Application of a gene inhibitor in inhibiting aging of umbilical cord blood mesenchymal stem cells

Abstract

The present invention provides an application of a gene inhibitor in inhibiting the aging of umbilical cord blood mesenchymal stem cells, belonging to the field of biomedical technology. The present invention has found through experiments that the non-coding RNA lnc-AC005307.1 is highly expressed during the replicative aging of umbilical cord blood mesenchymal stem cells, so the aging of umbilical cord blood mesenchymal stem cells can be detected by detecting the expression of lnc-AC005307.1 in umbilical cord blood mesenchymal stem cells. At the same time, the present invention has found through experiments that using a gene inhibitor to inhibit the expression of lnc-AC005307.1 can effectively inhibit the replicative aging and oxidative stress aging of umbilical cord blood mesenchymal stem cells.

Description

Technical Field

[0001] The present invention relates to the field of biomedical technology, and in particular to an application of a gene inhibitor in inhibiting aging of umbilical cord blood mesenchymal stem cells. Background Art

[0002] Stem cells are cells with certain proliferation and differentiation potentials, which can achieve self-renewal and high differentiation. According to different sources, stem cells are divided into embryonic stem cells, hematopoietic stem cells, neural stem cells, bone marrow mesenchymal stem cells, adipose stem cells, etc. Umbilical cord blood mesenchymal stem cells are a type of stem cells derived from umbilical cord blood. As a seed cell used in tissue engineering, it not only has a wide source, but also is very convenient to obtain. However, as the culture time increases, umbilical cord blood mesenchymal stem cells will gradually age and their proliferation ability will decrease, thus affecting the application of umbilical cord blood mesenchymal stem cells.

[0003] With the development of high-throughput sequencing technology, long non-coding RNA, which was previously considered to be transcriptional noise, has attracted the attention of more and more scientists. Long non-coding RNA is a type of non-coding RNA with a length greater than 200 nucleotides, which usually has no protein coding ability. Existing studies have shown that long non-coding RNA plays an important role in various biological functions such as cell proliferation, cell cycle, cell differentiation, and cell apoptosis. However, there are few studies on the role of long non-coding RNA in the aging and proliferation of umbilical cord blood mesenchymal stem cells. Therefore, studying the function of long non-coding RNA in the aging and proliferation of umbilical cord blood mesenchymal stem cells is of great significance for effectively delaying the aging of umbilical cord blood mesenchymal stem cells and increasing the proliferation capacity of umbilical cord blood mesenchymal stem cells. Summary of the invention

[0004] The purpose of the present invention is to use a gene inhibitor in inhibiting the aging of umbilical cord blood mesenchymal stem cells.

[0005] To achieve the above object, the present invention provides the use of primers for detecting the expression level of lnc-AC005307.1 gene in the preparation of a kit for detecting the aging of umbilical cord blood mesenchymal stem cells, wherein the lnc-AC005307.1 is highly expressed in senescent cells of umbilical cord blood mesenchymal stem cells.

[0006] Preferably, the gene sequence of the lnc-AC005307.1 is shown as SEQ ID NO.11, and the sequences of the primers are shown as SEQ ID NO.7 and SEQ ID NO.8.

[0007] Secondly, the present invention provides an application of a gene inhibitor in the preparation of a drug for inhibiting aging of umbilical cord blood mesenchymal stem cells, wherein the gene inhibitor is a gene inhibitor of lnc-AC005307.1.

[0008] Preferably, the gene sequence of lnc-AC005307.1 is shown in SEQ ID NO, 11.

[0009] Preferably, the gene inhibitor is ShRNA that specifically targets and inhibits the expression of lnc-AC005307.1.

[0010] Preferably, the sequence of the ShRNA is shown as SEQ ID NO.12 and SEQ ID NO.13.

[0011] In addition, the present invention provides a gene inhibitor for inhibiting the aging of mesenchymal stem cells, wherein the gene inhibitor is ShRNA that specifically inhibits the expression of lnc-AC005307.1.

[0012] Preferably, the gene sequence of the lnc-AC005307.1 is shown as SEQ ID NO.11, and the sequence of the ShRNA is shown as SEQ ID NO.12 and SEQ ID NO.13.

[0013] In addition, the present invention provides a pharmaceutical composition for inhibiting the aging of umbilical cord blood mesenchymal stem cells, the pharmaceutical composition comprising ShRNA that specifically inhibits the expression of lnc-AC005307.1, the sequence of the ShRNA is shown in SEQ ID NO.12 and SEQ ID NO.13, and the sequence of the lnc-AC005307.1 is shown in SEQ ID NO.11.

[0014] Preferably, the drug further comprises a pharmaceutically acceptable drug carrier and a dressing that are compatible with the ShRNA.

