Method for improving pigment gland character and gossypol character of cotton seed and use thereof

Abstract

Provided are a method for improving the pigment gland character and gossypol character of a cotton seed and the use thereof. According to the method, a specific promoter of a cotton seed is used to specifically inhibit the expression and activity of the Gl2 / Gl3 protein during seed development to obtain a new cotton, the seeds of which have no pigment gland in seeds and the plants of which have a normal pigment gland, wherein the seeds thereof have no gossypol content, and the other tissues thereof have a normal gossypol content.

Description

Method for improving cotton seed pigment gland traits and gossypol traits and use thereof

[0001] This application claims the benefit of a prior Chinese application filed on October 27, 2023, with application number 202311418083.1, entitled “Methods for improving pigment gland traits and gossypol traits of cotton seeds and uses thereof,” the entire contents of which are incorporated herein by reference. Technical Field

[0002] The present invention belongs to the field of plant bioengineering and specifically relates to a method for improving cotton seed pigment gland traits and gossypol traits using a cotton seed-specific promoter and its use. Background Art

[0003] Cotton is not only an important natural fiber crop worldwide, but also a significant oilseed and high-protein food crop. China cultivates approximately 50 million mu (approximately 1.5 million hectares) of cotton annually, producing over 10 million tons of seeds, containing approximately 2 million tons of oil and 2 million tons of protein. However, the presence of high levels of gossypol in cotton seeds significantly limits their use as a food and feed ingredient.

[0004] Currently, both upland cotton plants and cotton seeds, which are widely cultivated around the world, contain large amounts of gossypol. Gossypol is a sesquiterpenoid secondary metabolite that is synthesized during the development of cotton pigment glands (referred to as "glands") and accumulates in the cotton glands. Gossypol is essential for cotton plants to resist insect pests. However, secondary metabolites such as gossypol contained in cotton seeds are harmful to humans and monogastric animals, seriously affecting their safety as food ingredients, bringing complexity to processing and detoxification, and consumer concerns. Therefore, maintaining the gossypol content of plants unchanged, eradicating toxic substances in cotton seeds in a targeted manner, and making cotton an integrated "grain, cotton, and oil" crop are scientific problems that need to be solved urgently internationally.

[0005] Traditional breeding primarily involves introducing low-phenol traits into other superior lines using phenol-free strains as parents. Currently selected low-phenol varieties include Xiangmian 18, Zhongmian 22, Lumian 12, Zhemian 10, Jinmian 22, Wanmian 18, Giza 77, and Giza 81, with seed gossypol contents of 0.0304%, 0.0051%, 0.008%, 0.006%, 0.002%, 0.00037%, 0.023%, and 0.021%, respectively. With the exception of Wanmian 18, the seed gossypol contents of most of these varieties, while below the World Health Organization standard of ≤600 mg / kg, are higher than the 50 mg / kg standard for first-grade finished cottonseed oil in my country's latest national standard, GB / T1537-2019, posing a potential safety risk. More importantly, since the glandless varieties have no gossypol or have very low gossypol content, they are easily harmed by rats, rabbits, leaf-feeding pests, etc., and have not yet been widely promoted and applied.

[0006] Using bioengineering methods, a large number of genetic improvement practices have been carried out at home and abroad, but no substantial progress has been made so far. For example, with the help of RNAi, American scientists use seed-specific promoters to drive the dsRNA of the CAD gene, specifically silence seed glandular genes and cotton phenol synthesis genes, and create new cotton germplasms with normal seed low phenol plants (Sunilkumar G, Campbell LAM, Puckhaber L, et al. Engineering cottonseed for use in human nutrition by tissue-specific reduction of toxic gossypol. Proceedings of the National Academy of Sciences, 2006, 103 (48): 18054-18059). The cotton breeding team of Zhejiang University silenced the key gene Gl2 / Gl3 of cotton gland synthesis by RNAi method, and also created similar cotton germplasm (Gao W, Zhu X, Ding L, et al. Development of the engineered "glanded plant and glandless seed" cotton. Food Chemistry: Molecular Sciences, 2022, 5: 100130.). However, the above methods can only reduce but not completely block the translation of target genes, so there are still a small amount of glands and low levels of gossypol in the seeds, and other secondary metabolites in the glands still pose a great threat to the health of humans and monogastric animals.

[0007] Therefore, there is an urgent need to develop a more effective method to reduce the gossypol content in cotton seeds, so as to achieve zero gossypol in cotton seeds while leaving the gossypol content in other tissues of the cotton plant unaffected.

[0008] Summary of the Invention

[0009] The present invention provides a new method for improving the pigment gland traits and gossypol traits of cotton seeds. This method can achieve the goal of producing cotton seeds without pigment glands and with zero gossypol content, while maintaining the pigment glands and gossypol content of the cotton plant. Cotton plants created using this method are able to normally resist pests and diseases, and the resulting seeds, because they do not contain gossypol, are significantly superior to "low-phenol cotton" in terms of food safety. The new cotton combines the advantages of both pigment gland-free and pigment gland-containing cotton, without compromising the plant's ability to resist pests and diseases. It also completely eliminates the dephenolization process during cotton seed utilization, providing a large amount of high-quality protein and oil resources for humans and livestock, greatly improving the economic benefits of cotton cultivation.

[0010] Accordingly, in a first aspect, the present invention provides a method for inhibiting the formation of pigment glands in cotton seeds, the method comprising causing the cotton seeds to express an inhibitory molecule that inhibits the expression and / or activity of Gl2 / Gl3 protein, wherein the inhibitory molecule is expressed by a cotton seed-specific promoter.

[0011] At the same time, the present invention also provides a method for reducing the gossypol content in cotton seeds, which comprises causing the cotton seeds to express an inhibitory molecule that inhibits the expression and / or activity of Gl2 / Gl3 protein, wherein the inhibitory molecule is expressed by a cotton seed-specific promoter.

[0012] Seed-specific promoters suitable for use in the methods of the present invention include:

[0013] (1) Initiating expression of inhibitory molecules no later than the expression time of Gl2 / Gl3 proteins during seed development in wild-type cotton;

[0014] (2) ensuring that the expression level of the inhibitory molecule is no less than the sum of the expression levels of the wild-type Gl2 and Gl3 proteins; and

[0015] (3) The expression of inhibitory molecules is initiated only during the development of cotton seeds, and does not or substantially does not initiate after the germination of mature seeds and during other stages of cotton plant development.

[0016] In some embodiments, the seed-specific promoter is a promoter derived from the OLE_A, OLE_D, or ALB2S gene. In some preferred embodiments, the seed-specific promoter comprises a nucleotide sequence having at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to SEQ ID NOs: 1-3.

[0017] In some embodiments, the inhibitory molecule is selected from: dsRNA, shRNA, antisense nucleic acid, small interfering RNA (siRNA), microRNA (microRNA or miRNA), antibody or antigen-binding fragment thereof, small molecule ligand, or a combination thereof that inhibits or silences a gene.

[0018] In some embodiments, the inhibitory molecule is a dsRNA that targets the mRNA transcribed from the G12 / G13 gene. In some preferred embodiments, the nucleotide sequence encoding the dsRNA comprises a nucleotide sequence having at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to SEQ ID NO: 28, 59, or 70.

[0019] In some embodiments, the inhibitory molecule is a microRNA that targets an mRNA transcribed from a Gl2 / Gl3 gene. In some preferred embodiments, the nucleotide sequence encoding the microRNA comprises a nucleotide sequence that has at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to SEQ ID NO: 44.

[0020] In some specific embodiments, the method described herein comprises integrating into the genome of the cotton a nucleotide sequence having at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% sequence identity to SEQ ID NO: 29, 45, 60, 71, 76 or 77.

[0021] In some specific embodiments, the method of the present invention comprises the following steps:

[0022] (1) transforming the nucleotide sequence containing the seed-specific promoter and encoding the inhibitory molecule into Agrobacterium to obtain Agrobacterium carrying the nucleotide sequence; and

[0023] (2) contacting cotton cells, seeds, tissues, organs or plants with the Agrobacterium carrying the nucleotide sequence in step (1), thereby introducing the nucleotide sequence into the cotton cells, seeds, tissues, organs or plants.

[0024] In some embodiments, the methods described herein comprise causing cotton seeds to express two or more inhibitory molecules that inhibit the expression and / or activity of G12 / G13 proteins. In some embodiments, expression of the two or more inhibitory molecules is initiated by the same cotton seed-specific promoter. In some embodiments, expression of the two or more inhibitory molecules is initiated by different cotton seed-specific promoters. In some preferred embodiments, the cotton seed-specific promoters are each independently selected from promoters derived from the OLE_A, OLE_D, or ALB2S genes.

[0025] In some embodiments, the methods described herein result in the abortion of pigment glands in cotton seeds compared to pigment glands in wild-type cotton seeds, and the development of pigment glands in cotton plants is not affected.

[0026] In some embodiments, the methods described herein reduce the gossypol content in cotton seeds by 99%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, or 100% compared to the gossypol content of wild-type cotton seeds.

[0027] In some embodiments, the methods described herein result in gossypol levels in tissues of a cotton plant that are no different or substantially no different than the gossypol levels in tissues of a wild-type cotton plant.

[0028] In a second aspect, the present invention provides a cotton cell, seed, tissue, organ or plant obtained by the method of the first aspect of the present invention.

[0029] In a third aspect, the present invention provides cotton cells, seeds, tissues, organs or plants comprising a nucleotide sequence encoding an inhibitory molecule that inhibits the expression and / or activity of Gl2 / Gl3 protein, wherein the inhibitory molecule is expressed from a cotton seed-specific promoter.

[0030] In some embodiments, the seed-specific promoter:

[0031] (1) Initiating expression of inhibitory molecules no later than the expression time of Gl2 / Gl3 proteins during seed development in wild-type cotton;

[0032] (2) ensuring that the expression level of the inhibitory molecule is no less than the sum of the expression levels of the wild-type Gl2 and Gl3 proteins; and

[0033] (3) The expression of inhibitory molecules is initiated only during the development of cotton seeds, and does not or substantially does not initiate after the germination of mature seeds and during other stages of cotton plant development.

[0034] In some embodiments, the seed-specific promoter is a promoter derived from the OLE_A, OLE_D, or ALB2S gene. In some preferred embodiments, the seed-specific promoter comprises a nucleotide sequence having at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to SEQ ID NOs: 1-3.

[0035] In some embodiments, the inhibitory molecule is selected from: dsRNA, shRNA, antisense nucleic acid, small interfering RNA (siRNA), microRNA (microRNA or miRNA), antibody or antigen-binding fragment thereof, small molecule ligand, or a combination thereof that inhibits or silences a gene.

[0036] In some embodiments, the inhibitory molecule is a dsRNA that targets the mRNA transcribed from the G12 / G13 gene. In some preferred embodiments, the nucleotide sequence encoding the dsRNA comprises a nucleotide sequence having at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to SEQ ID NO: 28, 59, or 70.

[0037] In some embodiments, the inhibitory molecule is a microRNA that targets an mRNA transcribed from a Gl2 / Gl3 gene. In some preferred embodiments, the nucleotide sequence encoding the microRNA comprises a nucleotide sequence that has at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to SEQ ID NO: 44.

[0038] In some specific embodiments, the cotton cell, seed, tissue, organ or plant of the third aspect of the invention is obtained by integrating a nucleotide sequence having at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% sequence identity to SEQ ID NO: 29, 45, 60, 71, 76 or 77 into the genome of cotton.

[0039] In some specific embodiments, the cotton cell, seed, tissue, organ or plant of the third aspect of the present invention is obtained by the following steps:

[0040] (1) transforming the nucleotide sequence containing the seed-specific promoter and encoding the inhibitory molecule into Agrobacterium to obtain Agrobacterium carrying the nucleotide sequence; and

[0041] (2) contacting cotton cells, seeds, tissues, organs or plants with the Agrobacterium carrying the nucleotide sequence in step (1), thereby obtaining the cotton cells, seeds, tissues, organs or plants.

[0042] In some embodiments, the cotton cells, seeds, tissues, organs, or plants of the third aspect of the present invention contain nucleotide sequences encoding inhibitory molecules that inhibit the expression and / or activity of two or more G12 / G13 proteins. In some embodiments, expression of the two or more inhibitory molecules is initiated by the same cotton seed-specific promoter. In some embodiments, expression of the two or more inhibitory molecules is initiated by different cotton seed-specific promoters. In some preferred embodiments, the cotton seed-specific promoters are each independently selected from a promoter derived from the OLE_A, OLE_D, or ALB2S gene.

