transduction but should be compatible with the cell type the virus or viral vector are transduced into (e.g., low toxicity, capability to enter cells). Suitable viruses Docket No.10034-324WO1 and viral vectors include adenovirus, lentivirus, retrovirus, among others. In some embodiments, the expression vector is a naked DNA or is comprised in a nanoparticle (e.g., liposomal vesicle, porous silicon nanoparticle, gold-DNA conjugate particle, polyethyleneimine polymer particle, cationic peptides, etc.). In some embodiments, the one or more nucleic acid sequences encoding the single sgRNAs in a multi sgRNA cassette are separated and inserted into 1, 2, 3, or more expression vectors. In some embodiments, the one or more nucleic acid sequences encoding the CRISPR-dCas is inserted into a first expression vector and at least two to six sgRNAs multi cassette is inserted into a second expression vector. In some embodiments, the yeast-derived promoter comprises a native yeast promoter or a mutated yeast promoter. In some embodiments, the yeast-derived promoter comprises a native yeast terminator or a mutated yeast terminator. Method for Controlled Expression of Multi-sgRNA Cassette In some aspects, disclosed herein is a method for controlled expression of multi- sgRNA cassette within a cell, comprising: introducing two to six target gene sgRNAs in two to six base vectors; assembling the two to six base vectors using overlap-extension PCR (OE- PCR) into a multi-sgRNA cassette; inserting the multi-sgRNA cassette in an expression vector; expressing the multi-sgRNA cassette in the cell; blocking the DNA binding site of the Pol III promoter with a transcriptional effector protein; co-expressing the multi-sgRNA cassette with a transcriptional activator or a transcriptional repressor with RNA binding proteins bound to dCas9 in the cell. The “Overlap-extension polymerase chain reaction” (OE- PCR) refers to a specialized form of polymerase chain reaction (PCR) involving the amplification and fusion of two or more DNA fragments that contain overlapping sequences. In OE-PCR, primers are designed such that the ends of adjacent DNA fragments overlap by several base pairs. These overlaps allow the DNA fragments to anneal to one another, forming a continuous sequence when amplified by DNA polymerase. As used herein, in some embodiments OE-PCR is used to assemble two to six base vectors into a multi-sgRNA cassette. In some embodiments, the transcriptional activator is a VPR protein. In some embodiments, the transcriptional repressor is a MXI1protein. In some embodiments, the two to six target gene sgRNAs comprises at least two MS2 aptamers or at least two PP7 aptamers. Docket No.10034-324WO1 In some embodiments, each target gene sgRNA in the multi-sgRNA cassette is flanked by a Pol III promoter. In some embodiments, the Pol III promoters comprise SNR52, RPR1, or ZOD1. In some embodiments, the Pol III promoter is engineered with a DNA binding site. In some embodiments, the transcriptional effector protein blocks the DNA binding site in presence of a stressor, thereby regulating sgRNA targeted gene. In some embodiments, the Pol III promoter engineered to include a DNA binding site allows for the recruitment of transcriptional regulators. The inclusion of such a site enables more precise control over the promoter's activity in response to specific transcriptional effectors. For example, in some embodiments, the DNA binding site is a Ben O gene site, which can bind to specific transcriptional effectors such as Ben M, enhancing or repressing transcription based on the presence or absence of an inducer. In some embodiments, the transcriptional effector protein is Ben M or LysR-type. In some embodiments, the stressor to the transcriptional effector protein comprises fdeR, naringenin, cis,cis-muconic acid, or reactive oxygen species. In some embodiments, the RNA binding proteins comprise MS2 phage coat protein (MCP) or PP7 phage coat protein (PCP). In some embodiments, the Pol III promoter is further enhanced by the inclusion of specific RNA Pol III regulatory elements. The regulatory elements can include: a TATA Box, a conserved sequence that facilitates the binding of RNA Polymerase III and ensures the correct initiation of transcription; TFIIIB protein binding region, a sequence that allows for the recruitment of the TFIIIB transcription factor, which is essential for Pol III transcription initiation; TFIIIC protein binding region, a sequence that facilitates the binding of the TFIIIC protein, which aids in the assembly of the transcriptional machinery. It will be apparent to those skilled in the art that various modifications and variations can be made in the present disclosure without departing from the scope or spirit of the invention. Other embodiments of the disclosure will be apparent to those skilled in the art from consideration of the specification and practice of the methods disclosed herein. It is intended that the specification and examples be considered as exemplary only, with a true scope and spirit of the invention being indicated by the following claims. EXAMPLES The following examples are set forth below to illustrate the compositions, systems, methods, and results according to the disclosed subject matter. These examples are not Docket No.10034-324WO1 intended to be inclusive of all aspects of the subject matter disclosed herein, but rather to illustrate representative methods and results. These examples are not intended to exclude equivalents and variations of the present invention which are apparent to one skilled in the art. Example 1: An overlap-extension PCR based method that creates multi-sgRNA cassettes to control multiple genes per cell and is easily scaled to be able to control millions of different combinations of gene perturbations in millions of different cells To enable high throughput combinatorial gene perturbations, multiplexable programmability is installed into the CRISPR / Cas9 system. Cas9 is a programmable nuclease that can be targeted to specific genes by single guide RNAs (sgRNAs). Deactivated Cas9 (dCas9) lacks nuclease ability, and fusing dCas9 to transcriptional activator or repressor domains allows targeted modulation of gene expression level (FIG. 1). CRISPR / dCas9 technologies have ushered in a new era of rapid genetic deletion screens and are unsurprisingly at the forefront of high-throughput screenings in S. cerevisiae. The CRISPR (cluster regularly interspaced short palindromic repeats) / Cas9 system employs an RNA- targeted Cas9 protein with exquisite gene / DNA targeting capabilities. When endonuclease activity is abrogated from Cas9 (i.e., deactivated Cas9 or dCas9), the DNA targeting functionality remains. CRISPR-(d)Cas9 technology has combined genome-wide overexpression, knockdown, and deletion purposes into a single platform, which has been scaled to cover a significant portion of the yeast genome. Genome-wide dCas9-based transcriptional inhibition (CRISPRi) screens rely on the deficient endonuclease’s ability to repress genes by interfering with RNA Pol II and repressors that usually bind to promoter DNA when targeting a 200 bp region immediately upstream of the transcription start site, as well as open chromatin regions. The addition of a repressor domain, such as MXI1, to the C-terminal region of dCas9 enhances its inhibitory potency (FIG. 1). The findings from a CRISPRi screen, in which over >51,000 sgRNAs were used to perturb genes involved in adenine and arginine biosynthesis in S. cerevisiae, demonstrated the high throughput capability of dCas9. With clever engineering, a trifunctional genetic control method which used three orthogonal dCas9 proteins or protein fusions to mediate either gene activation, inhibition, or deletion (CRISPR-AID) within an individual cell, highlighted the versatility of this system. In contrast, fusing a transcriptional activator such as the tripartite VPR (VP64-p65-Rta) to dCas9 “flips the switch” on transcription by increasing gene expression(FIG. 1). In addition, the VPR or MXI domains Docket No.10034-324WO1 can be tethered to viral proteins that complex with specified stem loops that can be inserted into the sgRNA (FIG. 1). Using an optimized overlap-extension, tRNA-tethering PCR technique, it has been demonstrated that both three and six sgRNA-containing cassettes are created, that can function to control 3 or 6 different genes simultaneously in a single cell and can be easily scaled to perturb millions of different gene combinations of genes in millions of individual cells to be able to enhance cell function or understand important biological functions with disease relevance. (FIGS. 2-8). Each sgRNA is flanked by tRNA sequences (or a promoter or terminator) in a “base plasmid” and amplified. During the next step of the OE-PCR, the homology between tRNAs in the fragments allows them to act as mega-primers in a PCR reaction which results in assembly of a multi-sgRNA cassette at very low yield (FIGS. 4-5). This DNA fragment which contains multi-sgRNA serves as the template for its amplification with primers that bind the flanking regions. Using primers that anneal far away from the repetitive sequences found in sgRNA scaffolds prevents non-specific amplification that results in the “DNA smear” seen when using primers that anneal closer to receptive regions. The “DNA smear” is thought to be a consequence of early polymerase dissociation, which generates fragments with homology to the template, thus acting like megaprimers. The chances of “DNA smear” were reduced by optimizing the experimental design which included: (1) using ‘far away’ primers creates fragments that have less homology to the template when the polymerase dissociates and (2) using a polymerase (KOD-HotStart) that is both very fast and able to elongate long DNA templates, decreasing its likelihood of dissociations. Importantly, any number of different sgRNAs can be inserted into the ‘base plasmids,’ allowing pooled fragment amplification and OE-PCR mediated multi-sgRNA assembly for downstream high throughput combinatorial gene targeting (FIG. 4). Moreover, the multi-sgRNA cassettes are functional after assembled with the current method. Specifically, the characterization test of the multi-sgRNA cassettes confirmed that sgRNAs are released after cassette transcription, as would be expected during normal tRNA processing, and that this yields functional sgRNAs that can complex with dCas9 to control gene expression. It is shown that (1) 3X and 6X -sgRNA arrays with the same sgRNA inserted at any position resulted in the same level of transcriptional repression as compared to non-targeting controls (FIG. 7), and that (2) 3X and 6X-sgRNA arrays with three distinct sgRNAs simultaneously reduced the expression level of three proteins as compared to non- target controls (FIG. 7). This shows that the tRNAs are ‘processed’ by intracellular and Docket No.10034-324WO1 universally conserved enzymes to allow the creation of the distinct and functional sgRNAs (multiple per cell) (FIG. 3). Example 2: Expanding the platform to include Pol III promoters and molecular aptamers for simultaneous activation and repression of genes in one cell When using single sgRNA cassettes, it is shown that co-expressing a PCP-MXI1 protein and a sgRNA scaffolded with two PP7 stem loops improves repression compared to a direct dCas9-MXI1 fusion protein, likely due to this system’s ability to recruit multiple MXI1 proteins to the targeted gene (FIG. 6). Furthermore, the promoters with low homology from disparate yeast species are characterized (FIG. 14), selecting those that mediate transcriptional activation of a weak HTA promoter driving mTagBFP expression as effectively as or better than S. cerevisiae RNA Pol III promoters (FIG. 14). Selected promoters are used to construct 2X, 4X, and 6X constructs without stem loops to confirm the expression of functional multi-sgRNAs (FIG. 16). These sgRNAs mediated transcriptional activation of mTagBFP expression in a yeast strain with integrated dCas9-VPR. Assembly of multi-sgRNA cassettes with promoters as the overlapping regions using OE-PCR, function effectively in the system. Using the scaffolded sgRNA setup still allows function of multi- sgRNA cassettes that are driven by different RNA Pol III promoters. In the initial combinatorial multi-sgRNA platform tRNAs were used as linkers and regions of overlap for assembly by OE-PCR, allowing either transcriptional repression or activation, but not both. The simultaneous activation and repression of genes with MCP / PCP-bound sgRNAs in a yeast strain with integrated corresponding CRISPR proteins is confirmed (FIG. 18). Further screening and selecting cells from engineered yeast strains transformed with multi-targeting sgRNA libraries assembled by OE-PCR is shown in FIG. 22. Moreover, engineering Pol III promoters that in the presence of an inducer, change their activity based on the binding of a LysR-type transcriptional regulator is shown in FIG. 23. When used to target one gene per cell in a high throughput manner, both dCas9 and Cas9 can improve understanding of the effect of individual genes at a systems level. However, is not currently possible to perform combinatorial gene targeting at nearly the scale necessary to fully study how genetic interactions lead to complex phenotypes like resistance to stress. In this vein, it has been established through large-scale yeast deletion / mating screening assays that genetic interactions occur across the genome (e.g., ~9,600 distinct interactions that negatively impacted growth from ~400,000 pairwise gene perturbations), with the three-way gene interaction network predicted to be up to 100-fold larger than the pairwise network. Recent efforts have used Cas9 or dCas9 to probe more than one gene per Docket No.10034-324WO1 cell but have been limited to comparatively moderate scale, maxing out with two-way combinatorial libraries of ~12,000 gene pairs (Perturb-Seq) or 110,000 pairs (CRISPRi) and with three-way combinatorial libraries of up to only 32 genes = 32,768 combinations (CombiGemv2). Therefore, the scale of previous Cas9-mediated efforts for combinatorial targeting is limiting the detection of how gene perturbations might combine to impact complex phenotypes. In addition, none of these combinatorial efforts allowed for detection of interactions that could occur when one gene is being upregulated and another downregulated, which based on the large number of genes both activated and repressed by stressors in yeast, are likely to be very prevalent. The scale of combinatorial (d)Cas9-mediated screens has been limited for a surprisingly simple reason. It has been impossible to create, in a high throughput manner (>105), constructs that enable expression of multiple sgRNAs in a single cell – which are needed to control multiple genes per cell. This difficulty arises because each sgRNA contains identical stretches of nucleotides, and these repetitive sequences prevent the use of standard high throughput molecular cloning techniques or DNA synthesis. For instance, while Golden Gate-based cloning has been used to generate multi-sgRNA cassettes, it has typically been used to produce only one multi-sgRNA construct from scratch at a time, as the assembly of several sgRNAs and their flanking regions requires many fragments, while repetitive insertion of one ‘sgRNA library’ then a second identical library is the basis of CombiGem. In addition, repeated nucleotides preclude Gibson assembly, and sgRNAs only function as RNA (requiring an RNA Polymerase III promoter), making the use of multi-cistronic RNA Pol II expression, e.g. IRES sequences or T2A peptides, impossible. Highly characterized Pol III promoters such as the SNR52 promoter from S. cerevisiae are a crucial component in the production of sgRNAs in the single and multi-targeting cassettes. Though these Pol III promoters demonstrate constitutive activity in the novel platform, there is room for expanding its functionality. Based on findings from a recent study, in which Pol II promoters driving the expression of a fluorescent reporter were engineered to respond to metabolites for transcriptional regulation in a yeast model organism, the functionality of the SNR52 promoter could be expanded to serve as biosensor that controls the production of sgRNAs. These sgRNAs are responsible for changes in mRNA transcripts. Therefore, they were engineered to express DNA-binding site(s) (BenO) that recruit BenM, the transcriptional effector protein from Acinetobacter sp. ADP1, a cis,cis-muconic acid (CCM), the inducer of BenM is used, to demonstrate a responsive promoter or biosensor within a complex CRISPR system. Docket No.10034-324WO1 The method for high-throughput construction of multi-sgRNA cassettes takes an innovative approach to overcoming barriers to their creation, including low throughput and erroneous assembly, both of which are caused in part by the inclusion of repetitive DNA sequences. The current disclosure is an approach to enable simultaneous transcriptional activation and transcriptional repression of several different genes per cell at high throughput. These novel advances will enable heretofore impossible studies into complex gene interactions, gene redundancies, and large-scale cause and effect studies of transcriptional perturbation. The method is also generalizable such that it can be used in any eukaryotic cell, particularly in human cells. The method utilized ‘base vectors’ that can be used for insertion of pools of sgRNAs that can then be combined through an optimized overlap extension PCR process to make multi-sgRNA cassettes at incredible scale (10^6) that can be used to control the expression of multiple genes per cell at this large scale (10^6 different cells with different gene perturbations). The method also captures both increase and decrease the expression of multiple genes per cells while keeping the same scale, testing millions of different combinations in millions of individual cells. In addition, the SNR52 promoter is engineered to change its activity based on the presence of the BenM protein and its cognate inducer. Second, the promoter with configurations that successfully change gene expression through the regulated production of sgRNAs targeting Pol II promoters and a reporter (e.g., pHTA- eGFP) were selected, to engineer the SNR52 promoter to include other DNA elements that recruit different LysR-type transcriptional regulators, which further respond to specific inducers (e.g., fdeR and naringenin). Lastly, base plasmids (pUC19) were designed to allow for the assembly of multi-targeting sgRNAs with responsive promoters by OE-PCR. The promoters in these cassettes would alter their activity based on the presence of three different inducers, targeting three different genes for simultaneous activation and repression. This approach, when combined with the high-throughput assembly of combinatorial libraries, reveals new genetic interactions and complex phenotypes resulting from multiple environmental stimuli, rather than being limited to the addition of a single stressor, for example, hydrogen peroxide. A key advantage of this technology is that it enables the ability to test multiple combinations of gene expression perturbations, i.e., millions of different combinations that can be 2x, 3x, 4x, 5x, or 6x genes per cell. The second key advantage of this technology is that the expression of the combinations of genes in cells can be turned up or turned down simultaneously (with activation and repression in the same cell) while keeping this large scale. The third key advantage of this technology is the development of a biosensor in the Docket No.10034-324WO1 form of a Pol III promoter that functions through the CRISPR system, rather than directly impacting gene expression via promoters upstream of the gene (Pol II promoters). This empowers the dissection of extraordinarily intricate phenotypes in manners currently beyond reach. The innovations originating from these studies and examples have wide-ranging applications in enhancing the comprehension of biology, facilitating novel investigations across diverse domains, including the involved landscape of degenerative diseases and cancer biology, both renowned for their multi-genic complexities. Unless defined otherwise, all technical and scientific terms used herein have the same meanings as commonly understood by one of skill in the art to which the disclosed invention belongs. Publications cited herein and the materials for which they are cited are specifically incorporated by reference. Those skilled in the art will appreciate that numerous changes and modifications can be made to the preferred embodiments of the invention and that such changes and modifications can be made without departing from the spirit of the invention. It is, therefore, intended that the appended claims cover all such equivalent variations as fall within the true spirit and scope of the invention.

