Adenovirus type-specific DNA aptamers

Abstract

The present invention relates to a single-stranded nucleic acid aptamer capable of specifically binding to at least one adenovirus type, the aptamer comprising one of the sequences SEQ ID NO: 1 to 3 or a variant thereof having at least 50% sequence identity, or consisting of one of the sequences SEQ ID NO: 1 to 3 or a variant thereof having at least 50% sequence identity. The present invention also relates to a composition comprising the aptamer. The present invention relates to the use of the aptamer for detecting, capturing, concentrating and / or quantifying at least one adenovirus type. The present invention relates to an in vitro method for capturing, detecting and / or quantifying at least one adenovirus type. The present invention also relates to a kit for detecting, quantifying, capturing and / or concentrating at least one adenovirus type.

Description

Technical Field

[0001] The present invention relates to specific aptamers of one or more adenovirus types and their use. Background Art

[0002] Enteroviruses (enteroviruses, noroviruses, adenoviruses, and hepatitis A and E viruses, among others) are present in high concentrations in the feces of infected individuals and can subsequently be spread in aquatic environments by way of wastewater effluents. These viruses are primarily transmitted from person to person, or through contaminated food and drinking water, as well as through bathing or recreational activities. Among these viruses, human adenoviruses (HAdVs) are capable of causing a number of diseases, including gastroenteritis, conjunctivitis, myocarditis, and pneumonia. Geographically, these viruses are distributed worldwide and are commonly found in a variety of water sources, including river water, seawater, or groundwater. Compared to other enteroviruses (e.g., enteroviruses or noroviruses), they are generally more abundant (Lee and Kim, 2008; Verheyen et al., 2009; Wyn-Jones et al., 2011), can be found in water all year round and have remarkable survival characteristics (Enriquez et al., 1995; Ogorzaly et al., 2010).

[0003] Adenovirus (AdV) belongs to the family of Adenoviridae, a family of non-enveloped viruses with a double-stranded DNA genome. Depending on the analytical framework and the type of sample (clinical, food or environmental samples), different detection methods targeting the viral genome or capsid can be applied, each with its advantages and disadvantages. Molecular amplification methods, namely polymerase chain reaction (PCR) are commonly used in food and environmental settings, while immunological techniques such as enzyme-linked immunosorbent assay (ELISA) using antibodies are the rule for clinical samples. The antigen method is suitable for samples presenting high viral concentrations, but it is not sensitive enough for environmental and food samples. In addition, the binding capacity of antibodies can be affected by the complex matrix of the sample. Therefore, there is a need to develop alternative AdV diagnostic tools to complement the existing ones, thereby providing a rapid, sensitive and effective method that will allow the relevant authorities to reduce the risk of infection from enteric and other diseases and limit the spread of the virus.

[0004] The published prior art patent document US 2017 / 0114420 A1 discloses an aptamer that specifically binds to norovirus. The aptamer is used to detect the presence of norovirus and to capture and / or concentrate norovirus from a test sample. However, there is no solution disclosed for detecting and capturing adenovirus.

[0005] Published prior art patent document US 9,562,900 B2 discloses aptamers that specifically target and bind to foodborne and waterborne pathogenic bacteria or parasites, molds or other pathogenic fungi. The document does not disclose tools for analyzing (detecting, etc. ...) viruses, more particularly adenoviruses, in samples such as food or water.

[0006] Published prior art patent documents EP 2 859 121 B1 and EP 2 613 147 B1 disclose methods, devices, reagents and kits for detecting one or more target molecules that may be present in a test sample using aptamers. These documents do not disclose any tools for analyzing adenoviruses.

[0007] Brief description of the invention

[0008] Technical issues

[0009] The present invention is directed to the technical problem of providing a rapid, sensitive and effective tool for the analysis of adenovirus types in a sample. The present invention is also directed to the technical problem of providing an inexpensive solution.

[0010] Technical Solution

[0011] The present invention relates to a single-stranded nucleic acid aptamer capable of specifically binding to at least one adenovirus type, wherein the aptamer comprises one of the sequences SEQ ID NO: 1 to 3 or a variant thereof having at least 50% sequence identity, or consists of one of the sequences SEQ ID NO: 1 to 3 or a variant thereof having at least 50% sequence identity.

