Closed SARS-CoV-2 isothermal amplification nucleic acid detection kit

Abstract

The invention relates to the technical field of virus nucleic acid detection methods, and particularly relates to an RT-LAMP nucleic acid detection primer group of SARS-CoV-2 and a closed SARS-CoV-2 isothermal amplification nucleic acid detection kit. According to the kit provided by the invention, nucleic acid extraction is not needed for virus RNA of a throat swab sample, and the sample can be directly amplified. The kit is a visual instant screening kit for the SARS-CoV-2 by a one-step method. The kit has good specificity, can eliminate non-specific interference of other coronavirus strains, is quick and efficient, and can complete detection within one hour. Large expensive and precise instruments and equipment are not needed, only a common metal bath or water bath kettle is needed, detection cost is low, toxic reagents are not involved and closed operation is performed in the whole process, secondary pollution is avoided, and safety of operators and an environment is ensured.

Description

technical field

[0001] The invention relates to the technical field of viral nucleic acid detection methods, in particular to a SARS-CoV-2 RT-LAMP nucleic acid detection primer set and a closed SARS-CoV-2 isothermal amplification nucleic acid detection kit. Background technique

[0002] With the release of the "Diagnosis and Treatment Program for Pneumonia Infected by Novel Coronavirus (Trial Sixth Edition)", the importance of nucleic acid testing as an important standard for diagnosis has been generally recognized. However, nucleic acid detection involves extraction, amplification, detection, etc., and has high requirements for the laboratory environment and operators. A complete nucleic acid detection procedure for the new coronavirus often requires professional testers to operate with their hands off the platform for more than 3 hours in a row, involving large-scale Therefore, the popularization and on-site application of nucleic acid detection are limited, which leads to...

Examples

Embodiment 1

[0050] This embodiment provides a closed SARS-CoV-2 isothermal amplification nucleic acid detection kit, the kit includes reaction premix A, reaction premix B, HNB chromogen, detection tube, standard positive template, negative control. The reaction premix consists of reaction premix A and reaction premix B. Wherein, the reaction premix A includes Bst DNA large fragment polymerase, AMV reverse transcriptase; the reaction premix B includes 10X reaction buffer, primer set, dNTPs, magnesium sulfate, betaine, 6wt% formamide and DEPC water.

[0051] The primer set includes a pair of outer primers F3-1 and B3-1, a pair of inner primers FIP-1 and BIP-1, and a pair of loop primers LF-1 and LB-1.

[0052] The nucleotide sequences of F3-1, B3-1, FIP-1, BIP-1, LF-1, LB-1 are as follows:

[0053] F3-1 (SEQ ID NO.1): 5'CTAGGTTTCAAACTTTACTTGC3';

[0054] B3-1 (SEQ ID NO.2): 5'CCTTTTTCTACAGTGAAGGATT3';

[0055] FIP-1 (SEQ ID NO.3):

[0056] 5'CACATAATAAGCTGCAGCACCA-TACATAGAAGTTATTTGACTCC...

Embodiment 2

[0071] In combination with the requirements of the detection standards detected by the kit of the present invention, clinical verification has been carried out on the samples to be tested.

[0072] Comparison of LAMP test results with qPCR test

[0073]

[0074] LAMP positive detection rate for positive samples: 100%

[0075] LAMP positive detection rate for negative samples: 100%

technical field

[0001] The invention relates to the technical field of viral nucleic acid detection methods, in particular to a SARS-CoV-2 RT-LAMP nucleic acid detection primer set and a closed SARS-CoV-2 isothermal amplification nucleic acid detection kit. Background technique

[0002] With the release of the "Diagnosis and Treatment Program for Pneumonia Infected by Novel Coronavirus (Trial Sixth Edition)", the importance of nucleic acid testing as an important standard for diagnosis has been generally recognized. However, nucleic acid detection involves extraction, amplification, detection, etc., and has high requirements for the laboratory environment and operators. A complete nucleic acid detection procedure for the new coronavirus often requires professional testers to operate with their hands off the platform for more than 3 hours in a row, involving large-scale Therefore, the popularization and on-site application of nucleic acid detection are limited, which leads to...

Examples

Embodiment 1

[0050] This embodiment provides a closed SARS-CoV-2 isothermal amplification nucleic acid detection kit, the kit includes reaction premix A, reaction premix B, HNB chromogen, detection tube, standard positive template, negative control. The reaction premix consists of reaction premix A and reaction premix B. Wherein, the reaction premix A includes Bst DNA large fragment polymerase, AMV reverse transcriptase; the reaction premix B includes 10X reaction buffer, primer set, dNTPs, magnesium sulfate, betaine, 6wt% formamide and DEPC water.

[0051] The primer set includes a pair of outer primers F3-1 and B3-1, a pair of inner primers FIP-1 and BIP-1, and a pair of loop primers LF-1 and LB-1.

[0052] The nucleotide sequences of F3-1, B3-1, FIP-1, BIP-1, LF-1, LB-1 are as follows:

[0053] F3-1 (SEQ ID NO.1): 5'CTAGGTTTCAAACTTTACTTGC3';

[0054] B3-1 (SEQ ID NO.2): 5'CCTTTTTCTACAGTGAAGGATT3';

[0055] FIP-1 (SEQ ID NO.3):

[0056] 5'CACATAATAAGCTGCAGCACCA-TACATAGAAGTTATTTGACTCC...

Embodiment 2

[0071] In combination with the requirements of the detection standards detected by the kit of the present invention, clinical verification has been carried out on the samples to be tested.

[0072] Comparison of LAMP test results with qPCR test

[0073]

[0074] LAMP positive detection rate for positive samples: 100%

[0075] LAMP positive detection rate for negative samples: 100%

Images