[0002] Docket No.10034-324WO1 TABLES Table 1. List of oligonucleotides < Q : >Table 2. Overlap extension PCR primers < Q : > Docket No.10034-324WO1 Table 3. Linking tRNAs (CTG) Table 4. List of sgRNAs Aptamers <SEQ ID NO: 42> Table 5. List of Pol III promoters inserted in BenO site ATAAACAATTCGGCGTTCGAAACTTCTCCGCAGTGAAAGATAAATGATC Docket No.10034-324WO1 NO: 59> Table 6. List of Pol II promoters ACATTTTTGAGATTTTCAACTATTACGTATTACGATAATCCTGCTGTCA Docket No.10034-324WO1 TAGAAAGAAAGCATAGCAATCTAATCTAAGTTTTAATTACAA Table 7. List of Pol III promoters (multiplexing) CTGGGAGCTGCGATTGGCA Docket No.10034-324WO1 AAAGTTACTTTCTCGGCAGTTCGAATC Table 8. List of genes inserted in the plasmid TCCATTTTTAAAAGATAATAGAGAAAAAATCGAGAAAATTTTAACCTTTAGAATTCCATACTATGTTGGGCC Docket No.10034-324WO1 AAATTATATCTTTACTACCTTCAAAATGGACGTGATATGTATGTTGATCAGGAATTAGATATAAATAGACTT Docket No.10034-324WO1 TTTTGGTTGTGGCAAAGGTTGAAAAGGGTAAAAGTAAAAAGCTTAAATCAGTAAAAGAACTTTTGGGTATT Docket No.10034-324WO1 TGCCTCTTGCATGCCATGCATATCAGCACAGGACTGTCCATCTTCGACACATCTCTGTTTTAA Docket No.10034-324WO1 GATCACATGGTCTTGTTAGAATTTGTTACTGCTGCTGGTATTACCCATGGTATGGATGAATTGTACAAATAA Table 9. List of Terminators 91> Docket No.10034-324WO1 96> Table 10. Recombination plasmid with forward and reverse primers Table 11. Overhangs for base plasmids Table 12. Types of plasmids: Promoters 2X 4X 6X plasmids gRNA_STEMs , , Docket No.10034-324WO1 , _ _ _ Docket No.10034-324WO1 , _ _ _ _ _ Table 13. Types of plasmids: tRNA 3X and 6X plasmids gRNA STEMs ,_ _ _ _ Docket No.10034-324WO1 ,_ _ _ _