[0012] The present invention also relates to a composition comprising at least one single-stranded nucleic acid aptamer capable of specifically binding to at least one adenovirus type and at least one adenovirus type, wherein the aptamer comprises one of the sequences SEQ ID NO: 1 to 3 or a variant thereof having at least 50% sequence identity, or consists of one of the sequences SEQ ID NO: 1 to 3 or a variant thereof having at least 50% sequence identity.

[0013] The present invention also relates to the use of a single-stranded nucleic acid aptamer capable of specifically binding to at least one adenovirus type for detecting, capturing, quantifying and / or concentrating at least one adenovirus type, wherein the aptamer comprises one of the sequences SEQ ID NO: 1 to 3 or a variant thereof having at least 50% sequence identity, or consists of one of the sequences SEQ ID NO: 1 to 3 or a variant thereof having at least 50% sequence identity.

[0014] The present invention also relates to an in vitro method for capturing at least one adenovirus type in a sample, comprising the step of contacting the sample with a single-stranded nucleic acid aptamer capable of specifically binding to at least one adenovirus type, the aptamer comprising one of the sequences SEQ ID NO: 1 to 3 or a variant thereof having at least 50% sequence identity, or consisting of one of the sequences SEQ ID NO: 1 to 3 or a variant thereof having at least 50% sequence identity.

[0015] The present invention also relates to an in vitro method for detecting and / or quantifying at least one adenovirus type in a sample, comprising: performing the in vitro method for capture according to the present invention, quantifying or detecting the presence or absence of aptamers bound to adenovirus; thereby inferring the amount or presence or absence of adenovirus in the sample.

[0016] According to a preferred embodiment, the presence or absence of the aptamer bound to the adenovirus is quantified or detected by comparison with a control group.

[0017] According to a preferred embodiment, the detection of the presence or absence of an aptamer binding to an adenovirus in said sample is carried out by performing a PCR aimed at amplifying said aptamer and / or by an enzyme-linked aptamer adsorption assay, wherein said PCR is performed using a set of two primers corresponding to the sequences 5'-GTGCCAGCTATGCCATTG-3' and 5'-GCAGCAGAGATAGACGCTA-3'.

[0018] According to a preferred embodiment, wherein the at least one aptamer comprises a detectable label, and detecting the presence or absence of the aptamer bound to the adenovirus in the sample is performed by detecting the label.

[0019] The present invention also relates to a kit for detecting, quantifying, capturing and / or concentrating at least one adenovirus type, the kit comprising at least one single-stranded nucleic acid aptamer capable of specifically binding to at least one adenovirus type, the aptamer comprising one of the sequences SEQ ID NO: 1 to 3 or a variant thereof with at least 50% sequence identity, or consisting of one of the sequences SEQ ID NO: 1 to 3 or a variant thereof with at least 50% sequence identity.

[0020] According to a preferred embodiment, the kit further comprises a support or solution having at least one capture element and / or detection means for said at least one adenovirus type.

[0021] According to a preferred embodiment, said at least one capture element comprises one or more of said at least one aptamer.

[0022] According to a preferred embodiment, the detection means comprises one or more of the aptamers linked to a detectable label.

[0023] According to a preferred embodiment, the detectable label is bound to the 5' or 3' end of the aptamer.

[0024] According to a preferred embodiment, a set of two primers is further included to amplify the aptamer bound to the adenovirus, the set of two primers being capable of binding to the at least one aptamer and corresponding to the sequences 5'-GTGCCAGCTATGCCATTG-3' and 5'-GCAGCAGAGATAGACGCTA-3'.

[0025] Advantages of the Invention

[0026] The present invention is particularly interesting in that the aptamers of the present invention are specific for adenovirus types and are able to specifically bind to different adenovirus types with high affinity. Aptamers can be used instead of commercial monoclonal antibodies. Aptamers show similar affinity to antibodies for adenovirus types. Aptamers show long-term stability. Another advantage of aptamers is that they are less expensive and easier to store than antibodies. The methods and kits of the present invention are easy to use and / or perform for quantifying, detecting, capturing and / or concentrating at least one adenovirus type. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Figure 1 Indicates HAdV-2 (about 10 7 Direct ELISA results of incubation of 1000 μM (400 μM) with twenty biotinylated candidate aptamers. All aptamers were used at the same concentration of 1 μM.

