Application of lymphocytes and nanocomplexes mediated by CRISPR system in the preparation of drugs for the treatment of cervical cancer

Abstract

The present invention relates to the application of a gene editing nanocomplex of a lymphocyte-mediated CRISPR system in the preparation of a cervical cancer treatment drug, and belongs to the field of medical technology. The present invention adopts a strategy of simultaneous delivery of Cas9 mRNA and guide RNA, and successfully constructs a CRISPR / Cas9 nano delivery system with good transfection efficiency, providing a new attempt for the research and development of non-viral vectors, and the low pH targeting characteristics and endogenous escape mechanism of the constructed pH-responsive cyclodextrin nanocomplex are conducive to the release of nanoparticles in the local tumor, maximizing the efficiency of in vivo transportation. At the same time, due to the complex immunosuppressive microenvironment of cervical cancer, lymphocytes are combined with gene editing nanocomplexes for the treatment of cervical cancer. The combined application of the two can reshape the local immune environment in the local tumor and maximize the anti-tumor effect.

Description

Technical Field

[0001] The present invention belongs to the field of medical technology, and specifically relates to the application of a lymphocyte-mediated CRISPR / Case9 nanogene editing system in the preparation of drugs for treating cervical cancer. Background Art

[0002] Cervical cancer screening technology has been implemented in my country for many years, and free screening measures have been implemented at the national level. However, in recent years, there are still nearly 110,000 new cases of cervical cancer and nearly 60,000 deaths in China each year, accounting for approximately 18.3% and 17.6% of the global total incidence and mortality, respectively. my country's cervical cancer patients account for approximately 1 / 5 of the world's total, and the pressure of prevention and control is very high. Human papillomavirus (HPV) is the main risk factor and causative agent of the disease. The recurrence rate of locally advanced cervical cancer is high, and the survival rate in the late stage is worrying. Late recurrent metastasis and persistent cervical cancer are resistant to radiotherapy and chemotherapy, with a short survival period and no effective treatment measures. Immunotherapy and gene therapy bring new hope to patients. The local immune microenvironment of cervical cancer is complex, and many factors are involved. Reshaping the local immune microenvironment of cervical cancer is also a hot topic for future research.

[0003] HPV, as an exogenous viral DNA, can be integrated into host DNA. It is well known that the pathogenic genes that promote the occurrence and development of cervical cancer are mainly E6 / E7. Studies have shown that tumor cells undergo apoptosis after knocking out the pathogenic genes E6 / E7, which provides support for gene therapy of cervical cancer. Gene therapy for HPV does not damage normal human genes. Under the premise of minimizing the off-target rate, gene therapy for cervical cancer has broad prospects. As a delivery tool for the effective load CRISPR / Cas9 system, vectors are divided into two categories: viruses and non-viruses. The fusion of viral genes may destroy the expression of important human genes. In view of the safety, immunogenicity and potential tumorigenicity risks of viral vectors, the clinical application of non-viral vectors is in urgent need of development. At present, non-viral delivery methods and carrier materials have become a research hotspot, but the delivery and optimization of this method still need to be further studied. Our school has successfully developed pH-responsive cyclodextrin nanomaterials and has patented technology. Previous studies have shown that the nanoparticles have been optimized and prepared, and have shown good sustained release and targeting effects in in vivo drug delivery experiments, and have good tissue compatibility. In addition, the previous cooperation team used nanoparticles to deliver CRISPR / Cas9 gene editing complexes. Experiments have shown that they can be targeted for degradation and release in tissues and cells with low oxygen and low pH values, and have the characteristics of high transfection rate, stability and low toxicity. In cervical cancer, it can effectively target and knock out the E6 / E7 gene and has strong anti-tumor activity. In view of the performance advantages of pH-responsive cyclodextrin nanoparticles, we have become interested in using this material to carry the CRISPR / Cas9 system, and adopt the mRNA synchronous delivery strategy to minimize off-target and ease of use.