[0043] In a fourth aspect, the present invention provides a nucleic acid construct comprising, from 5' to 3', a cotton seed-specific promoter and a nucleotide sequence encoding an inhibitory molecule that inhibits the expression and / or activity of a Gl2 / Gl3 protein. In some embodiments, the nucleic acid construct further comprises a terminator.

[0044] In some embodiments, the seed-specific promoter is a promoter derived from the OLE_A, OLE_D, or ALB2S gene. In some preferred embodiments, the seed-specific promoter comprises a nucleotide sequence having at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to SEQ ID NOs: 1-3.

[0045] In some embodiments, the inhibitory molecule is selected from: dsRNA, shRNA, antisense nucleic acid, small interfering RNA (siRNA), microRNA (microRNA or miRNA), antibody or antigen-binding fragment thereof, small molecule ligand, or a combination thereof that inhibits or silences a gene.

[0046] In some embodiments, the inhibitory molecule is a dsRNA that targets the mRNA transcribed from the G12 / G13 gene. In some preferred embodiments, the nucleotide sequence encoding the dsRNA comprises a nucleotide sequence having at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to SEQ ID NO: 28, 59, or 70.

[0047] In some embodiments, the inhibitory molecule is a microRNA that targets an mRNA transcribed from a Gl2 / Gl3 gene. In some preferred embodiments, the nucleotide sequence encoding the microRNA comprises a nucleotide sequence that has at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to SEQ ID NO: 44.

[0048] In some specific embodiments, the nucleic acid construct comprises a nucleotide sequence having at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% sequence identity to SEQ ID NO:29, 45, 60, 71, 76 or 77.

[0049] In some embodiments, the nucleic acid construct comprises a nucleotide sequence encoding two or more inhibitory molecules that inhibit the expression and / or activity of the G12 / G13 protein. In some embodiments, the two or more inhibitory molecules are operably linked to the same cotton seed-specific promoter. In some embodiments, the two or more inhibitory molecules are operably linked to different cotton seed-specific promoters. In some preferred embodiments, the cotton seed-specific promoters are each independently selected from a promoter derived from the OLE_A, OLE_D, or ALB2S gene.

[0050] In a fifth aspect, the present invention provides the nucleic acid construct according to the fourth aspect of the present invention, which is used to inhibit the formation of pigment glands in cotton seeds.

[0051] In a sixth aspect, the present invention provides the nucleic acid construct according to the fourth aspect of the present invention, which is used to reduce the gossypol content in cotton seeds. BRIEF DESCRIPTION OF THE DRAWINGS

[0052] Figure 1 shows the development of cotton pigment glands. Figure 1a shows the pseudo-chronological process of cotton immature embryo gland development. Figure 1b shows the process of gland morphogenesis in the cotyledon of upland cotton immature embryo. Figure 1c shows the development of cotton immature embryo cotyledons.

[0053] FIG2 shows the results of measuring gossypol content in cotton immature embryos at different developmental stages.

[0054] Figure 3 shows the number of glands and gossypol content in plants with different Gl2 / Gl3 genotypes. Figure 3a shows the true leaf phenotypes of plants with different Gl2 / Gl3 genotypes. Figure 3b shows the gossypol content in different tissues of Gl2 / Gl3 loss-of-function mutants (gl2gl2gl3gl3). Figure 3c shows the statistical results of the number of glands in the second true leaf after germination of plants with different Gl2 / Gl3 genotypes. Figure 3d shows the results of the measurement of gossypol content in the second true leaf after germination of plants with different Gl2 / Gl3 genotypes.

[0055] Figure 4 shows that secondary metabolites such as gossypol are synthesized and accumulated in situ in pigment glands. Figure 4a is a schematic diagram of non-glandular cell sampling. Figure 4b shows the results of gossypol content determination in immature embryos and non-glandular cells. Figure 4c shows the transcriptome expression profiles of gossypol synthesis pathway genes in glandular cells in TM-1 immature embryos, leaves, and other parts, as well as glandular mutant strains. Figure 4d shows the GUS staining results of glands in immature embryos, leaves, and roots of transgenic strains after the promoter of CDNC, a key gene in the gossypol synthesis pathway, was fused to the GUS gene and introduced into the plant.

[0056] FIG5 shows the expression levels of Gl2 / Gl3 genes in glandular and non-glandular tissues.

[0057] FIG6 shows the expression levels of candidate promoter genes in different tissues of TM-1.

[0058] FIG. 7 shows the gene expression levels of seed-specifically expressed genes Ghα-globulin, GhOLE1_D, GhALB2S, and Gl2+Gl3 genes during seed development.

[0059] FIG8 shows a schematic diagram of the expression vector of the seed-specific promoter fused with the GUS gene.

[0060] FIG9 shows the results of GUS staining of seed-specific promoter-GUS transgenic cotton.

[0061] FIG10 shows a schematic diagram of the proGhOLE1_D::dsGhGl2-RNAi, proGhOLE1_A::dsGhGl2-RNAi and proGhALB2S::dsGhGl2-RNAi expression vectors.

[0062] FIG11 shows the PCR identification results of proGhOLE1_D::dsGhGl2-RNAi T1 generation transgenic materials.

[0063] FIG12 shows the phenotypes of seeds, leaves and stem glands of proGhOLE1_D::dsGhGl2-RNAi transgenic materials.

[0064] FIG13 shows a schematic diagram of the proGhOLE1_A::GhGl2 / GhGl3-miRNA, proGhOLE1_D::GhGl2-miRNA and proGhALB2S::GhGl2-miRNA expression vectors. DETAILED DESCRIPTION

[0065] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs.

[0066] In order to make the present disclosure more easily understood, certain terms are first defined below. The following terms and additional definitions of other terms are set forth throughout the specification.

[0067] As used in this specification and the appended claims, the singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise.

[0068] As used herein, the terms "comprising," "having," "including," and "containing" are to be construed as open-ended terms (ie, meaning "including, but not limited to, ").

[0069] As used herein, "and / or" refers to and includes any and all possible combinations of one or more of the associated listed items. For example, a composition comprising A and / or B can be interpreted as a composition comprising A, a composition comprising B, or a composition comprising A and B.

[0070] All numerical designations, such as pH, temperature, time, concentration, and molecular weight, including ranges, are approximate and are optionally varied (+) or (-) in increments of 1.0 or 0.1, or by variations of + / - 15%, 10%, 5%, or 2%, as appropriate. It should be understood that all numerical designations are preceded by the term "about." It should also be understood that the agents described herein are exemplary only and that equivalents thereof are known in the art. As used herein, the term "about" when referring to a measurable value such as an amount or concentration, etc., is intended to include variations within 20%, 10%, 5%, 1%, 0.5%, or 0.1% of the specified amount.

[0071] As used herein, the terms "nucleic acid," "nucleic acid molecule," "nucleic acid sequence," "nucleotide sequence," and "polynucleotide" are used interchangeably and refer to a polymeric form of nucleotides (ribonucleotides or deoxyribonucleotides) of any length. Thus, the term includes, but is not limited to, single-stranded, double-stranded, or double-stranded DNA or RNA, genomic DNA, cDNA, DNA-RNA hybrids, or polymers comprising, consisting of, or consisting essentially of purine and pyrimidine bases or other natural, chemically or biochemically modified, non-natural, or derivatized nucleotide bases.

[0072] The terms "protein," "peptide," "polypeptide," and "amino acid sequence" are used interchangeably and in their broadest sense refer to a polymeric form of two or more amino acid subunits, amino acid analogs, or peptidomimetics. "Protein," "peptide," "polypeptide," and "amino acid sequence" contain at least two amino acids, and there is no limitation on the maximum number of amino acids. As used herein, the term "amino acid" refers to natural and / or unnatural or synthetic amino acids, including D and L optical isomers and amino acid analogs.

[0073] The term "encoding" when applied to a nucleotide sequence refers to a nucleotide sequence that, in its native state or when manipulated by methods well known to those skilled in the art, can be transcribed to produce mRNA and / or translated to produce a polypeptide that "encodes" RNA or "encodes" a polypeptide. The antisense strand is the complement of such a nucleic acid, and the coding sequence can be deduced therefrom.

[0074] As used herein, "expression" refers to the process by which a nucleic acid sequence is transcribed into mRNA and / or the process by which the transcribed mRNA is subsequently translated into a peptide, polypeptide, amino acid sequence, or protein. In some cases, "expression" as used herein also includes splicing, modification, processing, etc. of mRNA molecules.

[0075] " vector " refers to the delivery vehicle or element of genetic material. In this article, the term " vector " refers to one or a series of macromolecules comprising polynucleotides, which promote the delivery of polynucleotides to target cells, target tissues or target organs in vitro or in vivo. The polynucleotides to be delivered are sometimes referred to as " transgenes (transgene)", including but not limited to the coding sequence of certain proteins or polypeptides that can enhance, suppress, weaken, protect, trigger or prevent certain biological functions and physiological functions, the coding sequence of RNAi components (for example, dsRNA, shRNA, siRNA, microRNA, antisense oligonucleotides), or optional markers. In the vector, the coding sequence of protein, polypeptide, RNAi components etc. is usually operably connected to expression control elements, such as promoters. In some embodiments, the vector can be a linear DNA molecule. In some embodiments, the vector can be a circular DNA molecule.

[0076] As used herein, the term "operably linked" refers to the functional spatial arrangement of two or more nucleic acid fragments or nucleic acid sequences. For example, if a promoter is placed at a specific position relative to a nucleic acid sequence encoding a protein of interest such that transcription of the nucleic acid sequence encoding the protein of interest is regulated by the promoter, the promoter is said to be "operably linked" to the nucleic acid sequence encoding the protein of interest.

[0077] As used herein, the term "specific promoter" refers to a promoter that is capable of directing the expression of a gene of interest at a specific time and / or specific space (e.g., a specific cell, tissue, or organ). In this article, a "seed-specific promoter" refers to a promoter that is capable of directing the expression of its downstream gene in cotton seeds (cottonseed). Typically, if the mRNA level in a specific cell, tissue, or organ is at least 5 times higher, preferably at least 10 times higher, more preferably at least 100 times higher, and most preferably at least 1000 times higher than in other cells, tissues, or organs, the expression of the gene of interest is considered to be cell-, tissue-, or organ-specific, and the promoter of the gene of interest is referred to as the specific cell-, tissue-, or organ-specific promoter.

[0078] The term "sequence identity" refers to the sequence similarity between two polypeptides or between two nucleic acid sequences. The percent identity can be determined by comparing positions in each sequence that can be aligned for the purpose of comparison. When a position in the compared sequences is occupied by the same base or amino acid, then the molecules are identical at that position. The degree of identity between sequences depends on the number of shared matching positions. "Unrelated" or "non-homologous" sequences share less than 40% identity, less than 25% identity with one of the sequences of the present invention. The alignment and percent sequence identity of the nucleic acid or amino acid sequences provided herein can be determined by importing the nucleic acid or amino acid sequence into ClustalW (available from https: / / genome.jp / tools-bin / clustalw / ) and using ClustalW.

[0079] When referring to a particular molecule, biological material, or cellular substance, the terms "equivalent" or "functional variant" are used interchangeably and refer to those having minimal homology while still retaining the desired structure or function. Non-limiting examples of equivalent polypeptides include polypeptides having at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity to a reference polypeptide (e.g., a G12 / G13 protein as described herein); or polypeptides encoded by polynucleotides having at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity to a reference polynucleotide (e.g., a seed-specific promoter as described herein).