[0029] Figure 2 Shown is the percentage of binding to HAdV-2 according to the concentration of the aptamer 10 comprising SEQ ID NO: 1. The concentration of the aptamer ranged from 0 to 1000 nM.

[0030] Figure 3 is for aptamer concentrations ranging from 0 to 20 nM Figure 2 Magnified image of .

[0031] Figure 4 Shown is the percentage of binding to HAdV-2 according to the concentration of aptamer 20 comprising SEQ ID NO: 3. The concentration of the aptamer ranged from 0 to 1000 nM.

[0032] Figure 5 The specificity of aptamer 10 against various viruses was demonstrated.

[0033] Figure 6 The specificity of aptamer 20 against various viruses is shown. DETAILED DESCRIPTION OF THE INVENTION

[0035] Virus stock generation and purification

[0036] HAdV-2 (human adenovirus type 2) was selected for aptamer selection. HAdV-2 was obtained from the Health Protection Agency culture collection (NCPV#213) and propagated on the human embryonic kidney cell line 293A (Invitrogen). Cells were grown in Dulbecco's Modified Eagle medium (D-MEM) containing high glucose concentration and Glutamax (Life Technologies), and supplemented with 1% non-essential amino acids (Life Technologies) and 5% non-heat-inactivated fetal bovine serum (Life Technologies). The HAdV-2 stock solution was prepared by freeze-thaw lysis of the infected 293A monolayer, followed by centrifugation (1200 rpm, 10 minutes, 4°C) to remove cell debris. The virus suspension was then purified by cesium chloride equilibrium density gradient centrifugation. The purified AdV band was collected using a syringe and injected directly into a float-a-lyser dialysis device (Spectrum Labs, USA) with a molecular weight cutoff of 100 KDa. The dialysis apparatus was placed in a 2 L container with Dubelcco's PBS (DPBS) (Gibco) and gently rotated (50 rpm) at 4°C. The DPBS was changed after 2-4 hours, 6-8 hours, and 12-14 hours. After the dialysis step, the virus suspension was collected and stored at 4°C. The purified HAdV-2 stock solution was quantified by the nearest number (MPN) analysis using 293A cells (Ogorzaly et al. 2013).

[0037] Selection of aptamers

[0038] A 65 base pair combinatorial DNA library with constant forward and reverse regions (GTGCCAGCTATGCCATTG-N28-TAGCGTCTATCTCTGCTGC) and a 28 base pair random region (N28) containing equimolar incorporation of A, T, C and G (Eurogentec) at each position was synthesized. Prior to selection, a 1 μM single stranded DNA (ss DNA) pool in selection buffer (referred to herein as SB) (composed of DPBS (Gibco) supplemented with MgCl2 (3 mM) and NaCl2 (20 mM), pH 7.4, and sterilized by autoclave and then filtered through a 0.2 μm membrane) was heated to 95°C to denature the DNA and then allowed to cool to room temperature for 30 minutes before incubation with the virus.

[0039] Table 1 below discloses oligonucleotides used for selecting aptamers against AdV.

[0040] Table 1

[0041]

[0042] The target complex for SELEX was generated by fixing purified HAdV-2 to the antibody-magnetic bead complex. According to the manufacturer's instructions, the biotinylated monoclonal antibody 8C4 (HyTest, Finland) against AdV was conjugated to streptavidin immunomagnetic beads (ThermoFisher Scientific Aalst, Belgium). In brief, 100 μL of streptavidin immunomagnetic beads were aliquoted and washed 3 times with washing buffer DPBS-T (PBS containing 0.005% Tween20). A three-fold excess of biotinylated monoclonal antibody 8C4 (30 μg) was combined with streptavidin immunomagnetic beads by pipetting and mixing every 5-10 minutes and incubating at room temperature for 1 hour. The antibody-bead complex was separated magnetically, washed 3 times with DPBS-T, and then eluted in 100 μL DPBS containing 0.05% bovine serum albumin (BSA, Sigma Darmstadt, Germany). 100 μL of purified HAdV-2 stock solution (equivalent to about 10 7 MPN / mL) was mixed with 10 μL of antibody-bead complex suspended in 490 μL SB and incubated for 2 hours at room temperature. The target complex HAdV-2-antibody-bead was washed 3 times with PBS supplemented with 0.1% BSA and finally resuspended in 20 μL of DPBS.