[0004] In addition, although the new nanocomplexes using CRISPR / Cas9 gene editing can effectively target and knock out tumor oncogenes, reduce the effects of tumor oncoproteins, and thus curb the biological malignant behavior of tumors; however, single targeted knockout technology may not be durable, and the heterogeneity of tumors, as well as the mechanisms of growth and decline and immune escape, cannot maximize the purpose of tumor elimination. Therefore, gene therapy combined with other treatment methods can be used as a new strategy. Cervical cancer immunotherapy provides an opportunity for late recurrent and metastatic cervical cancer, but the response rate of immunotherapy such as PD1 and CTLA-4 is less than 30%. How to reshape the immune microenvironment is the direction of clinical research. At present, treatment strategies such as CAR-T therapy, adoptive therapy of autologous lymphocytes, and combined or not combined with radiotherapy and chemotherapy are also being explored.

[0005] How to make T lymphocytes migrate to tumor tissues and how to effectively activate CD8+T cells are important links in reshaping the tumor immune microenvironment. Based on the previous use of pH-responsive cyclodextrin to simultaneously deliver CRISPR / Cas9 mRNA and specifically target and knock out E6 / E7 oncogenes, which has a high in vivo and in vitro transfection efficiency, and umbilical cord blood lymphocytes have stem cell characteristics and immunotherapy effects, this study adopts a gene therapy and lymphocyte combined therapy strategy to provide the feasibility of targeted HPV gene therapy combined with lymphocyte or stem cell cell therapy, observe its anti-tumor synergistic effect, and open up a new path for cervical cancer gene therapy. Summary of the invention

[0006] In view of this, one of the objects of the present invention is to provide a use of a combination of lymphocytes and a nanocomplex that mediates the CRISPR / Cas9 gene editing system in the preparation of a drug for the treatment of cervical cancer.

[0007] In order to achieve the above object, the present invention provides the following technical solutions:

[0008] 1. The use of lymphocytes and a nanocomplex that mediates the CRISPR system in the preparation of a drug for treating cervical cancer, wherein the nanocomplex that mediates the CRISPR system comprises a guide RNA designed according to a cervical cancer target gene, Cas9 mRNA, and acetalized β-cyclodextrin.

[0009] As one of the preferred technical features, the method for constructing the pH-responsive cyclodextrin nanocomplex mediating the CRISPR system is:

[0010] A. Design guide RNA sequences based on cervical cancer target genes and synthesize Cas9 mRNA and guide RNA;

[0011] B. Mixing Cas9 mRNA and guide RNA to obtain an inner aqueous phase, adding the inner aqueous phase to an organic phase solution and mixing evenly to form water-in-oil colostrum, wherein the organic phase solution includes branched polyethyleneimine and acetalized β-cyclodextrin;

[0012] C. Adding polyvinyl alcohol solution to the water-in-oil colostrum, mixing to obtain water-in-oil-in-water emulsion, stirring to volatilize the organic solvent, solidifying, high-speed centrifuging and washing to obtain pH-responsive cyclodextrin nanocomposite.

[0013] As one of the preferred technical features, in step B, the preparation method of the acetalized β-cyclodextrin is:

[0014] Diethoxypropylene and pyridinium p-toluenesulfonate are added to the β-cyclodextrin solution, stirred to dissolve, and then methoxypropylene is added. The reaction is allowed to react for one hour, and then triethylamine is added to the reaction solution to terminate the reaction. Water is added to precipitate, centrifuged, washed with water until the solution becomes clear, and vacuum dried to obtain acetalized β-cyclodextrin.

[0015] As one of the preferred technical features, the mass volume ratio of diethoxypropylene, pyridinium p-toluenesulfonate, β-cyclodextrin, methoxypropylene and triethylamine is 4.5:16.3:1:4:0.5, mL:mg:g:mL:mL.

[0016] As one of the preferred technical features, step B is specifically as follows: Cas9 mRNA and guide RNA are mixed to obtain an inner aqueous phase, and acetalized β-cyclodextrin and branched polyethyleneimine are mixed to obtain an organic phase; the organic phase and the inner aqueous phase are slowly mixed, and while magnetically stirring, the organic phase is slowly dripped into the inner aqueous phase at a rate of 1 mL / min, and ultrasonicated to form oil-in-water colostrum.