[0003] Docket No.10034-324WO1 SEQUENCES CGGGTGGGACCT Docket No.10034-324WO1 GTTCGAACT Docket No.10034-324WO1 ATCATATATAAGTATATTAGGATGAGGCGGTGAAAGAGATTTTTTTTTTTTCGCTTAATTTATT Docket No.10034-324WO1 GCCCAGGTCCTTCTTTGGCCAAATTTTAACTTCGGTCCTATGGCACAGCGGTAGCGCGT (multiplexing) Docket No.10034-324WO1 TGACCAATTTCGATAAAAACTTACCAAATGAAAAAGTTTTACCAAAACATTCCTTGTTATAC Docket No.10034-324WO1 AAAAGTTACTGTTAAACAATTAAAAGAAGATTACTTTAAGAAAATTGAATGTTTTGATTCAGTT Docket No.10034-324WO1 AACCTGAAAACATTGTCATTGAGATGGCAAGAGAAAATCAAACTACACAAAAAGGACAGAAAAATAGTA Docket No.10034-324WO1 ATTGGACGATTTTGATCTGGATATGCTGGGAAGTGACGCCCTCGATGATTTTGACCTTGAC Docket No.10034-324WO1 CTTACAGATCCAAAAAGACTGTTGGTAACATCAAGATGCCAGGTATTCATGCCGTTGACC Docket No.10034-324WO1 TTCGAAGTATTCTTTCAGAGAGTATTTTTGCAACATACCAATAAGCCAAATTACTC 3X Cassette (tRNAs); <SEQ ID NO: 97> TCTTTGAAAAGATAATGTATGATTATGCTTTCACTCATATTTATACAGAAACT TGATGTTTTCTTTCGAGTATATACAAGGTGATTACATGTACGTTTGAAGTAC AACTCTAGATTTTGTAGTGCCCTCTTGGGCTAGCGGTAAAGGTGCGCATTTT TTCACACCCTACAATGTTCTGTTCAAAAGATTTTGGTCAAACGCTGTAGAAG TGAAAGTTGGTGCGCATGTTTCGGCGTTCGAAACTTCTCCGCAGTGAAAGAT AAATGATCCTTGGTTTGGTTCTTTTTTCTTCCGTTTCAGAGCTAGAAATAGCAAGTTG AAATAAGGCTAGsTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCAAACAAG CGCAAGTGGTTTAGTGGTAAAATCCAACGTTGCCATCGTTGGGCCCCCGGTT Docket No.10034-324WO1 CGATTCCGGGCTTGCGCACTTGAAACAAGCCTAACGTCCATGGTTTCAGAGCTA GAAATAGCAAGTTGAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTC GGTGCAAACAAGCTCGCGTGGCGTAATGGCAACGCGTCTGACTTCTAATCAGAAGAT TATGGGTTCGACCCCCATCGTGAGTGCTTGCACCATTCGCGGTCAGGGGGGTTTCAG AGCTAGAAATAGCAAGTTGAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACC GAGTCGGTGCTTTTTTTGTTTTTTATGTCT SC SNR52; 20 bp inserts; gRNAs; tRNA GLY; tRNA ARG’ ; Terminator; Linkers Terminator; <SEQ ID NO: 98> TTTTTTTGTTTTTTATGTCT 24 bp linkers; <SEQ ID NO: 99> CTTGGTTTGGTTCTTTTTTCTTCC 24 bp linkers; <SEQ ID NO: 100> CTTGAAACAAGCCTAACGTCCATG 24 bp linkers; <SEQ ID NO: 101> CTTGCAAGTAGGGGAATAATTTCA 24 bp linkers; <SEQ ID NO: 102> CTTGCACCATTCGCGGTCAGGGGG 24 bp linkers; <SEQ ID NO: 103> CTTGACTACGCGCACTTGAATCGC 24 bp linkers; <SEQ ID NO: 104> CTTGTCCGGCAGCCAGGCGTGCAT 24 bp linkers; <SEQ ID NO: 105> CTTGCCGTTCACGAAGCCAGCCAG 24 bp linkers; <SEQ ID NO: 106> CTTGTCGCTGCAGACCTGCGAGCA 24 bp linkers; <SEQ ID NO: 107> CTTGGAACCGTGGCGCGCTGGATG SC SNR52 promoter; <SEQ ID NO: 108> TCTTTGAAAAGATAATGTATGATTATGCTTTCACTCATATTTATACAGAAACTTGA TGTTTTCTTTCGAGTATATACAAGGTGATTACATGTACGTTTGAAGTACAACTCTA GATTTTGTAGTGCCCTCTTGGGCTAGCGGTAAAGGTGCGCATTTTTTCACACCCTA CAATGTTCTGTTCAAAAGATTTTGGTCAAACGCTGTAGAAGTGAAAGTTGGTGCG CATGTTTCGGCGTTCGAAACTTCTCCGCAGTGAAAGATAAATGATC Docket No.10034-324WO1 tRNA GLY; <SEQ ID NO: 109> GCGCAAGTGGTTTAGTGGTAAAATCCAACGTTGCCATCGTTGGGCCCCCGGTTCG ATTCCGGGCTTGCGCA tRNA ARG; <SEQ ID NO: 110> GCTCGCGTGGCGTAATGGCAACGCGTCTGACTTCTAATCAGAAGATTATGGGTTC GACCCCCATCGTGAGTG tRNA HIS; <SEQ ID NO: 111> GCCATCTTAGTATAGTGGTTAGTACACATCGTTGTGGCCGATGAAACCCTGGTTC GATTCTAGGAGATGGCA tRNA THR; <SEQ ID NO: 112> GCCTCCTTAGCTTAGTGGTAGAGCGTTGCACTTGTAATGCAAAGGTCGCTAGTTC AATTCTGGCAGGTGGCA tRNA GLY; <SEQ ID NO: 113> GGTCCTATAGTGTAGTGGTTATCACTTTCGGTTCTGATCCGAACAACCCCAGTTC GAATCCGGGTGGGACCT gRNA used in cassettes; <SEQ ID NO: 114> GTTTCAGAGCTAGAAATAGCAAGTTGAAATAAGGCTAGTCCGTTATCAACTTGAA AAAGTGGCACCGAGTCGGTGC gRNA with MS21,3; <SEQ ID NO: 115> GTTTCAGAGCTAGGCCAACATGAGGATCACCCATGTCTGCAGGGCCTAGCAAGTT GAAATAAGGCTAGTCCGTTATCAACTTGGCCAACATGAGGATCACCCATGTCTGC AGGGCCAAGTGGCACCGAGTCGGTGC PP7 aptamer; <SEQ ID NO: 116> GGAGCAGACGATATGGCGTCGCTCC MS2 aptamer; <SEQ ID NO: 117> GGCCAACATGAGGATCACCCATGTCTGCAGGGCC gRNA with PP71,3; <SEQ ID NO: 118> GTTTCAGAGCTACCGGAGCAGACGATATGGCGTCGCTCCGGTAGCAAGTTGAAA TAAGGCTAGTCCGTTATCAACTTGGAGCAGACGATATGGCGTCGCTCCAAGTGGC ACCGAGTCGGTGC SC RPR1 promoter; <SEQ ID NO: 119> GATCTGCCAATTGAACATAACATGGTAGTTACATATACTAGTAATATGGTTCGGC ACACATTAAAAGTATAAAAACTATCTGAATTACGAATTACATATATTGGTCATAA AAATCAATCAATCATCGTGTGTTTTATATGTCTCTTATCTAAGTATAAGAATATCC Docket No.10034-324WO1 ATAGTTAATATTCACTTACGCTACCTTTTAACCTGTAATCATTGTCAACAGGATAT GTTAACGACCCACATTGATAAACGCTAGTATTTCTTTTTCCTCTTCTTATTGGCCG GCTGTCTCTATACTCCCCTATAGTCTGTTTCTTTTCGTTTCGATTGTTTTACGTTTG AGGCCTCGTGGCGCACATGGTACGCTGTGGTGCTCGCGGCTGGGAACGAAACTC TGGGAGCTGCGATTGGCA SC ZOD1; <SEQ ID NO: 120> CGTTGCATTACGTGGTGTCCGGTCGCTATTTCCTGGGTTTTCTGCGGCAGATTCGC ACTGCGCGCCACAGCTGCAACAACTGCAGTGTTATTTCGGGTGCCAATTTAGCGT GCTTCGATCTAACTATTCTGTAAATTCTGTAGTGACTCTTTAGGGCGAAGTACGT ATTTCATGATTTAAAATCCCCGTCTTCAAATATACCGAAAAAAGAAACAAGACAT