[0043] SELEX was performed using the target complex (HAdV-2-antibody-beads), and negative SELEX was performed using the antibody-bead complex. In brief, 500 pmol / 500 μL of DNA library in the selection buffer was denatured by heating to 95°C for 5 minutes and cooled to room temperature for 30 minutes. Negative selection was initially performed by incubating the DNA library with the antibody-bead complex at room temperature for 45 minutes to reduce nonspecific interactions of the DNA collection with the surface. The bound DNA was separated by magnetism, and the supernatant (recovered DNA library) was used directly for the first round of SELEX. The recovered DNA was added to 10 μL of the target complex (equivalent to approximately 107 infectious virus particles / reaction) and incubated at room temperature for 30 minutes. The bound DNA sequence was recovered by magnetic capture and washed 3 times with DPBS-T to facilitate the removal of non-binding and / or poor binding. 100 microliters of nuclease-free water was added to the beads, and the sample was heated to 90°C for 5 minutes to release the DNA. ss-DNA (Table 1) was amplified by PCR using a constant forward primer and a phosphorylated reverse primer. The final volume of PCR was 50 μL, of which 10 μL contained the DNA target. The reaction was performed on a Biometra T-Advanced96SG system (Germany) and the following conditions were applied: 95°C for 2 minutes, followed by various cycles of 95°C for 15 seconds, 67°C for 1 minute, and 72°C for 30 seconds, with a final extension of 2 minutes at 72°C. The PCR products were visualized on a 4% agarose gel stained with ethidium bromide. The PCR reaction was stopped when a 65 bp band appeared on the agarose gel. Double-stranded DNA (dsDNA) was purified using a centrifugal column (Nucleospin Gel and PCR purification system, Machery and Nagel). In order to separate dsDNA, 1 μL 1U λ exonuclease (Thermo Scientific, UK) was incubated at 37°C for 1 hour, and then ssDNA was confirmed by 4% agarose gel electrophoresis. All selection rounds were implemented in the same manner, but the concentration of HAdV-2 infectious particles was reduced and the concentration of DNA collection was reduced. The incubation time between rounds was also reduced, and the volume and number of wash steps were increased to increase the selection pressure of the process.

[0044] Identification of aptamer sequences

[0045] ssDNA obtained from the 9th, 10th and 11th rounds of SELEX was amplified by unmodified primers (D1 forward and reverse in Table 1) under the same conditions described previously. Products were analyzed by 4% agarose gel stained with ethidium bromide, and the 65 bp band was cut out and purified using the Purelink Quick gel extraction and PCR purification combo kit (Invitrogen). The purified products were cloned into the dual promoter PCR2.1 TOPO vector using the TOPO TA cloning kit (Invitrogen) according to the manufacturer's instructions. A total of 86 white clones were selected for sequencing on a Sanger sequencer (Applied Biosystems).

[0046] Binding affinity studies

[0047] The direct ELASA (enzyme-linked aptamer adsorption assay) method was used to test the binding activity of each selected aptamer. 96-well polystyrene plates (Greiner) were plated with HAdV-2 particles at 10 7 MPN / mL (about 10 6 The wells were coated with a concentration of 100 μL of DPBS (particles / well) and incubated at 37°C for 1 hour. After washing 5 times with 300 μL DPBS, the wells were blocked with 300 μL 3% BSA at 4°C overnight. After washing 5 times with 300 μL DPBS, 1 μM of each biotinylated candidate aptamer diluted in 100 μL selection buffer was added to the wells and incubated at room temperature for 1 hour. The wells were washed twice with 300 μL DPBS-T and twice with 300 μL 1% BSA. 100 microliters of streptavidin-conjugated HRP (1 / 300, ThermoScientific) diluted in 1% BSA was added to each well and incubated in the dark for 30 minutes at room temperature. The plate was washed 3 times with 300 μL DPBS and developed in the dark with 50 μL TMB substrate solution (ThermoScientific) at room temperature for 30 minutes. Finally, 50 μL of 2 M sulfuric acid was added to each well and the absorbance was recorded at 450 nm (Tecan). Based on the results, the top three aptamers were selected for further analysis.