[0080] Equivalents having one or more amino acid modifications compared to the reference polypeptide of the present invention (e.g., the Gl2 / Gl3 protein of the present invention) are also encompassed within the scope of the present invention, provided that the one or more amino acid modifications do not affect or substantially do not affect the function of the reference polypeptide. As used herein, an amino acid modification may be an amino acid substitution, an amino acid deletion, or an amino acid insertion. An amino acid substitution may be a conservative amino acid substitution or a non-conservative amino acid substitution. Conservative substitutions (also referred to as conservative mutations, conservative substitutions, or conservative variations) are amino acid substitutions in a protein that change a given amino acid into a different amino acid with similar biochemical properties (e.g., charge, hydrophobicity, or size). As used herein, "conservative substitutions" refer to replacement of an amino acid residue by another biologically similar residue. Examples of conservative substitutions include substitution of one hydrophobic residue such as isoleucine, valine, leucine, or methionine for another; or substitution of one charged or polar residue for another, such as substitution of arginine for lysine, substitution of glutamic acid for aspartic acid, substitution of glutamine for asparagine, and the like. Other illustrative examples of conservative substitutions include the following changes: alanine to serine; asparagine to glutamine or histidine; aspartic acid to glutamic acid; cysteine ​​to serine; glycine to proline; histidine to asparagine or glutamine; lysine to arginine, glutamine or glutamic acid; phenylalanine to tyrosine, serine to threonine; threonine to serine; tryptophan to tyrosine; tyrosine to tryptophan or phenylalanine; and the like.

[0081] Cotton pigment glands are a trait unique to the genus Gossypium and its closely related species, also known as gossypol glands. Glands are visible to the naked eye as small dark brown dots distributed on the plants and seeds of cotton plants. Glands are only observed in tissues such as anthers, seed coats, and fibers. Under a microscope, the glands are multicellular cavities, with the central cavity formed by the lysis of multiple cells and the exterior composed of multiple layers of flat cells. Glands in cotyledons or leaves occur under the palisade tissue, glands in new stems occur in the hypodermis, and glands in roots are distributed in the parenchyma tissue near the cambium. The central cavity of mature glands contains a large amount of terpene secondary metabolites such as gossypol, as well as components of residual cell walls. The gossypol content can reach 35-50% of the total weight of the pigment glands.

[0082] Upland cotton (Gossypium hirsutum) is one of the most widely cultivated cotton species in the world, possessing an allotetraploid AD genome. The synthesis and accumulation of gossypol involves the regulation of multiple genes in cotton. Among these, Gl2 and Gl3 are the most important genes controlling glandularization, encoding the Gl2 and Gl3 proteins, respectively, which control glandularization in various tissues of cotton. Other genes only affect glandularization in limited tissues or alter the number and morphology of glands. The Gl2 gene is located on the A subgenome of upland cotton, while the Gl3 gene is an allele located on the D subgenome. The Gl2 / Gl3 proteins encoded by these two genes differ by only two amino acids.

[0083] As used herein, the terms "G12 / G13" and "G12 and / or G13" are used interchangeably to refer to either or both of the G12 protein and the G13 protein, or the G12 gene and the G13 gene. It should be understood that due to the high similarity between the G12 and G13 proteins in amino acid sequence and function, the inhibitory molecules designed for the G12 protein or the G12 gene in the present invention are also applicable to the G13 protein or the G13 gene. It should also be understood that the technical solutions related to the G12 protein or the G12 gene described herein are also applicable to the G13 protein or the G13 gene, and that the aforementioned technical solutions can achieve similar technical effects.

[0084] The term "inhibitory molecule" refers to a molecule that inhibits the expression or function of a biologically active substance (e.g., protein, DNA, or RNA). Inhibitory molecules can be proteins (e.g., antibodies or antigen-binding fragments thereof), single-stranded or double-stranded nucleotide molecules (e.g., antisense nucleic acids, siRNA, miRNA, dsRNA, or shRNA), small molecule ligands, etc.

[0085] In this article, inhibiting the expression of Gl2 / Gl3 genes includes inhibiting the transcription process of Gl2 / Gl3 genes, inhibiting the translation process of mRNA after transcription, reducing the stability of mRNA or inducing mRNA degradation, etc.; inhibiting the activity of Gl2 / Gl3 proteins includes reducing the stability of proteins, inducing protein degradation, blocking the function of proteins, etc.

[0086] The term "antibody" as used herein should be understood in its broadest sense and includes monoclonal antibodies (including full-length monoclonal antibodies), polyclonal antibodies, antibody fragments, and multispecific antibodies (e.g., bispecific antibodies) containing at least two antigen-binding regions. Antibodies may contain additional modifications, such as non-naturally occurring amino acids, mutations in the Fc region, and mutations in glycosylation sites. Antibodies also include post-translationally modified antibodies, fusion proteins containing antigenic determinants of antibodies, and immunoglobulin molecules containing any other modifications to the antigen recognition site, as long as these antibodies exhibit the desired biological activity.

[0087] As used herein, the term "antigen-binding fragment" of an antibody refers to one or more fragments of an antibody that retain the ability to specifically bind to an antigen (e.g., specifically bind to a G12 / G13 protein). It has been shown that the antigen-binding function of an antibody can be performed by fragments of a full-length antibody.

[0088] Examples of "antigen-binding fragments" of antibodies include: (i) a Fab fragment, a monovalent fragment consisting of the VL, VH, CL and CH1 domains; (ii) a F(ab')2 fragment, a bivalent fragment comprising two Fab fragments linked by a disulfide bond at the hinge region; (iii) a Fab' fragment, which is essentially a Fab with a partial hinge region; (iv) a Fd fragment, which consists of the VH and CH1 domains; (v) a Fd' fragment, which has the VH and CH1 domains and one or more cysteine ​​residues at the C-terminus of the CH1 domain; (vi) an Fv fragment, which consists of the VL and VH domains of a single arm of an antibody; (vii) a dAb fragment, which consists of the VH domain; (viii) a single complementarity determining region (CDR); and (ix) a nanobody, a heavy chain variable region containing a single variable domain and two constant domains. In addition, although the two domains VL and VH of the Fv fragment are encoded by different genes, they can be connected by synthetic linkers using recombinant methods so that they can form a single protein chain in which the VL and VH regions are paired to form a monovalent molecule (called single-chain Fv (scFv)). Such single-chain antibodies are also intended to be encompassed within the term "antigen-binding fragment" of an antibody. In addition, the term also includes "straight-chain antibodies" comprising a pair of tandem Fd fragments (VH-CH1-VH-CH1), which together with the complementary light chain polypeptides and any modified forms of the aforementioned fragments that retain antigen-binding activity form an antigen-binding region.

[0089] These antigen-binding fragments can be obtained using conventional techniques known to those with skill in the art, and the fragments are screened for utility in the same manner as are intact antibodies.

[0090] The term "dsRNA" refers to a type of double-stranded RNA molecule that can mediate the degradation of homologous mRNA molecules, thereby achieving gene silencing. dsRNA is processed by intracellular nucleases (such as Dicer) to form siRNAs of approximately 21 to 23 nt in length.

[0091] The term "siRNA" is a double-stranded RNA molecule comprising a sense strand and an antisense strand that can mediate the silencing of a target RNA (e.g., mRNA, e.g., a transcript of a gene encoding a protein) that is complementary or substantially complementary to the antisense strand. siRNA is typically double-stranded, comprising an antisense strand that is complementary to the target RNA, and a sense strand that is complementary or substantially complementary to the antisense strand. For convenience, such mRNA is also referred to as mRNA to be silenced, and such a gene is also referred to as a target gene. Typically, the RNA to be silenced is an endogenous gene or a pathogen gene. In addition, RNA (e.g., tRNA) and viral RNA other than mRNA can also be targeted.

[0092] In the context of siRNA, the term "antisense strand" refers to the strand of the siRNA that contains a region that is fully complementary or substantially complementary to the target sequence; the term "sense strand" refers to the strand of the siRNA that includes a region that is substantially complementary to a region that is defined as the antisense strand herein.

[0093] MicroRNAs (miRNAs) are small, noncoding RNAs that belong to a class of regulatory molecules found in plants and animals. Generally, miRNAs control gene expression by binding to complementary sites on target messenger RNA (mRNA) transcripts. MiRNAs are generated from large RNA precursors (called pri-miRNAs) and processed in the cell nucleus into pre-miRNAs of approximately 70 nucleotides. Pre-miRNAs fold into imperfect stem-loop structures and undergo additional processing steps in the cytoplasm, where the RNase III enzyme Dicer cleaves the pre-miRNA hairpin from one side, forming mature miRNAs of 18-25 nucleotides in length. MiRNAs that bind complementary to protein-coding mRNA sequences induce the RNA-mediated interference pathway, resulting in cleavage and degradation of the mRNA target by ribonucleases within the RISC complex. This miRNA-mediated gene silencing mechanism has been observed in both plants and animals.

[0094] When referring to dsRNA, siRNA or microRNA, the term "targeting ... mRNA" means that the siRNA or the antisense strand of the siRNA generated by processing of the dsRNA or the microRNA is complementary or substantially complementary to the mRNA to be silenced (e.g., the mRNA transcribed from the Gl2 / Gl3 gene).

[0095] As used herein, the term "complementary" refers to the ability of a first polynucleotide to hybridize to a second polynucleotide under certain conditions, such as stringent conditions. For example, stringent conditions may include 400 mM NaCl, 40 mM PIPES pH 6.4, 1 mM EDTA at 50° C. or 70° C. for 12-16 hours. In terms of meeting the above requirements relative to their ability to hybridize, "complementary" sequences may also include or be completely formed from non-Watson-Crick base pairs and / or base pairs formed from non-natural and modified nucleotides. Such non-Watson-Crick base pairs include, but are not limited to, G:U wobble base pairing or Hoogstein base pairing.

[0096] As used herein, the terms "complementary," "fully complementary," and "substantially complementary" can be used with respect to base pairing between the sense and antisense strands of an siRNA, between the antisense strand of an siRNA and a target sequence, or between a microRNA and a target sequence.

[0097] Method for inhibiting the formation of pigment glands in cotton seeds and method for reducing gossypol content in cotton seeds

[0098] The present invention provides a method for inhibiting the formation of pigment glands in cotton seeds, which comprises causing the cotton seeds to express an inhibitory molecule that inhibits the expression and / or activity of Gl2 / Gl3 proteins, wherein the inhibitory molecule is expressed by a cotton seed-specific promoter.

[0099] At the same time, the present invention also provides a method for reducing the gossypol content in cotton seeds, which comprises causing the cotton seeds to express an inhibitory molecule that inhibits the expression and / or activity of Gl2 / Gl3 protein, wherein the inhibitory molecule is expressed by a cotton seed-specific promoter.

[0100] Seed-specific promoters suitable for use in the methods of the present invention include:

[0101] (1) Initiating expression of inhibitory molecules no later than the expression time of Gl2 / Gl3 proteins during seed development in wild-type cotton;

[0102] (2) ensuring that the expression level of the inhibitory molecule is no less than the sum of the expression levels of the wild-type Gl2 and Gl3 proteins; and

[0103] (3) The expression of inhibitory molecules is initiated only during the development of cotton seeds, and does not or substantially does not initiate after the germination of mature seeds and during other stages of cotton plant development.

[0104] In some embodiments, the seed-specific promoter is a promoter derived from the OLE_A, OLE_D, or ALB2S gene.

[0105] The seed-specific promoter used in the method of the present invention can be derived from the following species: upland cotton (Gossypium hirsutum), Asiatic cotton (Gossypium arboretum), abnormal cotton (Gossypium anomalum), Sturtianum cotton (Gossypium sturtianum), Raymond's cotton (Gossypium raimondii), Stoke's cotton (Gossypium stocksii), long-calyx cotton (Gossypium longicalyx), Bick's cotton (Gossypium bickii), round-leaf cotton (Gossypium rotundifolium), sea island cotton (Gossypium barbadense).

[0106] In some preferred embodiments, the seed-specific promoter comprises a nucleotide sequence having at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to SEQ ID NOs: 1-3. In some more preferred embodiments, the seed-specific promoter comprises the nucleotide sequence set forth in SEQ ID NOs: 1-3. In some most preferred embodiments, the seed-specific promoter consists of the nucleotide sequence set forth in SEQ ID NOs: 1-3.

[0107] It should be understood that the promoters derived from the OLE_A, OLE_D, or ALB2S genes provided herein can specifically direct the seed-specific expression of downstream genes. Therefore, in addition to the inhibitory molecules described herein that inhibit the expression and / or activity of the Gl2 / Gl3 proteins, the seed-specific promoters provided herein can also be combined with inhibitory molecules that inhibit other proteins associated with gland formation or gossypol synthesis, thereby inhibiting pigment gland formation in cotton seeds or reducing the gossypol content in cotton seeds.

[0108] It should also be understood that the promoter derived from the OLE_A, OLE_D or ALB2S gene provided by the present invention can not only be used for the purposes described in the present invention, but can also be used for various application purposes (such as improving plant traits) by specifically expressing other nucleic acid molecules or proteins in cotton seeds.