TTTTTAGCAGTTTATGTACGCATTTTAAAAGCCGGGAAAT YL SNR52; <SEQ ID NO: 121> GACCCCGTCTTCAATTACACTTCCCAACTGGGAACACCCCTCTTTATCGACCCATT TTAGGTAATTTACCCTAGCCCATTGTCTCCATAAGGAATATTACCCTAACCCACA GTCCAGGGTGCCCAGGTCCTTCTTTGGCCAAATTTTAACTTCGGTCCTATGGCAC AGCGGTAGCGCGTGAGATTGCAAATCTTAAGGTCCCGAGTTCGAATCTCGGTGG GACCTAGTTATTTTTGATAGATAATTTCGTGATGATTAGAAACTTAACGCAAAAT AATGACGT CA SNR52; <SEQ ID NO: 122> ATTACGTACCAAGAAGCATCTAATCAACTCCCAGATCACCACTATACATTTAAAA GTCATTGGTCAATAACTATACTCGAGTATTGCCTCATCAAAGAAACAATCAAATA TTATAGATACTCACTCCATCACGTGATAATTTCACTGGTATGGAAAAGTGGAAAA TTTTATAAAAAAAAATTTGATGCCTTTGGCATAGCTGAAACTTCGGCCCAATAGG ATTGGAGAATATGTTTTCGCAGCGTTCTTACAATTAAATTGTGGTGGAAGTTCGA GACTTGCGTAAACTATTTTTAATTT YL RPR1; <SEQ ID NO: 123> TATATATTTTTTATTCTAATGATTCATTACAGCTATATACCTAGTAAGCCGGGTTA TTGGCGTTCAATAAATCATACACTTCTGAATCTTTGATTACAGTCATTCCTGACGA CTGTCCGATGAAACGGCCTAAAAAAGTTAAAATGTCGGGAAATTTAGCTCTGGC CTAACGGTCAGACTGCAGTTACCC 6X Cassette (tRNAs); <SEQ ID NO: 124> TCTTTGAAAAGATAATGTATGATTATGCTTTCACTCATATTTATACAGAAACT TGATGTTTTCTTTCGAGTATATACAAGGTGATTACATGTACGTTTGAAGTAC AACTCTAGATTTTGTAGTGCCCTCTTGGGCTAGCGGTAAAGGTGCGCATTTT TTCACACCCTACAATGTTCTGTTCAAAAGATTTTGGTCAAACGCTGTAGAAG TGAAAGTTGGTGCGCATGTTTCGGCGTTCGAAACTTCTCCGCAGTGAAAGAT AAATGATCCTTGCAAGTAGGGGAATAATTTCAGTTTCAGAGCTAGAAATAGCAAGT TGAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCAAACAA GCGCAAGTGGTTTAGTGGTAAAATCCAACGTTGCCATCGTTGGGCCCCCGG Docket No.10034-324WO1 TTCGATTCCGGGCTTGCGCACTTGAAACAAGCCTAACGTCCATGGTTTCAGAGC TAGAAATAGCAAGTTGAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAG TCGGTGCAAACAAGCTCGCGTGGCGTAATGGCAACGCGTCTGACTTCTAATCAGAAG ATTATGGGTTCGACCCCCATCGTGAGTGCTTGCACCATTCGCGGTCAGGGGGGTTTC AGAGCTAGAAATAGCAAGTTGAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCA CCGAGTCGGTGCAAACAAGCCATCTTAGTATAGTGGTTAGTACACATCGTTGT GGCCGATGAAACCCTGGTTCGATTCTAGGAGATGGCACTTGGAACCGTGGCG CGCTGGATGGTTTCAGAGCTAGAAATAGCAAGTTGAAATAAGGCTAGTCCGTTATCAA CTTGAAAAAGTGGCACCGAGTCGGTGCAAACAAGCCTCCTTAGCTTAGTGGTAG AGCGTTGCACTTGTAATGCAAAGGTCGCTAGTTCAATTCTGGCAGGTGGCAC TTGACTACGCGCACTTGAATCGCGTTTCAGAGCTAGAAATAGCAAGTTGAAATAAGG CTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCAAACAAGGTCCTATA GTGTAGTGGTTATCACTTTCGGTTCTGATCCGAACAACCCCAGTTCGAATCC GGGTGGGACCTCTTGTCCGGCAGCCAGGCGTGCATGTTTCAGAGCTAGAAATAGC AAGTTGAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTT TTTTGTTTTTTATGTCT SC SNR52; 20 bp inserts; GLY Terminator; Linkers 3X Cassette (tRNAs and MS2 Aptamers); <SEQ ID NO: 125> TCTTTGAAAAGATAATGTATGATTATGCTTTCACTCATATTTATACAGAAACT TGATGTTTTCTTTCGAGTATATACAAGGTGATTACATGTACGTTTGAAGTAC AACTCTAGATTTTGTAGTGCCCTCTTGGGCTAGCGGTAAAGGTGCGCATTTT TTCACACCCTACAATGTTCTGTTCAAAAGATTTTGGTCAAACGCTGTAGAAG TGAAAGTTGGTGCGCATGTTTCGGCGTTCGAAACTTCTCCGCAGTGAAAGAT AAATGATCCTTGCCGTTCACGAAGCCAGCCAGGTTTCAGAGCTAGGCCAACATGAG GATCACCCATGTCTGCAGGGCCTAGCAAGTTGAAATAAGGCTAGTCCGTTATCAACTTG GCCAACATGAGGATCACCCATGTCTGCAGGGCCAAGTGGCACCGAGTCGGTGCAAAC AAGCGCAAGTGGTTTAGTGGTAAAATCCAACGTTGCCATCGTTGGGCCCCC GGTTCGATTCCGGGCTTGCGCACTTGAAACAAGCCTAACGTCCATGGTTTCAGA GCTAGGCCAACATGAGGATCACCCATGTCTGCAGGGCCTAGCAAGTTGAAATAAGGCT AGTCCGTTATCAACTTGGCCAACATGAGGATCACCCATGTCTGCAGGGCCAAGTGGCA CCGAGTCGGTGCAAACAAGCTCGCGTGGCGTAATGGCAACGCGTCTGACTTCTAATC AGAAGATTATGGGTTCGACCCCCATCGTGAGTGCTTGCACCATTCGCGGTCAGGGGG GTTTCAGAGCTAGGCCAACATGAGGATCACCCATGTCTGCAGGGCCTAGCAAGTTGAA ATAAGGCTAGTCCGTTATCAACTTGGCCAACATGAGGATCACCCATGTCTGCAGGGCC AAGTGGCACCGAGTCGGTGCTTTTTTTGTTTTTTATGTCT SC SNR52; 20 bp inserts; gRNAs (MS21,3); tRNA GLY; tRNA ARG’ ; Terminator; Linkers 3X Cassette (tRNAs and PP7 Aptamers); <SEQ ID NO: 126> TCTTTGAAAAGATAATGTATGATTATGCTTTCACTCATATTTATACAGAAACT TGATGTTTTCTTTCGAGTATATACAAGGTGATTACATGTACGTTTGAAGTAC AACTCTAGATTTTGTAGTGCCCTCTTGGGCTAGCGGTAAAGGTGCGCATTTT Docket No.10034-324WO1 TTCACACCCTACAATGTTCTGTTCAAAAGATTTTGGTCAAACGCTGTAGAAG TGAAAGTTGGTGCGCATGTTTCGGCGTTCGAAACTTCTCCGCAGTGAAAGAT AAATGATCCTTGTCGCTGCAGACCTGCGAGCAGTTTCAGAGCTACCGGAGCAGAC GATATGGCGTCGCTCCGGTAGCAAGTTGAAATAAGGCTAGTCCGTTATCAACTTGGAG CAGACGATATGGCGTCGCTCCAAGTGGCACCGAGTCGGTGCAAACAAGCGCAAGT GGTTTAGTGGTAAAATCCAACGTTGCCATCGTTGGGCCCCCGGTTCGATTCC GGGCTTGCGCACTTGAAACAAGCCTAACGTCCATGGTTTCAGAGCTACCGGAGCA GACGATATGGCGTCGCTCCGGTAGCAAGTTGAAATAAGGCTAGTCCGTTATCAACTTG GAGCAGACGATATGGCGTCGCTCCAAGTGGCACCGAGTCGGTGCAAACAAGCTCGC GTGGCGTAATGGCAACGCGTCTGACTTCTAATCAGAAGATTATGGGTTCGACCCCCAT CGTGAGTGCTTGCACCATTCGCGGTCAGGGGGGTTTCAGAGCTACCGGAGCAGACG ATATGGCGTCGCTCCGGTAGCAAGTTGAAATAAGGCTAGTCCGTTATCAACTTGGAGC AGACGATATGGCGTCGCTCCAAGTGGCACCGAGTCGGTGCTTTTTTTGTTTTTTATGT CT SC SNR52; 20 bp