[0017] As one of the preferred technical features, in step B, the mass ratio of branched polyethyleneimine to acetalized β-cyclodextrin in the organic phase is 1:6.

[0018] As one of the preferred technical features, step C specifically comprises adding polyvinyl alcohol solution to the oil-in-water colostrum, ultrasonically mixing to obtain a water-in-oil-in-water emulsion, stirring under magnetic stirring for 3 hours, standing at room temperature until solidified, centrifuging at 26000 rpm, washing with deionized water for 4-5 times, and obtaining a pH-responsive cyclodextrin nanocomposite.

[0019] As one of the preferred technical features, the concentration of the polyvinyl alcohol solution is 1%.

[0020] As one of the preferred technical features, the cervical cancer target genes are cervical cancer E6 and E7 genes.

[0021] As one of the preferred technical features, the lymphocytes are derived from umbilical cord blood lymphocytes with low immunogenicity. After the application of the nanocomplex of the CRISPR system, combined with lymphocyte immunotherapy, local T cell infiltration in the tumor can be enhanced, achieving synergistic anti-tumor effects.

[0022] The beneficial effects of the present invention are:

[0023] The present invention has constructed a strategy of simultaneous delivery of Cas9 mRNA and sgRNA, and constructed a new CRISPR / Cas9 nanocomplex with good transfection efficiency. The low pH targeting characteristics and endogenous escape mechanism of the CRISPR / Cas9 mRNA-loaded pH-responsive nanoparticles provided by the present invention are conducive to the local release of nanoparticles in the tumor, and the maximum efficiency of in vivo transportation. The application of CRISPR / Cas9 mRNA-loaded pH-responsive nanoparticles for treatment significantly reversed the immunosuppressive microenvironment in HeLa xenotransplantation, and combined with umbilical cord blood lymphocytes to produce a synergistic anti-tumor effect, which has good application prospects. The results of the study showed that combined treatment can reshape the cervical immune microenvironment and provide a new strategy for gene therapy combined with immunotherapy for cervical cancer. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] In order to make the purpose, technical solutions and advantages of the present invention more clear, the present invention will be described in detail below in conjunction with the accompanying drawings, wherein:

[0025] Figure 1 Schematic diagram of chemical modification of in vitro transcribed mRNA.

[0026] Figure 2 These are electrophoresis bands after mRNA in vitro transcription, 103nt and 4521nt gRNA and Cas9 mRNA electrophoresis bands.

[0027] Figure 3 Schematic diagram of the preparation of pH-responsive nanoparticles containing Cas9 mRNA and E6 or E7 gRNA.

[0028] Figure 4Preparation, characterization and in vitro evaluation results of pH-responsive nanoparticles loaded with CRISPR / Cas9 mRNA and gRNA. a, b are SEM images (left), TEM images (middle) and particle size distribution diagrams (right) of ACD NPs containing Cas9 mRNA and E6 / E7 gRNA, scale bar, 200nm. C is the fluorescence image result, HeLa cells take up cy5-labeled ACD NPs after 6h of incubation. d, e are the flow cytometry results (d) and quantitative data results (e) of the transfection efficiency of Cy5 / ACD NPs after different doses and different incubation times. f, g are the fluorescence images (f) and quantitative results (g) of Cas9 expression in HeLa cells 6h after 0.5, 1, and 2μg / mL Cas9 mRNA acted on E6 / ACD NPs, scale bar, 20μm.

[0029] Figure 5 Immunosuppression of the tumor microenvironment in HeLa xenograft mice. (a) Schematic diagram of the treatment regimen. (bc) Representative flow cytometric analysis (b) and quantitative analysis (c) of CD45+ T cells in HeLa tumors after treatment with ACD NP or ACD NP+lymphocytes (ACD NP+LC). (de) Flow cytometric analysis (d) and quantitative analysis (e) of CD8+ T cells in HeLa tumors after different treatments. Data in (c, e) are presented as mean ± SD (n = 3). ns, not significant. LC, lymphocytes.