[0109] In some embodiments, the inhibitory molecule of the present invention is selected from: dsRNA, shRNA, antisense nucleic acid, small interfering RNA (siRNA), microRNA (microRNA or miRNA), antibody or antigen-binding fragment thereof, small molecule ligand or a combination thereof that inhibits or silences genes.

[0110] In some embodiments, the inhibitory molecule is a dsRNA that targets the mRNA transcribed from the G12 / G13 gene.

[0111] In some preferred embodiments, the nucleotide sequence encoding the dsRNA comprises a nucleotide sequence having at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% sequence identity to SEQ ID NO: 28, 59 or 70.

[0112] In some embodiments, the inhibitory molecule is an siRNA that targets the mRNA transcribed from the G12 / G13 gene.

[0113] In some embodiments, the siRNA comprises a sense strand and an antisense strand, and the sense strand and antisense strand are each independently 15-27 nucleotides, 18-25 nucleotides, 19-25 nucleotides, 20-25 nucleotides, 19-23 nucleotides, or 19-21 nucleotides in length.

[0114] In some embodiments, the sense strand and the antisense strand are the same length. In some embodiments, the sense strand and the antisense strand are different lengths.

[0115] In some preferred embodiments, the nucleotide sequence encoding the siRNA comprises a nucleotide sequence having at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% sequence identity to SEQ ID NO: 28, 59 or 70.

[0116] In some embodiments, the inhibitory molecule is a microRNA that targets mRNA transcribed from the G12 / G13 gene.

[0117] In some embodiments, the microRNA is 15-27 nucleotides, 18-25 nucleotides, 19-25 nucleotides, 20-25 nucleotides, 20-24 nucleotides, 19-23 nucleotides, or 19-21 nucleotides in length.

[0118] In some preferred embodiments, the nucleotide sequence encoding the microRNA comprises a nucleotide sequence having at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% sequence identity to SEQ ID NO:44.

[0119] In some specific embodiments, the method described herein comprises integrating into the genome of the cotton a nucleotide sequence having at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% sequence identity to SEQ ID NO: 29, 45, 60, 71, 76 or 77.

[0120] In some embodiments, the inhibitory molecule is an anti-Gl2 / Gl3 protein antibody or an antigen-binding fragment thereof, which can specifically bind to Gl2 and Gl3 proteins and inhibit their functions (such as transcriptional activation function).

[0121] In some embodiments, the inhibitory molecule is a small molecule ligand of the G12 / G13 protein, which can specifically bind to the G12 and G13 proteins and inhibit their functions (eg, transcriptional activation function).

[0122] In some specific embodiments, the method of the present invention comprises the following steps:

[0123] (1) transforming the nucleotide sequence containing the seed-specific promoter and encoding the inhibitory molecule into Agrobacterium to obtain Agrobacterium carrying the nucleotide sequence; and

[0124] (2) contacting cotton cells, seeds, tissues, organs or plants with the Agrobacterium carrying the nucleotide sequence in step (1), thereby introducing the nucleotide sequence into the cotton cells, seeds, tissues, organs or plants.

[0125] Methods for transforming nucleotide sequences into Agrobacterium are well known to those of ordinary skill in the art, and those skilled in the art know that the nucleotide sequences carried by Agrobacterium can be introduced into cotton cells, tissues or organs by conventional methods in the art (e.g., stem tip transformation method).

[0126] In some embodiments, the methods described herein comprise causing cotton seeds to express two or more inhibitory molecules that inhibit the expression and / or activity of G12 / G13 proteins. In some embodiments, the two or more inhibitory molecules are expressed from the same cotton seed-specific promoter. In some embodiments, the two or more inhibitory molecules are expressed from different cotton seed-specific promoters.

[0127] In some embodiments, the two or more inhibitory molecules are selected from: dsRNA, shRNA, antisense nucleic acid, small interfering RNA (siRNA), microRNA (microRNA or miRNA), antibodies or antigen-binding fragments thereof, small molecule ligands, or combinations thereof that inhibit or silence genes. In some preferred embodiments, the two or more inhibitory molecules are dsRNA and / or microRNA.

[0128] In some preferred embodiments, the cotton seed-specific promoters are each independently selected from promoters derived from the OLE_A, OLE_D, or ALB2S genes. In some preferred embodiments, the seed-specific promoter comprises a nucleotide sequence having at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to SEQ ID NOs: 1-3. In some more preferred embodiments, the seed-specific promoter comprises the nucleotide sequence set forth in SEQ ID NOs: 1-3. In some most preferred embodiments, the seed-specific promoter consists of the nucleotide sequence set forth in SEQ ID NOs: 1-3.

[0129] In some embodiments, the methods described herein result in the abortion of pigment glands in cotton seeds compared to pigment glands in wild-type cotton seeds, and the development of pigment glands in cotton plants is not affected.

[0130] In some embodiments, the methods described herein reduce the gossypol content in cotton seeds by 99%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, or 100% compared to the gossypol content of wild-type cotton seeds.

[0131] In some embodiments, the methods described herein result in gossypol levels in tissues of a cotton plant that are no different or substantially no different than the gossypol levels in tissues of a wild-type cotton plant.

[0132] The significant advantages of the method of the present invention are:

[0133] (1) It not only achieves "zero" gossypol in cotton seeds, but also removes other secondary metabolites synthesized by cotton seed glands that may affect food safety;

[0134] (2) The glandular development of tissues other than seeds can be completely maintained in the same manner as that of wild-type materials, thereby ensuring that the resulting cotton lines have no significant differences in disease and insect pest resistance compared to currently promoted cotton varieties;

[0135] (3) It does not affect the cotton fiber yield and quality of the produced cotton varieties.

[0136] In order to make the purpose, technical solutions and advantages of the present invention more clear, the present invention is further described below in conjunction with specific examples and accompanying drawings, and the advantages and features of the present invention will become clearer as the description progresses. It should be understood that these examples are only used to illustrate the present invention and are not intended to limit the scope of the present invention. The experimental methods in the following examples where specific conditions are not specified are carried out according to conventional conditions in the art, for example, the conditions described in Sambrook and Russeii et al., Molecular Cloning: A Laboratory Manual (3rd Edition) (2001), CSHL Press, or according to the conditions recommended by the manufacturer. Unless otherwise stated, the experimental materials and reagents used in the following examples are all commercially available.

[0137] Example

[0138] Example 1. Occurrence and development of cotton pigment glands and gossypol accumulation

[0139] The development of pigment glands proceeds through four stages: glandular cell initiation, glandular development, secondary metabolite synthesis, and internal cell lysis. The present invention utilized the cotton Gl2 gene promoter (SEQ ID NO: 4) to construct a proGhGl2::GUS cotton transgenic line. GUS staining of cotton true leaves and immature embryos revealed that glandular cells arise from pseudo-meristems expressing the Gl2 / Gl3 genes. These fate-determined glandular cells undergo multiple divisions to form visible glands (as shown in Figure 1, a).

[0140] By observing the embryos at different developmental stages, it was found that glandular progenitors began to appear around 14 days after the embryos developed. At this time, the glands appeared white under an optical microscope, but no gossypol accumulated in the embryos at this time; gossypol began to accumulate in the embryos around 17-18 days after the embryos developed, and the glands appeared light yellow under an optical microscope (as shown in Figure 1c and Figure 2); as the glands developed, the cells in the center of the glands began to lyse, and eventually a mature pigment gland could be seen with an internal cavity filled with secondary metabolites such as gossypol wrapped by tightly arranged sheath cells on the outside (as shown in Figure 1b).

[0141] In summary, gossypol only begins to appear when the gland develops to a certain stage, and there is no gossypol accumulation in the immature embryo in the early stage of gland development.

[0142] Example 2. Alleles Gl2 and Gl3 are key genes regulating glandular development and gossypol synthesis

[0143] Gl2 and its alleles (including the Gl3 allele on the D subgenome) are necessary and sufficient for gland development. Plants with a simultaneous loss-of-function Gl2 / Gl3 mutant (gl2gl2gl3gl3) lack any pigmented glands (as shown in Figure 3a), and gossypol is undetectable in any of the mutant's tissues and organs (as shown in Figure 3b). Furthermore, as the wild-type Gl2 and Gl3 copy numbers decrease, the number of true leaf glands and gossypol content decrease significantly (as shown in Figure 3c and d).

[0144] The Gl2 and Gl3 proteins differ only in two amino acids (Gl3 has N207H and S281G substitutions compared to Gl2). Genetic analysis indicates that the Gl2 and Gl3 genes function identically in glandular development. The difference between the two is that Gl2 expression is significantly higher than Gl3, with Gl2 expression approximately double that of Gl3. Compared to the wild type (Gl2Gl2Gl3Gl3), the gl2 mutant (gl2gl2Gl3Gl3) exhibited significantly lower glandular number and gossypol content than the gl3 mutant (Gl2Gl2gl3gl3) (as shown in Figure 3, c and d).

[0145] In summary, the Gl2 / Gl3 genes determine the development of cotton pigment glands and the accumulation of gossypol.

[0146] Example 3. In situ synthesis and accumulation of gossypol and other secondary metabolites in pigment glands

[0147] Non-glandular cells of immature embryos (30 days, 40 days, and 50 days) of the upland cotton genetic standard line TM-1 were obtained, and their gossypol content was determined by high performance liquid chromatography (HPLC). The results showed that no gossypol was detected in the non-glandular cells of the immature embryos (as shown in Figure 4a and b).

[0148] In addition, glandular cells from TM-1 immature embryos, leaves, and other parts were obtained for transcriptome sequencing. Combined with the transcriptome expression profile of immature embryos of the Gl2 / Gl3 mutant strain, it was found that genes in the gossypol biosynthesis pathway were gland-specifically expressed genes (as shown in Figure 4c).

[0149] A vector harboring the CDNC promoter (SEQ ID NO: 6), a key gene in the gossypol biosynthesis pathway, and the GUS gene (SEQ ID NO: 5) was constructed and introduced into cotton. GUS staining of T1-positive plants revealed that glands in embryos, leaves, and roots of the transgenic lines exhibited distinct blue color (as shown in Figure 4(d)).

[0150] In summary, the present invention confirms that secondary metabolites such as gossypol in cotton pigment glands are synthesized and accumulated in situ in the glands.

[0151] Example 4. Gl2 / Gl3 genes are gland-specific highly expressed genes

[0152] Glandular cell-specific transcriptome analysis revealed that the expression levels of the Gl2 / Gl3 genes in glandular cells of cotton embryos, leaves, and stems were much higher than in non-glandular cells (Figure 5). ProGhGl2::GUS transgenic cotton lines were constructed, and GUS staining revealed that glands in embryos, leaves, and other parts of the transgenic lines exhibited a distinct blue color, while non-glandular tissues did not.

[0153] In summary, Gl2 / Gl3 genes are gland-specific highly expressed genes.

[0154] Example 5. Screening of cotton seed development-specific promoters

[0155] Gl2 / Gl3 gene expression begins after cotton flowering, during embryonic development, and continues until seed maturity. Based on the Gl2 / Gl3 gene's function in regulating glandularization, only by completely inhibiting the function of the Gl2 / Gl3 proteins during cotton seed development can cotton seeds be completely gland-free and have zero gossypol. However, Ghα-globulin, a cotton seed-specific gene commonly used in the development of low-phenol cotton, only reaches a significantly higher expression level than the combined expression of the Gl2 and Gl3 genes after 16 days of embryonic development. Therefore, the introduction of a silencing expression cassette for the Gl2 / Gl3 genes driven by the Ghα-globulin promoter into plants cannot completely eliminate glands in seeds, and therefore cannot achieve "zero gossypol" in seeds.

[0156] The present invention uses high-resolution spatiotemporal transcriptome technology to screen genes specifically expressed during cotton seed development, and the screening is performed according to the following principles:

[0157] 1. The candidate gene begins to express no later than the expression time of Gl2 and Gl3, and continues to express until the seeds mature.

[0158] 2. The expression level of the candidate gene in cotton seed glands is not lower than the sum of the expression levels of Gl2 and Gl3.

[0159] 3. The candidate gene is expressed only during cotton seed development, with very low or no expression at other stages of cotton plant development, and very low or no expression after mature seeds germinate. Seed development here refers to the process from fertilized egg to seed maturity, which for cotton is from flowering to boll opening.