inserts; gRNAs (PP71,3); tRNA GLY; tRNA ARG; Terminator; Linkers 2X Cassette (pol III promoters and gRNAs); <SEQ ID NO: 127> TCTTTGAAAAGATAATGTATGATTATGCTTTCACTCATATTTATACAGAAACT TGATGTTTTCTTTCGAGTATATACAAGGTGATTACATGTACGTTTGAAGTAC AACTCTAGATTTTGTAGTGCCCTCTTGGGCTAGCGGTAAAGGTGCGCATTTT TTCACACCCTACAATGTTCTGTTCAAAAGATTTTGGTCAAACGCTGTAGAAG TGAAAGTTGGTGCGCATGTTTCGGCGTTCGAAACTTCTCCGCAGTGAAAGAT AAATGATCCTTGGTTTGGTTCTTTTTTCTTCCGTTTCAGAGCTAGAAATAGCAAGTTG AAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTTGT TTTTTATGTCTGATCTGCCAATTGAACATAACATGGTAGTTACATATACTAGT AATATGGTTCGGCACACATTAAAAGTATAAAAACTATCTGAATTACGAATTA CATATATTGGTCATAAAAATCAATCAATCATCGTGTGTTTTATATGTCTCTTA TCTAAGTATAAGAATATCCATAGTTAATATTCACTTACGCTACCTTTTAACCT GTAATCATTGTCAACAGGATATGTTAACGACCCACATTGATAAACGCTAGTA TTTCTTTTTCCTCTTCTTATTGGCCGGCTGTCTCTATACTCCCCTATAGTCTG TTTCTTTTCGTTTCGATTGTTTTACGTTTGAGGCCTCGTGGCGCACATGGTA CGCTGTGGTGCTCGCGGCTGGGAACGAAACTCTGGGAGCTGCGATTGGCAC TTGAAACAAGCCTAACGTCCATGGTTTCAGAGCTAGAAATAGCAAGTTGAAATAAGG CTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTTGTTTTTTATG TCT SC SNR52; 20 bp inserts; gRNAs; SC RPR1; Terminators 4X Cassette (pol III promoters and gRNAs); <SEQ ID NO: 128> TCTTTGAAAAGATAATGTATGATTATGCTTTCACTCATATTTATACAGAAACT TGATGTTTTCTTTCGAGTATATACAAGGTGATTACATGTACGTTTGAAGTAC AACTCTAGATTTTGTAGTGCCCTCTTGGGCTAGCGGTAAAGGTGCGCATTTT TTCACACCCTACAATGTTCTGTTCAAAAGATTTTGGTCAAACGCTGTAGAAG TGAAAGTTGGTGCGCATGTTTCGGCGTTCGAAACTTCTCCGCAGTGAAAGAT AAATGATCCTTGGTTTGGTTCTTTTTTCTTCCGTTTCAGAGCTAGAAATAGCAAGTTG Docket No.10034-324WO1 AAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTTGT TTTTTATGTCTGATCTGCCAATTGAACATAACATGGTAGTTACATATACTAGT AATATGGTTCGGCACACATTAAAAGTATAAAAACTATCTGAATTACGAATTA CATATATTGGTCATAAAAATCAATCAATCATCGTGTGTTTTATATGTCTCTTA TCTAAGTATAAGAATATCCATAGTTAATATTCACTTACGCTACCTTTTAACCT GTAATCATTGTCAACAGGATATGTTAACGACCCACATTGATAAACGCTAGTA TTTCTTTTTCCTCTTCTTATTGGCCGGCTGTCTCTATACTCCCCTATAGTCTG TTTCTTTTCGTTTCGATTGTTTTACGTTTGAGGCCTCGTGGCGCACATGGTA CGCTGTGGTGCTCGCGGCTGGGAACGAAACTCTGGGAGCTGCGATTGGCAC TTGAAACAAGCCTAACGTCCATGGTTTCAGAGCTAGAAATAGCAAGTTGAAATAAGG CTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTTGTTTTTTATG TCTGACCCCGTCTTCAATTACACTTCCCAACTGGGAACACCCCTCTTTATCGA CCCATTTTAGGTAATTTACCCTAGCCCATTGTCTCCATAAGGAATATTACCCT AACCCACAGTCCAGGGTGCCCAGGTCCTTCTTTGGCCAAATTTTAACTTCGG TCCTATGGCACAGCGGTAGCGCGTGAGATTGCAAATCTTAAGGTCCCGAGT TCGAATCTCGGTGGGACCTAGTTATTTTTGATAGATAATTTCGTGATGATTA GAAACTTAACGCAAAATAATGACGTCTTGCACCATTCGCGGTCAGGGGGGTTTC AGAGCTAGAAATAGCAAGTTGAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCA CCGAGTCGGTGCTTTTTTTGTTTTTTATGTCTCGTTGCATTACGTGGTGTCCGGTCG CTATTTCCTGGGTTTTCTGCGGCAGATTCGCACTGCGCGCCACAGCTGCAACAACT GCAGTGTTATTTCGGGTGCCAATTTAGCGTGCTTCGATCTAACTATTCTGTAAATTC TGTAGTGACTCTTTAGGGCGAAGTACGTATTTCATGATTTAAAATCCCCGTCTTCAA ATATACCGAAAAAAGAAACAAGACATTTTTTAGCAGTTTATGTACGCATTTTAAAAG CCGGGAAATCTTGGAACCGTGGCGCGCTGGATGGTTTCAGAGCTAGAAATAGCAAG TTGAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTT TGTTTTTTATGTCT SC SNR52; 20 bp inserts; gRNAs; 1stSC RPR1; 2ndYL SNR52; 3rdSC ZOD1; Terminators 6X Cassette (pol III promoters and gRNAs); <SEQ ID NO: 129> TCTTTGAAAAGATAATGTATGATTATGCTTTCACTCATATTTATACAGAAACT TGATGTTTTCTTTCGAGTATATACAAGGTGATTACATGTACGTTTGAAGTAC AACTCTAGATTTTGTAGTGCCCTCTTGGGCTAGCGGTAAAGGTGCGCATTTT TTCACACCCTACAATGTTCTGTTCAAAAGATTTTGGTCAAACGCTGTAGAAG TGAAAGTTGGTGCGCATGTTTCGGCGTTCGAAACTTCTCCGCAGTGAAAGAT AAATGATCCTTGCCGTTCACGAAGCCAGCCAGGTTTCAGAGCTAGAAATAGCAAGT TGAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTT GTTTTTTATGTCTGATCTGCCAATTGAACATAACATGGTAGTTACATATACTAG TAATATGGTTCGGCACACATTAAAAGTATAAAAACTATCTGAATTACGAATT ACATATATTGGTCATAAAAATCAATCAATCATCGTGTGTTTTATATGTCTCTT ATCTAAGTATAAGAATATCCATAGTTAATATTCACTTACGCTACCTTTTAACC TGTAATCATTGTCAACAGGATATGTTAACGACCCACATTGATAAACGCTAGT ATTTCTTTTTCCTCTTCTTATTGGCCGGCTGTCTCTATACTCCCCTATAGTCT GTTTCTTTTCGTTTCGATTGTTTTACGTTTGAGGCCTCGTGGCGCACATGGT Docket No.10034-324WO1 ACGCTGTGGTGCTCGCGGCTGGGAACGAAACTCTGGGAGCTGCGATTGGCA CTTGAAACAAGCCTAACGTCCATGGTTTCAGAGCTAGAAATAGCAAGTTGAAATAAG GCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTTGTTTTTTAT GTCTGACCCCGTCTTCAATTACACTTCCCAACTGGGAACACCCCTCTTTATCG ACCCATTTTAGGTAATTTACCCTAGCCCATTGTCTCCATAAGGAATATTACC CTAACCCACAGTCCAGGGTGCCCAGGTCCTTCTTTGGCCAAATTTTAACTTC GGTCCTATGGCACAGCGGTAGCGCGTGAGATTGCAAATCTTAAGGTCCCGA GTTCGAATCTCGGTGGGACCTAGTTATTTTTGATAGATAATTTCGTGATGAT TAGAAACTTAACGCAAAATAATGACGTCTTGCACCATTCGCGGTCAGGGGGGTT TCAGAGCTAGAAATAGCAAGTTGAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGG CACCGAGTCGGTGCTTTTTTTGTTTTTTATGTCTCGTTGCATTACGTGGTGTCCG GTCGCTATTTCCTGGGTTTTCTGCGGCAGATTCGCACTGCGCGCCACAGCTG CAACAACTGCAGTGTTATTTCGGGTGCCAATTTAGCGTGCTTCGATCTAACT ATTCTGTAAATTCTGTAGTGACTCTTTAGGGCGAAGTACGTATTTCATGATT TAAAATCCCCGTCTTCAAATATACCGAAAAAAGAAACAAGACATTTTTTAGC AGTTTATGTACGCATTTTAAAAGCCGGGAAATCTTGGAACCGTGGCGCGCTGG ATGGTTTCAGAGCTAGAAATAGCAAGTTGAAATAAGGCTAGTCCGTTATCAACTTGAAA AAGTGGCACCGAGTCGGTGCTTTTTTTGTTTTTTATGTCTATTACGTACCAAGAAG CATCTAATCAACTCCCAGATCACCACTATACATTTAAAAGTCATTGGTCAAT AACTATACTCGAGTATTGCCTCATCAAAGAAACAATCAAATATTATAGATAC TCACTCCATCACGTGATAATTTCACTGGTATGGAAAAGTGGAAAATTTTATA AAAAAAAATTTGATGCCTTTGGCATAGCTGAAACTTCGGCCCAATAGGATTG GAGAATATGTTTTCGCAGCGTTCTTACAATTAAATTGTGGTGGAAGTTCGAG ACTTGCGTAAACTATTTTTAATTTCTTGACTACGCGCACTTGAATCGCGTTTCAG AGCTAGAAATAGCAAGTTGAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACC GAGTCGGTGCTTTTTTTGTTTTTTATGTCTTATATATTTTTTATTCTAATGATTCA TTACAGCTATATACCTAGTAAGCCGGGTTATTGGCGTTCAATAAATCATACA CTTCTGAATCTTTGATTACAGTCATTCCTGACGACTGTCCGATGAAACGGCC TAAAAAAGTTAAAATGTCGGGAAATTTAGCTCTGGCCTAACGGTCAGACTGC AGTTACCCCTTGTCCGGCAGCCAGGCGTGCATGTTTCAGAGCTAGAAATAGCAAGT TGAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTT GTTTTTTATGTCT SC SNR52; 20 bp inserts; gRNAs; SC RPR1; YL SNR52; SC ZOD1; CA SNR52; YL RPR1; Terminators 4X Cassette (pol III promoters and ALL PP7 Aptamers); <SEQ ID NO: 130> TCTTTGAAAAGATAATGTATGATTATGCTTTCACTCATATTTATACAGAAACT TGATGTTTTCTTTCGAGTATATACAAGGTGATTACATGTACGTTTGAAGTAC AACTCTAGATTTTGTAGTGCCCTCTTGGGCTAGCGGTAAAGGTGCGCATTTT TTCACACCCTACAATGTTCTGTTCAAAAGATTTTGGTCAAACGCTGTAGAAG TGAAAGTTGGTGCGCATGTTTCGGCGTTCGAAACTTCTCCGCAGTGAAAGAT AAATGATCCTTGTCGCTGCAGACCTGCGAGCAGTTTCAGAGCTACCGGAGCAGAC GATATGGCGTCGCTCCGGTAGCAAGTTGAAATAAGGCTAGTCCGTTATCAACTTGGAG CAGACGATATGGCGTCGCTCCAAGTGGCACCGAGTCGGTGCTTTTTTTGTTTTTTATG Docket No.10034-324WO1 TCTGATCTGCCAATTGAACATAACATGGTAGTTACATATACTAGTAATATGGT TCGGCACACATTAAAAGTATAAAAACTATCTGAATTACGAATTACATATATT GGTCATAAAAATCAATCAATCATCGTGTGTTTTATATGTCTCTTATCTAAGTA TAAGAATATCCATAGTTAATATTCACTTACGCTACCTTTTAACCTGTAATCAT TGTCAACAGGATATGTTAACGACCCACATTGATAAACGCTAGTATTTCTTTT TCCTCTTCTTATTGGCCGGCTGTCTCTATACTCCCCTATAGTCTGTTTCTTTT CGTTTCGATTGTTTTACGTTTGAGGCCTCGTGGCGCACATGGTACGCTGTGG TGCTCGCGGCTGGGAACGAAACTCTGGGAGCTGCGATTGGCACTTGAAACA AGCCTAACGTCCATGGTTTCAGAGCTACCGGAGCAGACGATATGGCGTCGCTCCGGT AGCAAGTTGAAATAAGGCTAGTCCGTTATCAACTTGGAGCAGACGATATGGCGTCGCT CCAAGTGGCACCGAGTCGGTGCTTTTTTTGTTTTTTATGTCTGACCCCGTCTTCAA TTACACTTCCCAACTGGGAACACCCCTCTTTATCGACCCATTTTAGGTAATTT ACCCTAGCCCATTGTCTCCATAAGGAATATTACCCTAACCCACAGTCCAGGG TGCCCAGGTCCTTCTTTGGCCAAATTTTAACTTCGGTCCTATGGCACAGCGG TAGCGCGTGAGATTGCAAATCTTAAGGTCCCGAGTTCGAATCTCGGTGGGA CCTAGTTATTTTTGATAGATAATTTCGTGATGATTAGAAACTTAACGCAAAAT AATGACGTCTTGCACCATTCGCGGTCAGGGGGGTTTCAGAGCTACCGGAGCAGAC GATATGGCGTCGCTCCGGTAGCAAGTTGAAATAAGGCTAGTCCGTTATCAACTTGGAG CAGACGATATGGCGTCGCTCCAAGTGGCACCGAGTCGGTGCTTTTTTTGTTTTTTATG TCTCGTTGCATTACGTGGTGTCCGGTCGCTATTTCCTGGGTTTTCTGCGGCA GATTCGCACTGCGCGCCACAGCTGCAACAACTGCAGTGTTATTTCGGGTGC CAATTTAGCGTGCTTCGATCTAACTATTCTGTAAATTCTGTAGTGACTCTTTA GGGCGAAGTACGTATTTCATGATTTAAAATCCCCGTCTTCAAATATACCGAA AAAAGAAACAAGACATTTTTTAGCAGTTTATGTACGCATTTTAAAAGCCGGG AAATCTTGGAACCGTGGCGCGCTGGATGGTTTCAGAGCTACCGGAGCAGACGATAT GGCGTCGCTCCGGTAGCAAGTTGAAATAAGGCTAGTCCGTTATCAACTTGGAGCAGAC GATATGGCGTCGCTCCAAGTGGCACCGAGTCGGTGCTTTTTTTGTTTTTTATGTCT SC SNR52; 20 bp inserts; gRNAs (PP71,3); SC RPR1; YL SNR52; SC ZOD1; Terminators 4X Cassette (pol III promoters and ALL MS2 Aptamers); <SEQ ID NO: 131> TCTTTGAAAAGATAATGTATGATTATGCTTTCACTCATATTTATACAGAAACT TGATGTTTTCTTTCGAGTATATACAAGGTGATTACATGTACGTTTGAAGTAC AACTCTAGATTTTGTAGTGCCCTCTTGGGCTAGCGGTAAAGGTGCGCATTTT TTCACACCCTACAATGTTCTGTTCAAAAGATTTTGGTCAAACGCTGTAGAAG TGAAAGTTGGTGCGCATGTTTCGGCGTTCGAAACTTCTCCGCAGTGAAAGAT AAATGATCCTTGAAACAAGCCTAACGTCCATGGTTTCAGAGCTAGGCCAACATGAG GATCACCCATGTCTGCAGGGCCTAGCAAGTTGAAATAAGGCTAGTCCGTTATCAACTTG GCCAACATGAGGATCACCCATGTCTGCAGGGCCAAGTGGCACCGAGTCGGTGCTTTT TTTGTTTTTTATGTCTGATCTGCCAATTGAACATAACATGGTAGTTACATATAC TAGTAATATGGTTCGGCACACATTAAAAGTATAAAAACTATCTGAATTACGA ATTACATATATTGGTCATAAAAATCAATCAATCATCGTGTGTTTTATATGTCT CTTATCTAAGTATAAGAATATCCATAGTTAATATTCACTTACGCTACCTTTTA ACCTGTAATCATTGTCAACAGGATATGTTAACGACCCACATTGATAAACGCT Docket No.10034-324WO1 AGTATTTCTTTTTCCTCTTCTTATTGGCCGGCTGTCTCTATACTCCCCTATAG TCTGTTTCTTTTCGTTTCGATTGTTTTACGTTTGAGGCCTCGTGGCGCACAT GGTACGCTGTGGTGCTCGCGGCTGGGAACGAAACTCTGGGAGCTGCGATTG GCACTTGAAACAAGCCTAACGTCCATGGTTTCAGAGCTAGGCCAACATGAGGATCA