[0048] The binding affinity of the selected aptamers was analyzed using the ELASA method described previously. 7 MPN / mL of HAdV-2 was coated onto 96-well polystyrene plates (Greiner) and reacted with different concentrations (0-1000 nM) of biotinylated aptamers 10 and 20. The plates were read at 450 nm, and the OD values ​​were entered into SigmaPlot software and processed using a one-site saturation equation with nonspecific binding to determine the Kd value.

[0049] Figure 1 Results obtained from direct ELASA of purified HAdV-2 incubated with 1 μM of various biotinylated candidate aptamers are shown.

[0050] based on Figure 1 The results showed that aptamers 10, 18, and 20 were the most promising candidates.

[0051] Figure 2 and 3 Representative ELASA binding studies of HAdV-2 and aptamer 10. The results show that aptamer 10 can specifically bind to HAdV-2 with high affinity. The Kd of the aptamer was calculated to be 3.6 ± 0.7 nM. Each point is the average of 6 independent experiments.

[0052] Figure 4 Represents ELASA binding study of HAdV-2 and aptamer 20. The results show that aptamer 20 can specifically bind to HAdV-2 with high affinity. The Kd value is estimated to be 75.9 ± 68.6 nM. Each point is the average of 7 independent experiments.

[0053] Specificity studies

[0054] The specificity of aptamers 10 and 20 was analyzed by ELASA using various types of adenovirus (ovine adenovirus type 1 and bovine adenovirus type 9) and various other waterborne virus types (F-specific RNA bacteriophage strains MS2, GA, Qβ, and SP). According to the previously described ELASA protocol, target and non-target viruses were added at the same initial concentration (approximately 10 7 Virus particles / well) were coated on the plate and tested against aptamers 10 and 20 at a concentration of 80 nM, respectively.

[0055] The results show that Figure 5 and 6 In the experiment, aptamers 10 and 20 were shown to be specific for adenovirus types. It only produced signals for adenovirus and not for other waterborne viruses.

[0056] Motif and structure analysis

[0057] Motif analysis was performed by the online software program MEME motif discovery tool. The predicted 2D fold of each aptamer was performed by the online software program MFOLD.

[0058] Table 2

[0059]

[0060]

[0061] The following sequences have been identified:

[0062] SEQ ID NO: 1:

[0063] GTGCCAGCTATGCCATTGGGGGACAATATCGCAGTGCATCTTCCTCTAGCGTCTATCTCTGCTGC.

[0064] SEQ ID NO:2:

[0065] GTGCCAGCTATGCCATTGGCCAGTAGTTTCAGTCTACCAACGGTCATAGCGTCTATCTCTGCTGC.

[0066] SEQ ID NO:3:

[0067] GTGCCAGCTATGCCATTGGGCGGGTCGTCCAATTCGAGAGGTCCCCTAGCGTCTATCTCTGCTGC.

[0068] Aptamers 10, 18, and 20 comprise SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3, respectively.

[0069] The present invention provides a single-stranded nucleic acid aptamer comprising or consisting of one of the sequences SEQ ID NO: 1 to 3 or a variant thereof having at least 50% sequence identity. Preferably, the variant has at least 80% sequence identity, more preferably 90%.

[0070] An aptamer has at least one stem-loop structure.

[0071] The present invention also provides a composition comprising at least one single-stranded nucleic acid aptamer and at least one adenovirus type, wherein the single-stranded nucleic acid aptamer comprises one of the sequences SEQ ID NO: 1 to 3 or a variant thereof having at least 50% sequence identity, or consists of one of the sequences SEQ ID NO: 1 to 3 or a variant thereof having at least 50% sequence identity.

[0072] The adenovirus type can be, for example, a human or animal adenovirus.

[0073] The present invention also provides the use of a single-stranded nucleic acid aptamer for detecting, capturing, quantifying and / or concentrating at least one type of adenovirus, wherein the single-stranded nucleic acid aptamer comprises one of the sequences SEQ ID NO: 1 to 3 or a variant thereof having at least 50% sequence identity, or consists of one of the sequences SEQ ID NO: 1 to 3 or a variant thereof having at least 50% sequence identity.