[0160] The present invention screened for multiple cotton seed-specifically expressed genes and obtained the corresponding gene promoters, proGhOLE1_A (SEQ ID NO: 1), proGhOLE1_D (SEQ ID NO: 2), and proGhALB2S (SEQ ID NO: 3) ( FIG6 ). The expression levels of the cotton seed-specific genes GhOLE1_A, GhOLE1_D, and GhALB2S, screened according to the aforementioned principles, were significantly higher throughout seed development than the combined expression levels of the Gl2 and Gl3 genes ( FIG7 ). Therefore, using these promoters to initiate expression of inhibitory molecules against the Gl2 / Gl3 genes or Gl2 / Gl3 proteins can effectively inhibit the function of the Gl2 / Gl3 proteins, thereby effectively suppressing the development of seed glands.

[0161] Example 6. proOLE1_D, proOLE1_A, and proALB2S promoters direct seed tissue-specific expression of downstream genes

[0162] The proOLE1_D, proOLE1_A and proALB2S promoters from the upland cotton TM-1 line were fused with the GUS gene to obtain the proGhOLE1_D-GUS, proGhOLE1_A-GUS and proGhALB2S-GUS expression vectors, respectively ( FIG8 ).

[0163] The above expression vector was sent to Jiangsu Weimi Biotechnology Co., Ltd. for transformation into the cotton variety "TM-1." A T0-generation transgenic cotton line was obtained from the company, and the T1 generation was planted and harvested. Positive T1 plants were screened and seeds were harvested, ultimately obtaining stable, homozygous, positive transgenic cotton plants containing the target gene.

[0164] GUS staining was performed on tissues and organs (immature embryos, leaves, sepals, and stems) of plants transformed with the proGhOLE1_D-GUS, proGhOLE1_A-GUS, and proGhALB2S-GUS expression vectors. As shown in Figure 9, the GUS gene exhibited a distinctly observable blue color in the immature embryos of the transgenic cotton plants, while no GUS gene expression was detected in any other organs. These results demonstrate that the promoter of the present invention can direct the expression of its downstream genes in the seeds of transgenic plants, and that this expression is seed-tissue specific.

[0165] Example 7. Creation of new cotton using seed-specific promoters combined with dsRNA

[0166] Using GhGl2 / GhGl3 as the target gene (the nucleotide sequence encoding the GhGl2 protein is shown in SEQ ID NO: 7), the proGhOLE1_D::dsGhGl2-RNAi vector, proGhOLE1_A::dsGhGl2-RNAi vector and proGhALB2S::dsGhGl2-RNAi vector were constructed ( FIG10 ).

[0167] The above vector was sent to Jiangsu Weimi Biotechnology Co., Ltd. for transformation into the cotton variety "Bai Mian No. 1." T0-generation transgenic cotton lines obtained from the company were planted and harvested for the T1 generation. For lines transformed with the proGhOLE1_D::dsGhGl2-RNAi vector, PCR amplification was performed using the forward primer RNAi-JD-F (SEQ ID NO: 8): 5'-ATACATACCTACATACTTTCCATTTACTAGCA-3' and the reverse primer RNAi-JD-R (SEQ ID NO: 9): 5'-AGAAACTTTATTGCCAAATGTTTGAA-3'. T1-positive plants were screened and seeds were harvested. PCR identification results are shown in Figure 11.

[0168] The forward primer RNAi-proGhOLE1_A-GhGl2-JD-F (SEQ ID NO: 46): 5'-CCCGACAAAAATCAACGTGTC-3', the reverse primer RNAi-proGhOLE1_A-GhGl2-JD-R (SEQ ID NO: 47): 5'-TATCAGAAGATCCCAATTCGACAA-3', and the forward primer RNAi-proGhALB2S-GhGl2-JD-F (SEQ ID NO: 48): 5'-CTACCGATCCCAGTTAAGGCAG-3', the reverse primer RNAi-proGhALB2S-GhGl2-JD-R (SEQ ID NO: NO:49): 5'-CAAGAATCCCATCACCTACAGCG-3' The cotton lines transformed with proGhOLE1_A::dsGhGl2-RNAi vector and proGhALB2S::dsGhGl2-RNAi vector were identified, T1 positive plants were screened and seeds were harvested.

[0169] Gossypol content was determined in roots, stems, leaves, petals, and mature seeds of T2 transgenic and wild-type (non-transgenic) cotton. The T2 transgenic lines transformed with the proGhOLE1_D::dsGhGl2-RNAi vector were named OLE1-T2-1 and OLE1-T2-3; the T2 transgenic lines transformed with the proGhOLE1_A::dsGhGl2-RNAi vector were named OLE1_A-T2-2 and OLE1_A-T2-4; and the T2 transgenic lines transformed with the proGhALB2S::dsGhGl2-RNAi vector were named ALB2S-T2-1 and ALB2S-T2-2.

[0170] The gossypol content was determined to be no different between the wild-type and transgenic lines in roots, stems, leaves, and petals, while the gossypol content in mature seeds of the transgenic plants was zero ( Figure 12 , Tables 1-3 ).

[0171] Table 1. Cottonsepol content in various organs of T2 transgenic lines of RNAi interference materials (μg / mg)

[0172] Table 2. Cottonsepol content in various organs of T2 transgenic lines of RNAi interference materials (μg / mg)

[0173] Table 3. Cottonse pol content in various organs of T2 transgenic lines of RNAi interference materials (μg / mg)

[0174] The impact of transgenic cotton on cotton yield was analyzed by analyzing the bud and boll stage, plant height, number of fruiting branches, number of bolls per plant, and fiber length and strength of T2 transgenic and non-transgenic cotton plants. The transgenic cotton showed similar plant height, number of fruiting branches, number of bolls per plant, yield, fiber length, and fiber strength to the non-transgenic variety Baimian No. 1, with no significant differences between the two (Tables 4-6).

[0175] Table 4. Statistics of comprehensive traits of T2 transgenic lines of RNAi interference materials

[0176] Table 5. Statistics of comprehensive traits of T2 transgenic lines of RNAi interference materials

[0177] Table 6. Statistics of comprehensive traits of T2 transgenic lines of RNAi interference materials

[0178] The above results show that the method of using the cotton seed-specific promoters proOLE1_D, proOLE1_A and proALB2S combined with dsRNA of the present invention can ensure that the gossypol content in the seeds is zero without affecting the gossypol content in other tissues or organs of the cotton, nor affecting the comprehensive traits and final yield of the cotton.

[0179] Example 8. Creation of new cotton using seed-specific promoters combined with microRNA (miRNA)

[0180] With GhGl2 / GhGl3 gene as target gene, proGhOLE1_A::GhGl2 / GhGl3-miRNA vector, proGhOLE1_D::GhGl2-miRNA vector and proGhALB2S::GhGl2-miRNA vector were constructed ( FIG13 ).

[0181] The above seed-specific miRNA vectors were introduced into the cotton variety Baimian No. 1 through Agrobacterium-mediated stem tip transformation to obtain transgenic strains.

[0182] Gossypol content was determined in leaves, stems, and mature seeds of T2 homozygous transgenic and wild-type (non-transgenic) cotton plants. The T2 transgenic lines transformed with the proGhOLE1_A::GhGl2 / GhGl3-miRNA vector were named NSGFS-5-2 and NSGFS-5-3; the T2 transgenic lines transformed with the proGhOLE1_D::GhGl2-miRNA vector were named NSGFS-6-1 and NSGFS-6-3; and the T2 transgenic lines transformed with the proGhALB2S::GhGl2-miRNA vector were named NSGFS-7-2 and NSGFS-7-5.

[0183] The gossypol content was determined to be no different between the wild-type and transgenic lines in roots, stems, leaves, and petals, while the gossypol content in mature seeds of the transgenic plants was reduced by more than 99.0% (Tables 7-9).

[0184] Table 7. Determination of gossypol content in various organs of microRNA interference material T2 generation (μg / mg)

[0185] Table 8. Determination of gossypol content in various organs of microRNA interference material T2 generation (μg / mg)

[0186] Table 9. Determination of gossypol content in various organs of microRNA interference material T2 generation (μg / mg)

[0187] The impact of transgenic cotton on cotton yield was analyzed by analyzing the bud and boll stage, plant height, number of fruiting branches, number of bolls per plant, and fiber length and strength of T2 transgenic and non-transgenic cotton plants. The transgenic cotton showed similar plant height, number of fruiting branches, number of bolls per plant, yield, fiber length, and fiber strength to the non-transgenic variety Baimian No. 1, with no significant differences between the two (Tables 10-12).

[0188] Table 10. Statistics of comprehensive traits of T2 generation of microRNA interference materials

[0189] Table 11. Statistics of comprehensive traits of T2 generation of microRNA interference materials

[0190] Table 12. Statistics of comprehensive traits of T2 generation of microRNA interference materials

[0191] These results demonstrate that the methods utilizing the cotton seed-specific promoters proOLE1_D, proOLE1_A, and proALB2S in combination with microRNA can significantly reduce the gossypol content in seeds without affecting the gossypol content in other cotton tissues or organs, or the overall cotton traits and yield. Further optimization of the microRNA sequence can achieve zero gossypol content in cotton seeds without affecting the gossypol content in other tissues or organs, or the overall cotton traits and yield.

[0192] Experimental methods

[0193] (1) Shoot tip transformation method

[0194] 1. Seed germination

[0195] One day before infection, take 300 lint-free cotton seeds and place them in a sterile conical flask. Add 75% alcohol, shake for 30 seconds, and discard the waste liquid. Then add 6% H2O2 and shake on a shaker for 15 minutes. Discard the waste liquid, rinse with sterile water 4 times, and soak and culture in a dark room at 28℃ overnight for 18-24 hours.

[0196] 2. Agrobacterium Preparation

[0197] Three days before infection, use a disposable inoculating loop to dip the target glycerol bacteria and evenly spread it on YEB culture medium containing the corresponding antibiotics. Seal the edge of the culture plate with sealing film and incubate it upside down at 28℃ in a constant temperature box for 2 days to obtain activated Agrobacterium. Expand the culture of the activated Agrobacterium at 28℃ and measure the A660 value of about 0.9 using a spectrophotometer for later use.

[0198] 3. Infection and Co-cultivation

[0199] After seed culture is complete, use a scalpel to cut the seed coat. Under a dissecting microscope, peel off the cotyledons to expose the embryo apex, retaining the embryo apex and hypocotyl as the explant. Place the explant in the prepared Agrobacterium suspension, sonicate at 40 kHz for 40 seconds, and then shake at a constant speed for 50 minutes. After infection, place the explant in a co-culture medium covered with double-layer sterile filter paper and incubate in a 23°C incubator in the dark for 3-4 days.

[0200] 4. Resume Culture

[0201] After 3-4 days of co-cultivation, the explants were transferred to selective medium and placed in a culture chamber. The explants were cultured at 35°C for 3-6 days and then transferred to a culture temperature of 28°C for another 22-25 days with a photoperiod of 16 / 8 h, light / dark.

[0202] 5. Bud induction culture and resistant bud screening

[0203] After culturing on the recovery medium for 7 days, the elongated roots of the cotton explants were cut off and then transferred to the shoot induction medium. They were subcultured every 2 weeks for 3-4 times at 25°C under a photoperiod of 16 / 8h, light / dark, until resistant shoots were obtained.

[0204] 6. Rooting culture

[0205] After resistant buds have fully expanded, transfer the explants to elongation medium and treat as for screening. Cultivate at 28°C under a 16 / 8 hour light / dark cycle. Subculture every two weeks. When resistant buds have elongated >3 cm, have >2 roots, and are >2 cm long, transplant them to a hardening room for testing and hardening.

[0206] Solution formula:

[0207] CA salt: magnesium sulfate 10 g / L, ammonium sulfate 5.36 g / L, sodium phosphite hydrate 6 g / L, calcium chloride 6 g / L, boric acid 30 mg / L, manganese sulfate 100 mg / L, zinc sulfate heptahydrate 20 mg / L, potassium iodide 7.5 mg / L, sodium molybdate dihydrate 2.5 mg / L, copper sulfate 250 μg / L, cobalt (II) chloride hexahydrate 250 μg / L, potassium nitrate 100 g / L.