[0030] Figure 6 In vivo gene editing of E6 / ACD NP promotes CD8+ T cell differentiation by reversing the tumor immunosuppressive microenvironment of transplanted HeLa mice. (a) Schematic diagram of the treatment protocol. (bc) Flow cytometric analysis shows that the survival of lymphocytes in HeLa tumors is improved after local gene editing using E6 / ACD NP. ACD NP+LC, mice treated with intratumoral injection of ACD NP+ lymphocytes; E6 / ACD NP+LC, mice treated with intratumoral injection of E6 / ACD NP+ lymphocytes. (de) Flow cytometric detection (c) and quantitative analysis (d) of CD8+ T cells in tumors after intratumoral injection of ACD NP+ lymphocytes (ACD NP+LC) or E6 / ACD NP+ lymphocytes (E6 / ACD NP+LC). (e) Immunohistochemical analysis of CD8 expression in tumor sections after treatment with ACD NP+LC or E6 / ACD NP+LC. Scale bar, 100 μm. Data are presented as mean ± SD (n = 3). ***P < 0.001. ns, not significant. LC, lymphocytes.

[0031] Figure 7Synergistic antitumor effects of gene editing combined with lymphocytes in HeLa xenograft mice. (a) Schematic diagram of the treatment regimen. (b) Tumor growth curves during different treatment periods. (c) Quantification of tumor volume on day 29 after different treatments. (d) Digital photos of tumors in different groups. (e) Tumor weight after different treatments. E6 / ACD NP, mice injected with E6 / ACD NP alone; E6 / ACD NP+LC, mice injected with E6 / ACD NP and lymphocytes simultaneously; ACD NP+LC, mice injected with ACD NP and lymphocytes simultaneously; ACD NP, mice injected with ACD NP alone. Scale bar (d), 1 cm. Data are expressed as mean ± sd (n = 3). *P < 0.05, **P < 0.01, ***P < 0.001; ns, not significant. LC, lymphocytes. DETAILED DESCRIPTION

[0032] The present invention is further described below in conjunction with specific preferred embodiments. It should be understood that these embodiments are only used to illustrate the present invention and are not intended to limit the scope of the present invention. The experimental methods for which specific conditions are not specified in the embodiments are generally carried out according to conventional conditions such as those described in Molecular Cloning Laboratory Manual (3rd edition, by J. Sambrook et al.), or according to the conditions recommended by the manufacturer.

[0033] Example 1

[0034] CRISPR / Cas9 vector construction and mRNA in vitro transcription

[0035] Design sgRNA for the target gene sequence, and synthesize single-stranded oligo by Cyagen, USA. Construct sgRNA+CRISPR / Cas9 overexpression plasmid, as well as the corresponding sgRNA and P330X plasmid in vitro transcribed mRNA vector. Transfect HeLa cells with sgRNA+CRISPR / Cas9 overexpression plasmid, and verify the plasmid HPVE6 / E7 gene cutting effect by Sanger sequencing, and then perform in vitro transcription of mRNA after verification. sgRNA is as follows:

[0036] E6:GAAGCTACCTGATCTGTGCA

[0037] E7:GGAGCAATTAAGCGACTCAG

[0038] Chemical modification of in vitro transcribed mRNA Figure 1 As shown, using The MessageMAX TMT7 ARCA-Capped Message Transcription Kit is used to transcribe Cas and sgRNA into mRNA in vitro. Using T7 RNA polymerase and anti-reversal cap analog (ARCA) m27,3'-OG [5'] ppp [5'] Chemical modification.

[0039] The results are as follows Figure 2 As shown, the in vitro transcription and chemical modification of mRNA was successful and active.

[0040] Example 2

[0041] Preparation and Characterization of pH Responsive Nanoparticles (ACD NPs)

[0042] (1) Preparation of ACD (acetalized β-cyclodextrin)

[0043] 1gβ-CD was ultrasonically dissolved in 10mL anhydrous DMSO and magnetically stirred for 5min at 25℃. Then 4.5mL diethoxypropylene and 16.3mg p-toluenesulfonic acid pyridinium salt (PTS) were added. After magnetic stirring at room temperature to allow PTS to fully dissolve, 4mL methoxypropylene (MP) was added. The reaction was allowed to react at room temperature for 3 hours, and 0.2mL triethylamine was added to terminate the reaction. 200mL pure water was poured into the resulting solution, and the reaction product was precipitated with deionized water. The reaction product was washed with water by centrifugation at 14000rpm for 5 times until the solution became clear to obtain ACD solution. The obtained product was freeze-dried in a vacuum freeze dryer for later use.