CCCATGTCTGCAGGGCCTAGCAAGTTGAAATAAGGCTAGTCCGTTATCAACTTGGCCA ACATGAGGATCACCCATGTCTGCAGGGCCAAGTGGCACCGAGTCGGTGCTTTTTTTG TTTTTTATGTCTGACCCCGTCTTCAATTACACTTCCCAACTGGGAACACCCCT CTTTATCGACCCATTTTAGGTAATTTACCCTAGCCCATTGTCTCCATAAGGA ATATTACCCTAACCCACAGTCCAGGGTGCCCAGGTCCTTCTTTGGCCAAATT TTAACTTCGGTCCTATGGCACAGCGGTAGCGCGTGAGATTGCAAATCTTAAG GTCCCGAGTTCGAATCTCGGTGGGACCTAGTTATTTTTGATAGATAATTTCG TGATGATTAGAAACTTAACGCAAAATAATGACGTCTTGCACCATTCGCGGTCA GGGGGGTTTCAGAGCTAGGCCAACATGAGGATCACCCATGTCTGCAGGGCCTAGCAA GTTGAAATAAGGCTAGTCCGTTATCAACTTGGCCAACATGAGGATCACCCATGTCTGCA GGGCCAAGTGGCACCGAGTCGGTGCTTTTTTTGTTTTTTATGTCTCGTTGCATTAC GTGGTGTCCGGTCGCTATTTCCTGGGTTTTCTGCGGCAGATTCGCACTGCGC GCCACAGCTGCAACAACTGCAGTGTTATTTCGGGTGCCAATTTAGCGTGCTT CGATCTAACTATTCTGTAAATTCTGTAGTGACTCTTTAGGGCGAAGTACGTA TTTCATGATTTAAAATCCCCGTCTTCAAATATACCGAAAAAAGAAACAAGAC ATTTTTTAGCAGTTTATGTACGCATTTTAAAAGCCGGGAAATCTTGGAACCGT GGCGCGCTGGATGGTTTCAGAGCTAGGCCAACATGAGGATCACCCATGTCTGCAGGG CCTAGCAAGTTGAAATAAGGCTAGTCCGTTATCAACTTGGCCAACATGAGGATCACCCA TGTCTGCAGGGCCAAGTGGCACCGAGTCGGTGCTTTTTTTGTTTTTTATGTCT SC SNR52; 20 bp inserts; gRNAs (MS21,3); SC RPR1; YL SNR52; SC ZOD1; Terminators 2X Cassette (pol III promoters and MS2 and PP7 Aptamers); <SEQ ID NO: 132> TCTTTGAAAAGATAATGTATGATTATGCTTTCACTCATATTTATACAGAAACT TGATGTTTTCTTTCGAGTATATACAAGGTGATTACATGTACGTTTGAAGTAC AACTCTAGATTTTGTAGTGCCCTCTTGGGCTAGCGGTAAAGGTGCGCATTTT TTCACACCCTACAATGTTCTGTTCAAAAGATTTTGGTCAAACGCTGTAGAAG TGAAAGTTGGTGCGCATGTTTCGGCGTTCGAAACTTCTCCGCAGTGAAAGAT AAATGATCCTTGGTTTGGTTCTTTTTTCTTCCGTTTCAGAGCTAGGCCAACATGAGG ATCACCCATGTCTGCAGGGCCTAGCAAGTTGAAATAAGGCTAGTCCGTTATCAACTTGG CCAACATGAGGATCACCCATGTCTGCAGGGCCAAGTGGCACCGAGTCGGTGCTTTTT TTGTTTTTTATGTCTGATCTGCCAATTGAACATAACATGGTAGTTACATATACT AGTAATATGGTTCGGCACACATTAAAAGTATAAAAACTATCTGAATTACGAA TTACATATATTGGTCATAAAAATCAATCAATCATCGTGTGTTTTATATGTCTC TTATCTAAGTATAAGAATATCCATAGTTAATATTCACTTACGCTACCTTTTAA CCTGTAATCATTGTCAACAGGATATGTTAACGACCCACATTGATAAACGCTA GTATTTCTTTTTCCTCTTCTTATTGGCCGGCTGTCTCTATACTCCCCTATAGT CTGTTTCTTTTCGTTTCGATTGTTTTACGTTTGAGGCCTCGTGGCGCACATG GTACGCTGTGGTGCTCGCGGCTGGGAACGAAACTCTGGGAGCTGCGATTGG CACTTGAAACAAGCCTAACGTCCATGGTTTCAGAGCTACCGGAGCAGACGATATG Docket No.10034-324WO1 GCGTCGCTCCGGTAGCAAGTTGAAATAAGGCTAGTCCGTTATCAACTTGGAGCAGA CGATATGGCGTCGCTCCAAGTGGCACCGAGTCGGTGCTTTTTTTGTTTTTTATGTCT SC SNR52; 20 bp inserts; gRNAs (MS21,3 and PP71,3); SC RPR1; Terminators 4X Cassette (pol III promoters and MS2 and PP7 Aptamers); <SEQ ID NO: 133> TCTTTGAAAAGATAATGTATGATTATGCTTTCACTCATATTTATACAGAAACT TGATGTTTTCTTTCGAGTATATACAAGGTGATTACATGTACGTTTGAAGTAC AACTCTAGATTTTGTAGTGCCCTCTTGGGCTAGCGGTAAAGGTGCGCATTTT TTCACACCCTACAATGTTCTGTTCAAAAGATTTTGGTCAAACGCTGTAGAAG TGAAAGTTGGTGCGCATGTTTCGGCGTTCGAAACTTCTCCGCAGTGAAAGAT AAATGATCCTTGTCGCTGCAGACCTGCGAGCAGTTTCAGAGCTACCGGAGCAGAC GATATGGCGTCGCTCCGGTAGCAAGTTGAAATAAGGCTAGTCCGTTATCAACTTGG AGCAGACGATATGGCGTCGCTCCAAGTGGCACCGAGTCGGTGCTTTTTTTGTTTTT TATGTCTGATCTGCCAATTGAACATAACATGGTAGTTACATATACTAGTAATA TGGTTCGGCACACATTAAAAGTATAAAAACTATCTGAATTACGAATTACATA TATTGGTCATAAAAATCAATCAATCATCGTGTGTTTTATATGTCTCTTATCTA AGTATAAGAATATCCATAGTTAATATTCACTTACGCTACCTTTTAACCTGTAA TCATTGTCAACAGGATATGTTAACGACCCACATTGATAAACGCTAGTATTTC TTTTTCCTCTTCTTATTGGCCGGCTGTCTCTATACTCCCCTATAGTCTGTTTC TTTTCGTTTCGATTGTTTTACGTTTGAGGCCTCGTGGCGCACATGGTACGCT GTGGTGCTCGCGGCTGGGAACGAAACTCTGGGAGCTGCGATTGGCACTTGA AACAAGCCTAACGTCCATGGTTTCAGAGCTACCGGAGCAGACGATATGGCGTCGC TCCGGTAGCAAGTTGAAATAAGGCTAGTCCGTTATCAACTTGGAGCAGACGATATG GCGTCGCTCCAAGTGGCACCGAGTCGGTGCTTTTTTTGTTTTTTATGTCTGACCCC GTCTTCAATTACACTTCCCAACTGGGAACACCCCTCTTTATCGACCCATTTTA GGTAATTTACCCTAGCCCATTGTCTCCATAAGGAATATTACCCTAACCCACA GTCCAGGGTGCCCAGGTCCTTCTTTGGCCAAATTTTAACTTCGGTCCTATGG CACAGCGGTAGCGCGTGAGATTGCAAATCTTAAGGTCCCGAGTTCGAATCT CGGTGGGACCTAGTTATTTTTGATAGATAATTTCGTGATGATTAGAAACTTA ACGCAAAATAATGACGTCTTGCCGTTCACGAAGCCAGCCAGGTTTCAGAGCTAG GCCAACATGAGGATCACCCATGTCTGCAGGGCCTAGCAAGTTGAAATAAGGCTAGTCC GTTATCAACTTGGCCAACATGAGGATCACCCATGTCTGCAGGGCCAAGTGGCACCGAG TCGGTGCTTTTTTTGTTTTTTATGTCTCGTTGCATTACGTGGTGTCCGGTCGCTA TTTCCTGGGTTTTCTGCGGCAGATTCGCACTGCGCGCCACAGCTGCAACAAC TGCAGTGTTATTTCGGGTGCCAATTTAGCGTGCTTCGATCTAACTATTCTGT AAATTCTGTAGTGACTCTTTAGGGCGAAGTACGTATTTCATGATTTAAAATC CCCGTCTTCAAATATACCGAAAAAAGAAACAAGACATTTTTTAGCAGTTTAT GTACGCATTTTAAAAGCCGGGAAATCTTGGAACCGTGGCGCGCTGGATGGTTTC AGAGCTAGGCCAACATGAGGATCACCCATGTCTGCAGGGCCTAGCAAGTTGAAATAAG GCTAGTCCGTTATCAACTTGGCCAACATGAGGATCACCCATGTCTGCAGGGCCAAGTG GCACCGAGTCGGTGCTTTTTTTGTTTTTTATGTCT SC SNR52; 20 bp inserts; gRNAs (MS21,3 and PP71,3); SC RPR1; YL SNR52; SC ZOD1; Terminators