[0074] The present invention also provides an in vitro method for capturing at least one adenovirus type in a sample, which comprises the step of contacting the sample with a single-stranded nucleic acid aptamer, wherein the aptamer comprises one of the sequences SEQ ID NO: 1 to 3 or a variant thereof having at least 50% sequence identity, or consists of one of the sequences SEQ ID NO: 1 to 3 or a variant thereof having at least 50% sequence identity.

[0075] The present invention also provides an in vitro method for detecting and / or quantifying at least one adenovirus type in a sample, comprising the following steps: performing the in vitro method for capture as defined above, quantifying or detecting the presence or absence of bound aptamers; and inferring the amount or presence or absence of adenovirus in the sample. The quantification or detection of the presence or absence of bound aptamers is performed by comparison with a control group. The method may include a step of removing unbound aptamers before the step of quantifying or detecting the presence or absence of bound aptamers.

[0076] Detecting the presence or absence of the bound aptamer in the sample is performed by performing a PCR designed to amplify the bound aptamer and / or by an enzyme-linked aptamer adsorption assay (ELASA), wherein the PCR is performed using a set of two primers corresponding to the sequences 5'-GTGCCAGCTATGCCATTG-3' (forward) and 5'-GCAGCAGAGATAGACGCTA-3' (reverse). Alternatively, at least one aptamer comprises a detectable label, and detecting the presence or absence of the aptamer bound to the adenovirus in the sample is performed by detecting the label.

[0077] The present invention also provides a kit for detecting, quantifying, capturing and / or concentrating at least one adenovirus type, the kit comprising at least one single-stranded nucleic acid, the nucleic acid comprising one of the sequences SEQ ID NO: 1 to 3 or a variant thereof having at least 50% sequence identity, or consisting of one of the sequences SEQ ID NO: 1 to 3 or a variant thereof having at least 50% sequence identity. According to one embodiment, the kit further comprises a support or solution having at least one capture element and / or detection means of the at least one adenovirus type. The support may be a solid support, such as a polystyrene plate, magnetic beads or an extraction column, a chromatographic column or an affinity column, but is not limited thereto. According to one embodiment of the present invention, at least one capture element of at least one adenovirus type is at least one aptamer immobilized on a support or in a solution.

[0078] The kit may also comprise means for detecting the aptamer that binds to the adenovirus.According to one embodiment, the detection means comprises one or more aptamers to which a detectable label is attached.

[0079] Detectable label can be part (moiety), it can be detected by methods known in the art.For example, detectable label can be optical label, electrochemical label, radioisotope or its combination.Detectable label can be connected to the specific base of aptamer, the specific site of specific structure, such as the hairpin loop structure of aptamer, or the 3'-end or 5'-end of aptamer.Optical label can be, for example, fluorescent material.In addition, optical label can be enzyme, and this enzyme can be used for enzyme-linked immunosorbent assay (ELISA).Those of ordinary skill in the art can appropriately select other materials.

[0080] The kit also comprises a set of two primers to amplify the aptamer bound to the adenovirus, the set of two primers being capable of binding to the at least one aptamer and corresponding to the sequences 5'-GTGCCAGCTATGCCATTG-3' and 5'-GCAGCAGAGATAGACGCTA-3'.

[0081] The kit may also include instructions for use. The kit may also include a positive control (eg, inactivated adenovirus particles) and a negative control.

[0082] The sample may be a clinical sample, such as stool, blood, etc.; an environmental sample, such as water, sediment and / or food sample, but is not limited thereto. Sequence Listing <110> Luxembourg Institute of Science and Technology (LIST) <120> Adenovirus type-specific DNA aptamers <130> PT06203WO <160> 5 <170> PatentIn version 3.5 <210> 1 <211> 65 <212> DNA <213> Artificial sequence <220> <223> Adenovirus-specific aptamers <400> 1 gtgccagcta tgccattggg ggacaatatc gcagtgcatc ttcctctagc gtctatctct 60 gctgc 65 <210> 2 <211> 65 <212> DNA <213> Artificial sequence <220> <223> Adenovirus-specific aptamers <400> 2 gtgccagcta tgccattggc cagtagtttc agtctaccaa cggtcatagc gtctatctct 60 gctgc 65 <210> 3 <211> 65 <212> DNA <213> Artificial sequence <220> <223> Adenovirus-specific aptamers <400> 3 gtgccagcta tgccattggg cgggtcgtcc aattcgagag gtcccctagc gtctatctct 60 gctgc 65 <210> 4 <211> 18 <212> DNA <213> Artificial sequence <220> <223> Oligonucleotide primers <400> 4 gtgccagcta tgccattg 18 <210> 5 <211> 19 <212> DNA <213> Artificial sequence <220> <223> Oligonucleotide primers <400> 5 gcagcagaga tagacgcta 19