[0044] (2) Preparation of pH-responsive nanoparticles

[0045] CRISPR-Cas9 and sgRNA (E6) / sgRNA (E7) were prepared in a 1:1 ratio to form a CRISPR-sgRNA-Cas9 small molecule complex solution, and the solution was diluted to 100 μL of water to obtain an inner aqueous phase.

[0046] 1 mL of dichloromethane was dissolved in 15 mg of ACD and 2.5 mg of branched polyethyleneimine with a molecular weight of 1.8 kDa to obtain an organic phase; while magnetically stirring, the organic phase was slowly dripped into the inner aqueous phase at a rate of 1 mL / min, slowly mixed, ultrasonically treated, and magnetically stirred at 65°C for 30 min. The inner aqueous phase was fully mixed to emulsify the organic phase to form an oil-in-water colostrum.

[0047] 6 mL of polyvinyl alcohol (PVA) was added to PBS to obtain a 1% PVA aqueous solution (molecular weight 8.8 kDa, degree of hydrolysis 88%), and the obtained PVA aqueous solution was mixed with the above-mentioned water-in-oil colostrum, and ultrasonic treatment was performed to obtain a water-in-oil-in-water emulsion. The obtained emulsion was magnetically stirred at room temperature for 3 hours to volatilize and remove the organic solvent of the organic phase, and allowed to stand for reaction at room temperature for 2 hours to obtain solidified nanoparticles, which were centrifuged at 26000 rpm and washed with deionized water 4-5 times to obtain a nanocomposite.

[0048] When preparing CY5-labeled nanoparticles, ACD and 0.1 mg CY5 were first mixed together to load CY5 on ACD, and then 2 mL acetonitrile was added and dissolved by ultrasonic emulsification. According to the above steps, the organic phase and the inner aqueous phase were mixed to prepare the CY5-labeled nanocomposite.

[0049] The obtained nanocomplex CRISPR / Cas9 mRNA loaded pH-responsive nanoparticles (abbreviated as pH-NPA) were resuspended in pure water and mixed evenly. A small amount was evenly applied on the mica sheet and copper mesh, and the water was naturally evaporated and dried. The mixture was placed at room temperature and then tested for particle size and charge on a machine.

[0050] like Figure 3 As shown, pH-responsive nanoparticles (ACD NPs) are based on pH-responsive cyclodextrin materials, in which Cas9 mRNA and E6 or E7 gRNA are loaded by forming a complex with low molecular weight PEI (Mw, 1800) to obtain genome editing nanotherapy E6 / ACD NPs and E7 / ACD NPs, respectively. Under low pH conditions, both E6 / ACD NPs or E7 / ACD NPs can release the encapsulated complexes by responsive hydrolysis of ACD NPs.

[0051] pH-responsive acetalized β-cyclodextrin was synthesized by adding acid-responsive groups to acetalized β-cyclodextrin. The CRISPR small molecule complex was then prepared as the inner aqueous phase. The aqueous phase was emulsified in the aforementioned organic phase to obtain an oil-in-water colostrum encapsulating the CRISPR small molecule complex. After that, a water-in-oil-in-water emulsion was obtained to complete the host-guest self-assembly. The CY5 labeling step was to combine the organic phase ACD and CY5 fluorescent dye complex nanoparticles, which were mixed and wrapped with the CRISPR small molecule complex and then encapsulated.

[0052] Transmission electron microscopy and Malvern particle size test results are as follows Figure 4 As shown in ab, the size of the nanoparticles in each group is between 150-200nm, the size of the nanoparticles is basically uniform, round and full, and evenly dispersed.