[0208] Agrobacterium infection suspension: 10 ml / L CA salts, 30 g / L glucose, 4.2 g / L MES, 0.1 ml / L B5 vitamins, 1 mg / L 6-BA, 0.1 mg / L NAA, 2 ml / L 100 mM acetosyringone, pH = 5.4;

[0209] Co-culture medium: 10 ml / L CA salts, 30 g / L glucose, 4.2 g / L MES, 0.1 ml / L B5 vitamins, 1 mg / L 6-BA, 0.1 mg / L NAA, 2 ml / L 100 mM acetosyringone, 4 ml / L 50 mg / ml CYS cysteine, pH = 5.4;

[0210] Recovery medium: 4.4 g / L MS salts and B5 vitamins, 20 g / L glucose, 1.29 g / L calcium gluconate, 1 mg / L 6-BA, 0.1 mg / L NAA, 100 mg / L carbenicillin, 100 mg / L cephalosporin, 4 g / L agar, pH 5.6.

[0211] Shoot induction and selection medium: 4.4 g / L mixture of MS salts and B5 vitamins, 20 g / L glucose, 1.29 g / L calcium gluconate, 1 mg / L 6-BA, 0.1 mg / L NAA, 100 mg / L carbenicillin, 100 mg / L cephalosporin, 100 mg / L kanamycin, 4 g / L agar, pH 5.6.

[0212] Rooting medium: a mixture of MS salts and B5 vitamins at a concentration of 4.4 g / L, glucose at a concentration of 20 g / L, calcium gluconate at a concentration of 1.29 g / L, carbenicillin at a concentration of 100 mg / L, cephalosporin at a concentration of 100 mg / L, 4 g / L agar, pH = 5.6.

[0213] (2) GUS staining

[0214] The material was quickly cut with a sharp blade and placed in pre-cooled 90% acetone for 20 minutes for fixation; the acetone was discarded and 1 mL of GUS wash solution was added to wash away the residual acetone, and the solution was washed twice; 1 mL of GUS staining solution (Solebo GUS staining kit - ready-to-use, product number: G3061) was added and vacuumed on ice in the dark for 15-20 minutes; staining was carried out in the dark at 37°C for several hours or overnight; the staining solution was aspirated and 1 mL of 70% ethanol was added to stop the staining reaction and decolorization; 75% ethanol, 90% ethanol, and 100% ethanol were replaced until decolorization was complete; photographed and observed under a dissecting microscope and microscope.

[0215] (III) Construction of proGhOLE1_D-GUS, proGhOLE1_A-GUS and proGhALB2S-GUS expression vectors

[0216] 1) The VM062 plant expression vector was double-digested with restriction endonucleases HindIII and BamHI to linearize the circular vector.

[0217] 2) Synthesis of GUS gene: The GUS gene sequence was synthesized by Shanghai Sangon Biotechnology Co., Ltd. and amplified using primers with homology arms. The amplification primers for the GUS gene are as follows:

[0218] GUS-F forward primer (SEQ ID NO: 10):

[0219] cagtgccaagctaagcttATGTTACGTCCTGTAGAAACCCCA

[0220] GUS-R reverse primer (SEQ ID NO: 11):

[0221] ctaggctacgtaggatccTCATTGTTTGCCTCCCTGCT

[0222] Amplification system: KOD One TM PCR Master Mix (Toyobo, KMM-101) 20 μL; upstream primer (10 μM) 1 μL; downstream primer (10 μM) 1 μL; template 1.5 μL; sterile water 16.5 μL; total volume 40 μL.

[0223] The PCR reaction program was 98°C for 5 min; 98°C for 30 s; 55°C for 30 s; 68°C for 1 min, 35 cycles; then 68°C for 10 min and stored at 4°C.

[0224] 3) Detection and recovery of vector enzyme digestion products and PCR products: Recover PCR products and enzyme digestion products, and then use The target fragment was purified and recovered using Quick Gel Extraction Kit (Gold, EG101-01).

[0225] 4) Recombination of glue recovery products: Homologous recombination was performed using the Basic Seamless Cloning and Assembly Kit (Quanshijin, CU201-02). The reaction system was as follows: 5 μL of 2× Basic Assembly Mix, X μL of digested vector, Y μL of PCR product, and 10 μL of sterile water. Mix gently and incubate at 50°C for 15 minutes.

[0226] 5) Transform E. coli DH5α and use KOD One TMPCR Master Mix (Toyobo, KMM-101) was used for PCR detection, and positive clones were selected and sent to Shanghai Sangon Biotechnology Co., Ltd. for sequencing. The sequencing results showed that the intermediate vector VM062-GUS (SEQ ID NO: 12) was successfully obtained. The plasmid was extracted and stored for future use.

[0227] 6) The VM062-GUS vector from the previous step was digested with restriction endonuclease HindIII.

[0228] 7) Using genomic DNA from upland cotton TM-1 leaves as a template, primers with homology arms were used to amplify the proGhOLE1_A, proGhOLE1_D, and proGhALB2S promoter sequences.

[0229] Amplification primers for proGhOLE1_A:

[0230] GUS-proGhOLE1_A-F forward primer (SEQ ID NO: 13):

[0231] 5'-cagtgccaagctaagcttTGAGTTTGGGAAATTAGGCATCC-3';

[0232] GUS-proGhOLE1_A-R reverse primer (SEQ ID NO: 14):

[0233] 5'-aggacgtaacataagcttTGATTAAAAAAACAAAGAAAAGAACTTG-3';

[0234] Amplification primers for proGhOLE1_D:

[0235] GUS-proGhOLE1_D-F forward primer (SEQ ID NO: 15):

[0236] 5'-cagtgccaagctaagcttCTGATCAGTCTGCTGTCAAATCG-3';

[0237] GUS-proGhOLE1_D-R reverse primer (SEQ ID NO: 16):

[0238] 5'-aggacgtaacataagcttTGCCTAAAAAAACAAAGAAAAGAACT-3'

[0239] Amplification primers for proGhALB2S:

[0240] GUS-proGhALB2S-F forward primer (SEQ ID NO: 17):

[0241] 5'-cagtgccaagctaagcttGCGACTCGACGATTGTTCCT-3'

[0242] GUS-proGhALB2S-R reverse primer (SEQ ID NO: 18):

[0243] 5'-aggacgtaacataagcttTGTTGATTTATGCTGGTATGGAGAA-3'

[0244] The amplification system and PCR reaction procedures were the same as above.

[0245] 8) Detection and recovery of vector enzyme digestion products and PCR products: PCR products and enzyme digestion products were detected by agarose gel electrophoresis, and then The target fragment was purified and recovered using Quick Gel Extraction Kit.

[0246] 9) Recombination of glue recovery products: -Basic Seamless cloning and Assembly Kit for homologous recombination.

[0247] 10) Transform E. coli DH5α and use KOD One TM PCR Master Mix was used for PCR detection, and positive clones were selected and sent to Shanghai Sangon Biotechnology Co., Ltd. for sequencing.

[0248] (IV) Construction of proGhOLE1_D::dsGhGl2-RNAi vector

[0249] 1) Linearization of WMV076 (a plant RNAi vector provided by Jiangsu Weimi Biotechnology Co., Ltd.): Double-digest the WMV076 vector with HindIII and XbaⅠ restriction endonucleases to linearize the circular vector.

[0250] 2) Construction of proGhOLE1_D-RNAi intermediate vector: Using upland cotton DNA as a template, primers with linkers were designed using one-step cloning technology to amplify the promoter proGhOLE1_D.

[0251] Forward primer sequence RNAi-proGhOLE1_D-F (SEQ ID NO: 19):

[0252] 5'-gatcccccgaattaAAGCTTCTGATCAGTCTGCTGTCAAATCGGTG-3';

[0253] Reverse primer sequence RNAi-proGhOLE1_D-R (SEQ ID NO: 20):

[0254] 5'-TCCCCGGTCTAGATGCCTAAAAAAACAAAGAAAAGAACTTGAAG-3'.

[0255] The amplification system and PCR reaction procedures were the same as above.

[0256] Detection and recovery of vector enzyme digestion products and PCR products: PCR products and enzyme digestion products were detected by agarose gel electrophoresis, and then The target fragment was purified and recovered using Quick Gel Extraction Kit.

[0257] Recombination of rubber recovery products: -Basic Seamless cloning and Assembly Kit for homologous recombination.

[0258] The recombinant product was transformed into Escherichia coli DH5α and the KOD One TM PCR Master Mix was used for PCR detection, and positive clones were selected and sent to Shanghai Sangon Biotechnology Co., Ltd. for sequencing. After sequence comparison, plasmids were extracted from the clones with correct sequencing using a plasmid extraction kit to obtain the proGhOLE1_D-RNAi intermediate vector.

[0259] 3) Construction of proGhOLE1_D::dsGhGl2-F-RNAi intermediate vector: The proGhOLE1_D-RNAi vector was digested with BamHI restriction endonuclease to linearize the circular vector.

[0260] GhGl2 / GhGl3 gene positive dsRNA chain amplification:

[0261] PCR amplification was performed using the forward primer RNAi-GhGl2-F1 (SEQ ID NO: 21): 5'-CATCTAGACCGGGGATCCCAGTGTGAGCGTGTTAGAGAAGCT-3'; the reverse primer RNAi-GhGl2-R1 (SEQ ID NO: 22): 5'-gtatatacgtacGGATCCTGCTTCAACGTGGTTTATAGGGG-3' as a primer pair and upland cotton DNA as a template to obtain the GhGl2 / GhGl3 gene positive interference fragment 1 (SEQ ID NO: 23); the GhGl2 / GhGl3 gene positive interference fragment 1 was purified and recovered, and enzymatically ligated with the linearized proGhOLE1_D-RNAi vector using a one-step cloning enzyme, and transformed to finally obtain the positive clone proGhOLE1_D::dsGhGl2-F-RNAi with correct sequencing. The plasmid was extracted and stored for future use.

[0262] 4) Construction of proGhOLE1_D::dsGhGl2-RNAi vector: proGhOLE1_D::dsGhGl2-F-RNAi was double-digested with AscⅠ and SpeⅠ restriction endonucleases to linearize the circular vector.

[0263] GhGl2 / GhGl3 gene antisense dsRNA chain amplification:

[0264] PCR amplification was performed using the forward primer RNAi-GhGl2-F2 (SEQ ID NO: 24): 5'-acgtgtgcagGGCGCGCCTGCTTCAACGTGGTTTATAGGGG-3'; and the reverse primer RNAi-GhGl2-R2 (SEQ ID NO: 25): 5'-aaattcgagctcactagtCAGTGTGAGCGTGTTAGAGAAGCT-3' as a primer pair and upland cotton DNA as a template to obtain the GhGl2 / GhGl3 gene antisense interference fragment 1, the sequence of which is shown in SEQ ID NO: 26. The GhGl2 / GhGl3 gene antisense interference fragment 1 was purified and recovered, and enzymatically ligated with the linearized proGhOLE1_D::dsGhGl2-F-RNAi vector using a one-step cloning enzyme, and transformed to obtain the positive clone proGhOLE1_D::dsGhGl2-RNAi (SEQ ID NO: 27) with correct sequencing. Among them, the nucleotide sequence encoding the dsRNA targeting the GhGl2 / GhGl3 gene is shown in SEQ ID NO: 28, and the nucleotide sequence of the seed-specific promoter proGhOLE1_D fused with the coding sequence of the dsRNA targeting the GhGl2 / GhGl3 gene is shown in SEQ ID NO: 29.

[0265] (V) Construction of proGhOLE1_A::dsGhGl2-RNAi vector

[0266] 1) Linearization of WMV076 (a plant RNAi vector provided by Jiangsu Weimi Biotechnology Co., Ltd.): Double-digest the WMV076 vector with HindIII and XbaⅠ restriction endonucleases to linearize the circular vector.

[0267] 2) Construction of proGhOLE1_A-RNAi intermediate vector: Using upland cotton DNA as a template, primers with linkers were designed using one-step cloning technology to amplify the promoter proGhOLE1_A.

[0268] Forward primer sequence RNAi-proGhOLE1_A-F (SEQ ID NO: 50):

[0269] 5'-gatcccccgaattaAAGCTTtgagttgggaaattaggcatcc-3';

[0270] Reverse primer sequence RNAi-proGhOLE1_A-R (SEQ ID NO: 51):

[0271] 5'-gtacggatccccggtctagaTGATTAAAAAAACAAAGAAAAGAACTTG-3'.

[0272] The amplification system and PCR reaction procedures were the same as above.