Claims

1. A single-stranded nucleic acid aptamer capable of specifically binding to at least one type of adenovirus, wherein the adenovirus is selected from human adenovirus type 2, ovine adenovirus type 1 and bovine adenovirus type 9, wherein the aptamer consists of one of the sequences SEQ ID NO: 1 and 3.

2. A composition comprising at least one single-stranded nucleic acid aptamer capable of specifically binding to at least one type of adenovirus and at least one type of adenovirus, wherein the aptamer consists of one of SEQ ID NOs: 1 and 3, and the adenovirus is selected from human adenovirus type 2, ovine adenovirus type 1 and bovine adenovirus type 9.

3. A single-stranded nucleic acid aptamer capable of specifically binding to at least one type of adenovirus, wherein the aptamer consists of one of the sequences SEQ ID NO: 1 and 3, and wherein the aptamer is used in a method for treating at least one type of adenovirus, wherein the adenovirus is selected from human adenovirus type 2, ovine adenovirus type 1 and bovine adenovirus type 9.

4. An in vitro method for capturing at least one type of adenovirus in a sample, wherein the adenovirus is selected from human adenovirus type 2, ovine adenovirus type 1 and bovine adenovirus type 9, comprising the step of contacting the sample with a single-stranded nucleic acid aptamer capable of specifically binding to the at least one type of adenovirus, wherein the aptamer consists of one of the sequences SEQ ID NO: 1 and 3.

5. Use of a single-stranded nucleic acid aptamer capable of specifically binding to at least one type of adenovirus in the preparation of a kit for a method for detecting and / or quantifying at least one type of adenovirus in a sample, wherein the adenovirus is selected from human adenovirus type 2, ovine adenovirus type 1 and bovine adenovirus type 9, the method comprising: - carrying out said in vitro method for capturing according to claim 4, - quantifying or detecting the presence or absence of aptamers bound to adenovirus; - thereby inferring the amount or presence or absence of adenovirus in said sample.

6. The use according to claim 5, wherein the quantification or detection of the presence or absence of the aptamer binding to the adenovirus is performed by comparison with a control group.

7. The use according to any one of claims 5 and 6, wherein the detection of the presence or absence of the aptamer binding to the adenovirus in the sample is performed by performing PCR aimed at amplifying the aptamer and / or by an enzyme-linked aptamer adsorption assay, the PCR being performed using a set of two primers having the sequences of 5'-GTGCCAGCTATGCCATTG-3' and 5'-GCAGCAGAGATAGACGCTA-3'.

8. The use according to any one of claims 5 and 6, wherein the at least one aptamer comprises a detectable label, and detecting the presence or absence of the aptamer bound to the adenovirus in the sample is performed by detecting the label.

9. A kit for detecting, quantifying, capturing and / or concentrating at least one type of adenovirus, wherein the adenovirus is selected from human adenovirus type 2, ovine adenovirus type 1 and bovine adenovirus type 9, wherein the kit comprises at least one single-stranded nucleic acid aptamer capable of specifically binding to the at least one type of adenovirus, wherein the aptamer consists of one of the sequences SEQ ID NO: 1 and 3.

10. The kit according to claim 9, wherein the kit further comprises a support or solution having at least one capture element and / or detection means for the at least one type of adenovirus.

11. The kit of claim 10, wherein the at least one capture element comprises one or more of the at least one aptamer.

12. The kit according to any one of claims 10 and 11, wherein the detection means comprises one or more of the aptamers linked to a detectable label.

13. The kit according to claim 12, wherein the detectable label is bound to the 5' or 3' end of the aptamer.

14. The kit according to any one of claims 9 to 11, further comprising a set of two primers to amplify the aptamer bound to adenovirus, the set of two primers being capable of binding to the at least one aptamer and having sequences of 5'-GTGCCAGCTATGCCATTG-3' and 5'-GCAGCAGAGATAGACGCTA-3'.

Images