[0053] Example 3

[0054] Immunomodulatory effects of E6 / ACD NPs in mouse HeLa xenografts

[0055] Lymphocytes were isolated from fresh human umbilical cord blood using Ficoll-Paque Premium (Pharmacia Ltd., Sweden), counted, and mixed with PBS. Nude mice were subcutaneously injected with HeLa cells (2×10 7 ) HeLa xenograft tumors were established. To detect the presence of an immunosuppressive tumor microenvironment, mice were injected intratumorally with ACD NPs on day 15 after HeLa cell injection. The mice were then randomly divided into two groups. One group of mice was injected with saline, and the other group of mice was injected with freshly isolated lymphocytes (1.5-2×10 7 ). Five days after the last treatment, the tumors were removed and the counts of CD45+ or CD8+ T cells were measured by flow cytometry.

[0056] To investigate the effect of E6 / ACD NP treatment on the tumor microenvironment. In this case, mice transplanted with HeLa cells were locally injected with ACD NP or E6 / ACD NP on day 15 after subcutaneous injection of HeLa cells. Three days later, the ACD NP-treated mice were divided into two groups: one group (ACD NP) was given saline, and the other group (ACD NP+LC) was given lymphocytes. The E6 / ACD NP pretreatment group was locally injected with lymphocytes (1.5-2×10 7 ). Similarly, 5 days after the last treatment, CD8+T cells and CD45+T cells in the tumor were analyzed by flow cytometry. At the same time, immunohistochemistry was performed on tumor sections to detect the expression of CD8.

[0057] Since HPV oncoprotein E6 / E7 is associated with immunosuppression in cervical cancer, we thought that knocking out the E6 / E7 gene might alter this adverse tumor microenvironment. Considering the immunodeficiency of BALB / c nude mice, we first performed intratumoral injection of human lymphocytes isolated from fresh umbilical cord blood in HeLa xenografts ( Figure 5 Flow cytometry analysis showed that there was no significant increase in the levels of CD45+ or CD8+ T cells in the tumors of mice treated with both ACD NPs and lymphocytes at day 14 after different treatments, compared with control mice treated with ACD NPs alone ( Figure 5 These results suggest that locally injected lymphocytes cannot survive in HPV-positive tumors because of strong immunosuppression, resulting in a low proportion of differentiated CD8+ T cells.

[0058] To further explore whether E6 / ACD NP gene editing can reverse the immunosuppressive tumor microenvironment, different groups were used to observe the survival and activation of T cells after local injection of lymphocytes in HeLa transplanted mice ( Figure 6The number of CD45+ or CD8+ T cells in the tumors of mice treated with ACD NP+ lymphocytes was low, while the level of CD45+ or CD8+ T cells in the tumors injected with both E6 / ACD NP and lymphocytes was significantly increased ( Figure 6 Consistent with the results of flow cytometry, further immunohistochemical analysis of tumor sections also showed a significant high expression of CD8 after E6 / ACD NP and lymphocyte treatment ( Figure 6 (middle f) These results suggest that E6 / ACD NP treatment significantly promoted the survival of local lymphocytes and CD8+ T cell differentiation, mainly by modulating the immunosuppressive microenvironment through knockdown of E6.

[0059] Example 4

[0060] Anti-tumor effect of E6 / ACD NP combined with lymphocytes

[0061] To observe the therapeutic effect of E6 / ACD NP combined with lymphocyte transplantation, HeLa nude mouse xenografts were established by subcutaneous injection of tumor cells. On the 15th day after injection, the mice were randomly divided into 4 groups: intratumoral injection of ACD NP group and intratumoral injection of E6 / ACD NP group. Three days later, ACD NP or E6 / ACD NP-treated mice were injected with saline or freshly isolated lymphocytes (1.5-2×10 7 ). During different treatments, tumor volumes were measured. On the fifth day after the last treatment, mice were euthanized. Tumors were removed and weighed.