[0273] Detection and recovery of vector enzyme digestion products and PCR products: PCR products and enzyme digestion products were detected by agarose gel electrophoresis, and then The target fragment was purified and recovered using Quick Gel Extraction Kit.

[0274] Recombination of rubber recovery products: -Basic Seamless cloning and Assembly Kit for homologous recombination.

[0275] The recombinant product was transformed into Escherichia coli DH5α, and PCR detection was performed using KOD OneTM PCR Master Mix. Positive clones were selected and sent to Shanghai Sangon Biotechnology Co., Ltd. for sequencing. After sequence alignment, the plasmids of the correctly sequenced clones were extracted using a plasmid miniprep kit to obtain the proGhOLE1_A-RNAi intermediate vector.

[0276] 3) Construction of proGhOLE1_A::dsGhGl2-F-RNAi intermediate vector: The proGhOLE1_A-RNAi vector was cut with BamHI restriction endonuclease to linearize the circular vector.

[0277] GhGl2 / GhGl3 gene positive dsRNA chain amplification:

[0278] PCR amplification was performed using the forward primer RNAi-proGhOLE1_A-GhGl2-F1 (SEQ ID NO: 52): 5'-tctagaccggggatccGGGGCGATGGCTATTTTCG-3'; and the reverse primer RNAi-proGhOLE1_A-GhGl2-R1 (SEQ ID NO: 53): 5'-cggtatatacgtacggatccTATCAGAAGATCCCAATTCGACAA-3' as a primer pair and upland cotton DNA as a template to obtain the GhGl2 / GhGl3 gene positive interference fragment 2 (SEQ ID NO: 54). The GhGl2 / GhGl3 gene positive interference fragment 2 was purified and recovered, and enzymatically ligated with the linearized proGhOLE1_A-RNAi vector using a one-step cloning enzyme, and transformed to obtain the positive clone proGhOLE1_A::dsGhGl2-F-RNAi with correct sequencing. The plasmid was extracted and stored for future use.

[0279] 4) Construction of proGhOLE1_A::dsGhGl2-RNAi vector: proGhOLE1_A::dsGhGl2-F-RNAi was double-digested with AscⅠ and SpeⅠ restriction endonucleases to linearize the circular vector.

[0280] GhGl2 / GhGl3 gene antisense dsRNA chain amplification:

[0281] PCR amplification was performed using the forward primer RNAi-proGhOLE1_A-GhGl2-F2 (SEQ ID NO: 55): 5'-gtacgtgtgcagggcgcgccTATCAGAAGATCCCAATTCGACAA-3'; the reverse primer RNAi-proGhOLE1_A-GhGl2-R2 (SEQ ID NO: 56): 5'-ggaaattcgagctcactagtGGGGCGATGGCTATTTTCG-3' as a primer pair and upland cotton DNA as a template to obtain the GhGl2 / GhGl3 gene antisense interference fragment 2. The sequence is shown in SEQ ID NO:57; GhGl2 / GhGl3 gene antisense interference fragment 2 was purified and recovered, and enzymatically ligated with the linearized proGhOLE1_A::dsGhGl2-F-RNAi vector using a one-step cloning enzyme, followed by transformation, ultimately obtaining a positive clone, proGhOLE1_A::dsGhGl2-RNAi (SEQ ID NO:58), which was sequenced correctly. The nucleotide sequence encoding the dsRNA targeting the GhGl2 / GhGl3 genes is shown in SEQ ID NO:59, and the nucleotide sequence of the seed-specific promoter proGhOLE1_A fused with the coding sequence of the dsRNA targeting the GhGl2 / GhGl3 genes is shown in SEQ ID NO:60.

[0282] (VI) Construction of proGhALB2S::dsGhGl2-RNAi vector

[0283] 1) Linearization of WMV076 (a plant RNAi vector provided by Jiangsu Weimi Biotechnology Co., Ltd.): Double-digest the WMV076 vector with HindIII and XbaⅠ restriction endonucleases to linearize the circular vector.

[0284] 2) Construction of proGhALB2S-RNAi intermediate vector: Using upland cotton DNA as a template, primers with linkers were designed using one-step cloning technology to amplify the promoter proGhALB2S.

[0285] Forward primer sequence RNAi-proGhALB2S-F (SEQ ID NO: 61):

[0286] 5'-gatcccccgaattaAAGCTTgcgactcgacgattgttccttg-3';

[0287] Reverse primer sequence RNAi-proGhALB2S-R (SEQ ID NO: 62):

[0288] 5'-gtacGGATCCCCGGTCTAGAtgttgatttatgctggtatggagaaaataatcagatgag-3'.

[0289] The amplification system and PCR reaction procedures were the same as above.

[0290] Detection and recovery of vector enzyme digestion products and PCR products: PCR products and enzyme digestion products were detected by agarose gel electrophoresis, and then The target fragment was purified and recovered using Quick Gel Extraction Kit.

[0291] Recombination of rubber recovery products: -Basic Seamless cloning and Assembly Kit for homologous recombination.

[0292] The recombinant product was transformed into Escherichia coli DH5α, and PCR detection was performed using KOD OneTM PCR Master Mix. Positive clones were selected and sent to Shanghai Sangon Biotechnology Co., Ltd. for sequencing. After sequence alignment, the plasmids of the correctly sequenced clones were extracted using a plasmid miniprep kit to obtain the proGhALB2S-RNAi intermediate vector.

[0293] 3) Construction of proGhALB2S::dsGhGl2-F-RNAi intermediate vector: The proGhALB2S-RNAi vector was cut with BamHI restriction endonuclease to linearize the circular vector.

[0294] GhGl2 / GhGl3 gene positive dsRNA chain amplification:

[0295] PCR amplification was performed using the forward primer RNAi-proGhALB2S-GhGl2-F1 (SEQ ID NO: 63): 5'-aacatctagaccggggatccATGTCTTCCTCTTCTTCGTCTTCTCT-3'; and the reverse primer RNAi-proGhALB2S-GhGl2-R1 (SEQ ID NO: 64): 5'-cggtatatacgtacggatccCAAGAATCCCATCACCTACAGCG-3' as a primer pair and upland cotton DNA as a template to obtain the GhGl2 / GhGl3 gene positive interference fragment 3 (SEQ ID NO: 65). The GhGl2 / GhGl3 gene positive interference fragment 3 was purified and recovered, and enzymatically ligated with the linearized proGhALB2S-RNAi vector using a one-step cloning enzyme, and transformed to obtain a positive clone proGhALB2S::dsGhGl2-F-RNAi with correct sequencing. The plasmid was extracted and stored for future use.

[0296] 4) Construction of proGhALB2S::dsGhGl2-RNAi vector: proGhALB2S::dsGhGl2-F-RNAi was double-digested with AscⅠ and SpeⅠ restriction endonucleases to linearize the circular vector.

[0297] GhGl2 / GhGl3 gene antisense dsRNA chain amplification:

[0298] PCR amplification was performed using the forward primer RNAi-proGhALB2S-GhGl2-F2 (SEQ ID NO: 66): 5'-gtacgtgtgcagGGCGCGCCCAAGAATCCCATCACCTACAGCG-3'; the reverse primer RNAi-proGhALB2S-GhGl2-R2 (SEQ ID NO: 67): 5'- GGAAATTCGAGCTCACTAGTATGTCTTCCTCTTCTTCGTCTTCTCT-3' as a primer pair and upland cotton DNA as a template to obtain the GhGl2 / GhGl3 gene antisense interference fragment 3, the sequence of which is shown in SEQ ID NO:68; GhGl2 / GhGl3 gene antisense interference fragment 3 was purified and recovered, and enzymatically ligated with the linearized proGhALB2S::dsGhGl2-F-RNAi vector using a one-step cloning enzyme, followed by transformation, ultimately obtaining a positive clone, proGhALB2S::dsGhGl2-RNAi (SEQ ID NO:69), which was sequenced correctly. The nucleotide sequence encoding the dsRNA targeting the GhGl2 / GhGl3 gene is shown in SEQ ID NO:70, and the nucleotide sequence of the seed-specific promoter proGhALB2S fused with the coding sequence of the dsRNA targeting the GhGl2 / GhGl3 gene is shown in SEQ ID NO:71.

[0299] (VII) Construction of proGhOLE1_A::GhGl2 / GhGl3-miRNA, proGhOLE1_D::GhGl2-miRNA, and proGhALB2S::GhGl2-miRNA vectors

[0300] The miRNA silencing vector was modified based on the Arabidopsis miR319a gene silencing sequence, which is divided into a head segment, a tail segment, and a core silencing segment.

[0301] Arabidopsis miR319a gene silencing sequence (SEQ ID NO: 30):

[0302] First fragment (SEQ ID NO: 31):

[0303] Tail fragment (SEQ ID NO: 32):

[0304] Core Silencing Fragment (SEQ ID NO: 33):

[0305] The specific construction method of proGhOLE1_A::GhGl2 / GhGl3-miRNA vector is as follows:

[0306] 1) First, a Median Vector (SEQ ID NO: 34) containing the Arabidopsis miR319a first and tail fragments was synthesized by Sangon Biotech Co., Ltd. StuI and SnaBI restriction sites were added between the first and tail fragments to facilitate the subsequent addition of the core silencing fragment. Primers with adapters were designed using a one-step cloning technique to amplify the Median Vector sequence.

[0307] Forward primer sequence Median Vector-F: 5′-CAAACACACGCTCGGACGC-3′ (SEQ ID NO: 35);

[0308] Reverse primer sequence Median Vector-R: 5′-tcctaggctacgtaggatccCATGGCGATGCCTTAAATAAAGA-3′ (SEQ ID NO: 36).

[0309] 2) Linearization of VM062 (plant overexpression vector provided by Jiangsu Weimi Biotechnology Co., Ltd.): Double-digest the VM062 vector with HindⅢ and BamHI restriction enzymes to linearize the circular vector.

[0310] 3) Amplification of seed-specific promoters proGhOLE1_A, proGhOLE1_D, and proGhALB2S: PCR amplification was performed using upland cotton DNA as a template to obtain the seed-specific promoters proGhOLE1_A, proGhOLE1_D, and proGhALB2S. The amplification primers are as follows:

[0311] Seed-specific promoter proGhOLE1_A amplification primers:

[0312] Forward primer miRNA-proGhOLE1_A-F:

[0313] 5'-gccagtgccaagctaagcttTGAGTTTGGGAAATTAGGCATCC-3' (SEQ ID NO: 37);

[0314] Reverse primer miRNA-proGhOLE1_A-R:

[0315] 5'-tgcgtccgagcgtgtgtttgTGATTAAAAAAACAAAGAAAAGAACTTG-3' (SEQ ID NO: 38);

[0316] Seed-specific promoter proGhOLE1_D amplification primers:

[0317] Forward primer miRNA-proGhOLE1_D-F:

[0318] 5'-gccagtgccaagctaagcttCTGATCAGTCTGCTGTCAAATCG-3' (SEQ ID NO:72);

[0319] Reverse primer miRNA-proGhOLE1_D-R:

[0320] 5'-tgcgtccgagcgtgtgtttgTGCCTAAAAAAACAAAGAAAAGAACT-3' (SEQ ID NO: 73);

[0321] Seed-specific promoter proGhALB2S amplification primers:

[0322] Forward primer miRNA-proGhALB2S_A-F:

[0323] 5'-gccagtgccaagctaagcttGCGACTCGACGATTGTTCCTTG-3' (SEQ ID NO:74);

[0324] Reverse primer miRNA-proGhALB2S_A-R:

[0325] 5'-tgcgtccgagcgtgtgtttgTGTTGATTTATGCTGGTATGGAGAA-3' (SEQ ID NO: 75).

[0326] The Median Vector and proGhOLE1_A, proGhOLE1_D, and proGhALB2S fragments were obtained by PCR amplification. After purification and recovery, they were enzymatically ligated with the linearized VM062 vector using a one-step cloning enzyme and transformed to obtain positive clones proGhOLE1_A-Median Vector, proGhOLE1_D-Median Vector, and proGhALB2S-Median Vector with correct sequencing. The plasmids were extracted and stored for future use.