Claims

Docket No.10034-324WO1 CLAIMS What is claimed is:

1. A system for simultaneous transcriptional activation or transcriptional repression in a cell comprising: a catalytically inactive nuclease; an RNA binding protein; at least two bacteriophage aptamers; a multi-sgRNA cassette, wherein the multi-sgRNA cassette comprises two to six target gene sgRNAs; and a transcriptional activator or a transcriptional repressor; wherein the RNA binding protein is fused to the transcriptional activator or the transcriptional repressor.

2. The system of claim 1, wherein the catalytically inactive nuclease is a deactivated Cas protein (dCas).

3. The system of claim 2, wherein the deactivated Cas protein is a dCas9 or a dCas12.

4. The system of any one of claims 1 to 3, wherein the RNA binding protein comprises MS2 phage coat protein (MCP) or PP7 phage coat protein (PCP).

5. The system of any one of the claims 1-4, wherein the at least two bacteriophage aptamers comprise MS2 stem loops and / or PP7 stem loops.

6. The system of any one of the claims 1-5, wherein the transcriptional activator is a VPR protein.

7. The system of any one of the claims 1-5, wherein the transcriptional repressor is an MXI1 protein.

8. The system of any one of the claims 1-7, wherein the cell comprises a eukaryotic cell.Docket No.10034-324WO1 9. The system of claim 8, wherein the eukaryotic cell is a Saccharomyces cerevisiae (S. cerevisiae) cell.

10. A method for high throughput transcriptional activation or transcriptional repression of target genes within a cell, comprising: introducing a multi-sgRNA cassette comprising two to six target gene sgRNAs in the cell, wherein each target gene sgRNA comprises a bacteriophage aptamer; and co-expressing a catalytically inactive nuclease with a transcriptional activator or a transcriptional repressor and an RNA binding protein, wherein the multi-sgRNA cassette controls the transcriptional activation or transcriptional repression of two to six target genes simultaneously in the cell.

11. The method of claim 10, wherein the catalytically inactive nuclease is a deactivated Cas protein (dCas).

12. The method of claim 11, wherein the deactivated Cas protein is a dCas9 or a dCas12.

13. The method of any one of the claims 10-12, wherein the RNA binding protein comprises MS2 phage coat protein (MCP) or PP7 phage coat protein (PCP).

14. The method of any one of the claims 10-13, wherein the bacteriophage aptamer comprises MS2 stem loop or PP7 stem loop.

15. The method of any one of the claims 10-14, wherein the transcriptional activator is a VPR protein.

16. The method of any one of the claims 10-14, wherein the transcriptional repressor is a MXI1protein.

17. The method of any one of the claims 10-16, wherein the cell comprises a eukaryotic cell.Docket No.10034-324WO1 18. The method of claim 17, wherein the eukaryotic cell is a Saccharomyces cerevisiae (S. cerevisiae) cell.

19. A method for high throughput simultaneous transcriptional activation and transcriptional repression of target genes within a cell, comprising: introducing a multi-sgRNA cassette comprising two to six target gene sgRNAs in the cell, wherein each target gene sgRNA comprises a bacteriophage aptamer, wherein each of the two to six target gene sgRNAs is flanked by a Pol III promoter; and co-expressing a catalytically inactive nuclease with a transcriptional activator or a transcriptional repressor and an RNA binding protein, wherein the multi-sgRNA cassette controls the simultaneous transcriptional activation and transcriptional repression of two to six target genes in the cell.

20. The method of claim 19, wherein the Pol III promoter comprises SNR52, RPR1, or ZOD1.

21. The method of claim 19, wherein the catalytically inactive nuclease is a deactivated Cas protein (dCas).

22. The method of claim 21, wherein the deactivated Cas protein is a dCas9 or a dCas12.

23. The method of any one of the claims 19-22, wherein the RNA binding protein comprises MS2 phage coat protein (MCP) or PP7 phage coat protein (PCP).

24. The method of any one of the claims 19-23, wherein the bacteriophage aptamer comprises MS2 stem loop or PP7 stem loop.

25. The method of any one of the claims 19-24, wherein the transcriptional activator is a VPR protein.

26. The method of any one of the claims 19-24, wherein the transcriptional repressor is a MXI1protein.

27. The method of any one of the claims 19-26, wherein the cell comprises a eukaryotic cell.Docket No.10034-324WO1 28. The method of claim 27, wherein the eukaryotic cell is a Saccharomyces cerevisiae (S. cerevisiae) cell.

Images