[0062] Based on the above results, we further studied whether the combination of E6 / ACD NP and lymphocytes in the treatment of HeLa xenograft nude mice could achieve a synergistic anti-tumor effect. Figure 7 As shown in Figures a to e, compared with mice injected with ACD NP alone or ACD NP + lymphocytes, the tumor growth rate of mice treated with E6 / ACD NP or E6 / ACD NP + lymphocytes (i.e., E6 / ACD NP + LC) was significantly reduced ( Figure 7 bc), among which, the tumor growth of mice treated with E6 / ACD NP+lymphocyte combination was the slowest. After different treatments, the tumors of mice were removed and the tumor size was measured. It was observed that the tumor in the E6 / ACD NP+LC group was the smallest and had the lowest tumor weight ( Figure 7 (d, e) There was a significant difference between the E6 / ACD NP group and the E6 / ACD NP+LC group. The above experimental results show that the combination of nano-mediated oncogene editing system and lymphocyte therapy can achieve a synergistic anti-tumor effect.

Claims

1. The use of a combination of lymphocytes and a nanocomplex mediating a CRISPR / Cas9 gene editing system in the preparation of a drug for treating cervical cancer, characterized in that: The lymphocytes are derived from umbilical cord blood lymphocytes with low immunogenicity; the nanocomplex mediating the CRISPR / Cas9 gene editing system comprises a guide RNA designed according to a cervical cancer target gene, Cas9 mRNA and acetalized β-cyclodextrin, the cervical cancer target genes are cervical cancer E6 and E7 genes, the guide RNA sequence of the cervical cancer E6 gene is: GAAGCTACCTGATCTGTGCA, and the guide RNA sequence of the cervical cancer E7 gene is: GGAGCAATTAAGCGACTCAG.

2. The use according to claim 1, characterized in that The method for constructing the nanocomplex that mediates the CRISPR / Cas9 gene editing system is as follows: A. Design guide RNA sequences based on cervical cancer target genes and synthesize Cas9 mRNA and guide RNA; B. Mixing Cas9 mRNA and guide RNA to obtain an inner aqueous phase, adding the inner aqueous phase to an organic phase solution and mixing evenly to form water-in-oil colostrum, wherein the organic phase solution includes branched polyethyleneimine and acetalized β-cyclodextrin; C. Adding polyvinyl alcohol solution to the water-in-oil colostrum, mixing to obtain water-in-oil-in-water emulsion, stirring to volatilize the organic solvent, solidifying, high-speed centrifuging and washing to obtain pH-responsive cyclodextrin nanocomposite.

3. The use according to claim 2, characterized in that In step B, the preparation method of the acetalized β-cyclodextrin is: Diethoxypropylene and pyridinium p-toluenesulfonate are added to the β-cyclodextrin solution, stirred and dissolved, and then methoxypropylene is added to react for 3 hours. Triethylamine is then added to the reaction solution to terminate the reaction, water is added for precipitation, centrifuged, washed with water until the solution becomes clear, and vacuum dried to obtain acetalized β-cyclodextrin.

4. The use according to claim 3, characterized in that The mass volume ratio of diethoxypropylene, pyridinium p-toluenesulfonate, β-cyclodextrin, methoxypropylene and triethylamine is 4.5:16.3:1:4:0.5, mL:mg:g:mL:mL.

5. The use according to claim 2, characterized in that Specifically, step B comprises mixing Cas9 mRNA and guide RNA to obtain an inner aqueous phase, and mixing acetalized β-cyclodextrin and branched polyethyleneimine to obtain an organic phase; slowly mixing the organic phase and the inner aqueous phase, and while magnetically stirring, slowly dripping the organic phase into the inner aqueous phase at a rate of 1 mL / min, and ultrasonicating to form oil-in-water colostrum.

6. The use according to claim 2, characterized in that In step B, the mass ratio of branched polyethyleneimine to acetalized β-cyclodextrin in the organic phase is 1:

6.

7. The use according to claim 2, characterized in that Step C specifically comprises adding a polyvinyl alcohol solution to the water-in-oil colostrum, ultrasonically mixing to obtain a water-in-oil-in-water emulsion, stirring under magnetic stirring for 3 hours, standing at room temperature until solidified, centrifuging at 26000 rpm, and washing with deionized water for 4-5 times to obtain a pH-responsive cyclodextrin nanocomposite, wherein the concentration of the polyvinyl alcohol solution is 1%.

Images