[0327] 4) Construction of proGhOLE1_A::GhGl2 / GhGl3-miRNA, proGhOLE1_D::GhGl2-miRNA, and proGhALB2S::GhGl2-miRNA vectors: First, GhGl2 / GhGl3 artificial miRNA sequences were designed at http: / / wmd3.weigelworld.org / (Warthman et al., 2008). The designed artificial miRNA fragments were reverse-complemented, and positions 12 and 16 were transposed to GA, CA, TA, or AT to obtain the forward sequence (SEQ ID NO: 39, TGATACGGTATTGTAACGCTC) and reverse sequence (SEQ ID NO: 40, GAGCGTTACAATACCGTATCA) of the GhGl2 / GhGl3 artificial miRNAs, where the underlined positions indicate the substituted positions. The forward and reverse sequences of the GhGl2 / GhGl3 artificial miRNA were fused to the Arabidopsis miR319a core silencing fragment through gene synthesis by Sangon Biotech (Shanghai) Co., Ltd., and designated the stem-loop: TGATACGGTATTGTAACGCTCcacaggtcgtgatatgattcaattagcttccgactcattcatccaaataccgagtcgccaaaattcaaactagactcgttaaatgaatgaatgatgcggtagacaaattggatcattgattctctttgaGAGCGTTACAATACCGTATCA (SEQ ID NO:41). Primers with adapters were designed using a one-step cloning technique to amplify the stem-loop containing the GhGl2 / GhGl3 gene core silencing fragment.

[0328] Forward primer Stem-loop-F:

[0329] 5'-gttttaggaatatataggTGATACGGTATTGTAACGCTC-3' (SEQ ID NO: 42);

[0330] Reverse primer Stem-loop-R:

[0331] 5'-AAATTGGAATACAAAtacTGATACGGTATTGTAACGCTC-3' (SEQ ID NO: 43).

[0332] The proGhOLE1_A-Median Vector, proGhOLE1_D-Median Vector, and proGhALB2S-Median Vector were double-digested with StuⅠ and SnaBI restriction enzymes to linearize the circular vectors. The Stem-loop core silencing fragments with adapters were purified and recovered, then ligated with the linearized vectors using a one-step cloning enzyme. Finally, positive clones, proGhOLE1_A::GhGl2 / GhGl3-miRNA, proGhOLE1_D::GhGl2-miRNA, and proGhALB2S::GhGl2-miRNA, which were sequenced correctly, were obtained. Among them, the nucleotide sequence encoding the microRNA targeting the GhGl2 / GhGl3 gene (first fragment-GhGl2 / GhGl3 core silent fragment-tail fragment) is shown in SEQ ID NO: 44, and the nucleotide sequences of proOLE1_A-first fragment-GhGl2 / GhGl3 core silent fragment-tail fragment, proOLE1_D-first fragment-GhGl2 / GhGl3 core silent fragment-tail fragment and proALB2S-first fragment-GhGl2 / GhGl3 core silent fragment-tail fragment are shown in SEQ ID NOs: 45, 76 and 77, respectively.

[0333] Sequence Listing

Claims

1. A method for inhibiting the formation of pigment glands in cotton seeds, the method comprising causing the cotton seeds to express an inhibitory molecule that inhibits the expression and / or activity of Gl2 / Gl3 proteins, wherein the inhibitory molecule is expressed by a seed-specific promoter of the cotton.

2. A method for reducing the cottonpol content in cotton seeds, the method comprising causing the cotton seeds to express an inhibitory molecule that inhibits the expression and / or activity of Gl2 / Gl3 proteins, wherein the inhibitory molecule is expressed by a cotton seed-specific promoter.

3. The method of claim 1 or 2, wherein the seed-specific promoter: (1) initiating the expression of the inhibitory molecule no later than the expression time of Gl2 / Gl3 protein during seed development of wild-type cotton; (2) making the expression level of the inhibitory molecule no less than the sum of the expression levels of the wild-type Gl2 and Gl3 proteins; and (3) The expression of the inhibitory molecule is initiated only during the development of cotton seeds, and the expression of the inhibitory molecule is not initiated or substantially not initiated after the germination of mature seeds and at other stages of cotton plant development.

4. The method according to any one of claims 1 to 3, wherein the seed-specific promoter is a promoter derived from the OLE_A, OLE_D or ALB2S gene; Preferably, the seed-specific promoter comprises a nucleotide sequence having at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% sequence identity to SEQ ID NO: 1-3.

5. The method of any one of claims 1 to 4, wherein the inhibitory molecule is selected from: dsRNA, shRNA, antisense nucleic acid, small interfering RNA (siRNA), microRNA (microRNA or miRNA), antibody or antigen-binding fragment thereof, small molecule ligand or a combination thereof that inhibits or silences a gene.

6. The method of claim 5, wherein the inhibitory molecule is dsRNA, which targets mRNA transcribed from the Gl2 / Gl3 gene.

7. The method of claim 6, wherein the nucleotide sequence encoding the dsRNA comprises a nucleotide sequence having at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% sequence identity to SEQ ID NO: 28, 59 or 70.

8. The method of claim 5, wherein the inhibitory molecule is a microRNA, and the microRNA targets the mRNA generated by transcription of the Gl2 / Gl3 gene; Preferably, the nucleotide sequence encoding the microRNA comprises a nucleotide sequence having at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% sequence identity to SEQ ID NO:

44.

9. The method of any one of claims 6-8, comprising integrating into the genome of the cotton a nucleotide sequence having at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% sequence identity to SEQ ID NO: 29, 45, 60, 71, 76 or 77.

10. The method according to any one of claims 1 to 9, comprising the steps of: (1) transforming the nucleotide sequence containing the seed-specific promoter and encoding the inhibitory molecule into Agrobacterium to obtain Agrobacterium carrying the nucleotide sequence; and (2) contacting cotton cells, seeds, tissues, organs or plants with the Agrobacterium carrying the nucleotide sequence in step (1), thereby introducing the nucleotide sequence into the cotton cells, seeds, tissues, organs or plants.

11. The method according to any one of claims 1 to 10, comprising causing the cotton seeds to express two or more inhibitory molecules that inhibit the expression and / or activity of Gl2 / Gl3 proteins, wherein the two or more inhibitory molecules are expressed by the same or different cotton seed-specific promoters, preferably the cotton seed-specific promoters are each independently selected from promoters derived from OLE_A, OLE_D or ALB2S genes.

12. The method of any one of claims 1-11, wherein the method results in the absence of pigment glands in the cotton seeds compared to pigment glands in wild-type cotton seeds, and the occurrence and development of pigment glands in the cotton plants is not affected.

13. The method of any one of claims 1-12, wherein the method reduces the gossypol content in the cotton seed by 99%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9% or 100% compared to the gossypol content of wild-type cotton seeds.

14. The method of any one of claims 1 to 13, wherein the method results in a cotton plant having a gossypol content in each tissue that is no different or substantially no different than the gossypol content in each tissue of a wild-type cotton plant.

15. Cotton cell, seed, tissue, organ or plant obtained by the method of any one of claims 1 to 14.

16. A cotton cell, seed, tissue, organ or plant comprising a nucleotide sequence encoding an inhibitory molecule that inhibits the expression and / or activity of a G12 / G13 protein, wherein the inhibitory molecule is expressed from a cotton seed-specific promoter.

17. The cotton cell, seed, tissue, organ or plant of claim 16, wherein the seed-specific promoter: (1) initiating the expression of the inhibitory molecule no later than the expression time of Gl2 / Gl3 protein during seed development of wild-type cotton; (2) making the expression level of the inhibitory molecule no less than the sum of the expression levels of the wild-type Gl2 and Gl3 proteins; and (3) The expression of the inhibitory molecule is initiated only during the development of cotton seeds, and the expression of the inhibitory molecule is not initiated or substantially not initiated after the germination of mature seeds and at other stages of cotton plant development.

18. The cotton cell, seed, tissue, organ or plant of claim 16 or 17, wherein the seed-specific promoter is a promoter derived from the OLE_A, OLE_D or ALB2S gene; Preferably, the seed-specific promoter comprises a nucleotide sequence having at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% sequence identity to SEQ ID NO: 1-3.

19. The cotton cell, seed, tissue, organ or plant of any one of claims 16-18, wherein the inhibitory molecule is selected from: dsRNA, shRNA, antisense nucleic acid, small interfering RNA (siRNA), microRNA (microRNA or miRNA), antibody or antigen-binding fragment thereof, small molecule ligand or a combination thereof that inhibits or silences a gene.

20. The cotton cell, seed, tissue, organ or plant of claim 19, wherein the inhibitory molecule is dsRNA, which targets mRNA transcribed from the Gl2 / Gl3 gene.

21. The cotton cell, seed, tissue, organ or plant of claim 20, wherein the nucleotide sequence encoding the dsRNA comprises a nucleotide sequence having at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% sequence identity to SEQ ID NO:28, 59 or 70.

22. The cotton cell, seed, tissue, organ or plant of claim 19, wherein the inhibitory molecule is a microRNA, and the microRNA targets the mRNA generated by transcription of the Gl2 / Gl3 gene; Preferably, the nucleotide sequence encoding the microRNA comprises a nucleotide sequence having at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% sequence identity to SEQ ID NO:

44.

23. The cotton cell, seed, tissue, organ or plant of any one of claims 20-22, obtained by integrating a nucleotide sequence having at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% sequence identity to SEQ ID NO: 29, 45, 60, 71, 76 or 77 into the genome of cotton.

24. The cotton cell, seed, tissue, organ or plant of any one of claims 16 to 23, obtained by the following steps: (1) transforming the nucleotide sequence containing the seed-specific promoter and encoding the inhibitory molecule into Agrobacterium to obtain Agrobacterium carrying the nucleotide sequence; and (2) contacting cotton cells, seeds, tissues, organs or plants with the Agrobacterium carrying the nucleotide sequence in step (1), thereby obtaining the cotton cells, seeds, tissues, organs or plants.

25. The cotton cell, seed, tissue, organ or plant of any one of claims 16 to 24, comprising a nucleotide sequence encoding an inhibitory molecule for the expression and / or activity of two or more Gl2 / Gl3 proteins, wherein the two or more inhibitory molecules are expressed by the same or different cotton seed-specific promoters, preferably the cotton seed-specific promoters are each independently selected from a promoter derived from the OLE_A, OLE_D or ALB2S gene.

26. A nucleic acid construct comprising, from 5' to 3', a cotton seed-specific promoter and a nucleotide sequence encoding an inhibitory molecule that inhibits the expression and / or activity of a G12 / G13 protein.

27. The nucleic acid construct of claim 26, wherein the seed-specific promoter is a promoter derived from the OLE_A, OLE_D or ALB2S gene; Preferably, the seed-specific promoter comprises a nucleotide sequence having at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% sequence identity to SEQ ID NO: 1-3.

28. The nucleic acid construct of claim 26 or 27, wherein the inhibitory molecule is selected from: dsRNA, shRNA, antisense nucleic acid, small interfering RNA (siRNA), microRNA (microRNA or miRNA), antibody or antigen-binding fragment thereof, small molecule ligand or a combination thereof that inhibits or silences a gene.

29. The nucleic acid construct of claim 28, wherein the inhibitory molecule is a dsRNA that targets the mRNA generated by transcription of the Gl2 / Gl3 gene.

30. The nucleic acid construct of claim 29, wherein the nucleotide sequence encoding the dsRNA comprises a nucleotide sequence having at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% sequence identity to SEQ ID NO: 28, 59 or 70.

31. The nucleic acid construct of claim 28, wherein the inhibitory molecule is a microRNA that targets mRNA generated by transcription of the Gl2 / Gl3 gene; Preferably, the nucleotide sequence encoding the microRNA comprises a nucleotide sequence having at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% sequence identity to SEQ ID NO:

44.

32. The nucleic acid construct of any one of claims 29-31, comprising a nucleotide sequence having at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% sequence identity to SEQ ID NO:29, 45, 60, 71, 76 or 77.

33. The nucleic acid construct of any one of claims 26 to 32, comprising a nucleotide sequence encoding two or more inhibitory molecules that inhibit the expression and / or activity of Gl2 / Gl3 proteins, wherein the two or more inhibitory molecules are operably linked to the same or different cotton seed-specific promoters, preferably the cotton seed-specific promoters are each independently selected from promoters derived from OLE_A, OLE_D or ALB2S genes.

34. The nucleic acid construct of any one of claims 26 to 33 for use in inhibiting pigment gland formation in cotton seeds.

35. The nucleic acid construct of any one of claims 26 to 33, for use in reducing the content of gossypol in cotton seeds.

Images