[0015] The beneficial effects of the present invention are:

[0016] The present invention has found through experiments that the non-coding RNA lnc-AC005307.1 is highly expressed during the replicative aging of umbilical cord blood mesenchymal stem cells. Therefore, the aging of umbilical cord blood mesenchymal stem cells can be detected by detecting the expression of lnc-AC005307.1 in umbilical cord blood mesenchymal stem cells. At the same time, the present invention has found through experiments that the use of gene inhibitors to inhibit the expression of lnc-AC005307.1 can effectively inhibit the replicative aging and oxidative stress aging of umbilical cord blood mesenchymal stem cells. In addition, the present invention has found through experiments that the gene inhibitor of lnc-AC005307.1 can effectively inhibit the protein expression of P21 and P16, and can effectively promote the protein expression of Cyclin-D1 and Cyclin-E1. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1Differential expression of lnc-RP11-266K4.9 during replicative aging of umbilical cord blood mesenchymal stem cells;

[0018] Figure 2 Differential expression of lnc-HOTAIR during replicative senescence of umbilical cord blood mesenchymal stem cells;

[0019] Figure 3 Differential expression of lnc-RP11-272B17.1 during replicative senescence of umbilical cord blood mesenchymal stem cells;

[0020] Figure 4 Differential expression of lnc-AC005307.1 during replicative aging of umbilical cord blood mesenchymal stem cells;

[0021] Figure 5 Differential expression of lnc-AC091814.2 during replicative senescence of umbilical cord blood mesenchymal stem cells;

[0022] Figure 6 The inhibitor effect test results of Sh-lnc-AC005307.1 designed by the present invention;

[0023] Figure 7 Knockdown of Sh-NC and Sh-lnc-AC005307.1 regulates the proliferation of umbilical cord blood mesenchymal stem cells;

[0024] Figure 8 Knockdown of Sh-NC and Sh-lnc-AC005307.1 regulates replicative senescence of umbilical cord blood mesenchymal stem cells;

[0025] Fig. 9 Knockdown of Sh-NC and Sh-lnc-AC005307.1 regulates the expression of P21, P16, CyclinD1 and CyclinE1 proteins in umbilical cord blood mesenchymal stem cells;

[0026] Fig.10 Knockdown of Sh-NC and Sh-lnc-AC005307.1 regulates oxidative stress aging of umbilical cord blood mesenchymal stem cells. DETAILED DESCRIPTION

[0027] In order to clearly illustrate the technical features of this solution, this solution is described below through a specific implementation method.

[0028] Example 1 Isolation and culture of umbilical cord blood mesenchymal stem cells

[0029] (1) Collect umbilical cord blood from healthy women who under 30 years old who underwent cesarean section and dilute and mix with 1:1 PBS;

[0030] (2) Pour an equal volume of Percoll solution into a centrifuge tube, mix well, and place in a centrifuge at 2000 rpm / min for 20 min.

[0031] (3) After centrifugation, aspirate the middle flocculent white membrane mononuclear cell layer and resuspend it in PBS;

[0032] (4) Place the centrifuge tube in a centrifuge and centrifuge at 1000 rpm / min for 10 min to collect the cells at the bottom of the tube;

[0033] (5) Add DMEM / F12 medium containing 10% fetal bovine serum and 0.1% penicillin and streptomycin to suspend the cells;

[0034] (6) Wash the cells twice by centrifugation using DMEM / F12 medium, count the cells, and adjust the cell density to 1×10 6 / ml;

[0035] (7) The cells are inoculated into a cell culture dish and cultured with DMEM / F12 medium to obtain umbilical cord blood mesenchymal stem cells.

[0036] Example 2 Expression differences of genes lnc-RP11-266K4.9, lnc-HOTAIR, lnc-RP11-272B17.1, lnc-AC005307.1 and lnc-AC091814.2 during replicative senescence of umbilical cord blood mesenchymal stem cells

[0037] (1) Collect umbilical cord blood mesenchymal stem cells of P3, P6, P9 and P12 (three replicates in each group) into EP tubes and add 1 ml of Trizol to fully lyse the cells;

[0038] (2) After 10 min of lysis, add 200 μL of chloroform, shake and mix, and let stand at room temperature for 10 min;

[0039] (3) Place the EP tube in a high-speed centrifuge and centrifuge at 12,000 rpm for 10 min at 4°C. Carefully aspirate the upper aqueous phase and transfer it to a new EP tube.

[0040] (4) Add an equal volume of pre-cooled isopropanol according to the volume of the aqueous phase absorbed, mix well, and let stand on ice for 10 min;

[0041] (5) Place the EP tube in a high-speed centrifuge and centrifuge at 12,000 rpm for 10 min at 4°C. Discard the supernatant to obtain RNA precipitate.

[0042] (6) After adding 1 ml of 75% ethanol to resuspend the precipitate, place the EP tube in a high-speed centrifuge and centrifuge at 8000 rpm for 5 min at 4°C. After taking it out, remove the ethanol and dry it at room temperature to obtain RNA;

[0043] (7) Refer to the instructions of the Takara reverse transcription kit to prepare the following reaction system to remove genomic DNA:

[0044] Reagents Addition amount 5×gDNA Eraser Buffer 2μl gDNA Eraser 1μl Total RNA 1 μg RNase Free dH2O up to 10μl

[0045] The PCR reaction conditions were set as follows: 42°C for 2 min, 4°C for ∞;

[0046] (8) Refer to the instructions of the Takara reverse transcription kit to configure the following reaction system for reverse transcription:

[0047] Reagents Addition amount Step (7) Reaction solution 10μl PrimeScript RT Enzyme Mix I 1μl RT Primer Mix 1μl 5×PrimeScript Buffer 4μl RNase Free dH2O 4μl

[0048] The PCR reaction conditions were set as 37°C for 15 min, 85°C for 5 s, and 4°C for ∞;

[0049] (9) Design and synthesize primers for lnc-RP11-266K4.9, lnc-HOTAIR, lnc-RP11-272B17.1, lnc-AC005307.1, and lnc-AC091814.2. The specific primer sequences are as follows:

[0050]

[0051] (10) Refer to the instructions of Takara quantitative PCR kit to configure the following reaction system for quantitative PCR reaction:

[0052] Reagents Addition amount SYBR Green Premix Ex Taq (2×) 10μl Upstream primer 0.4μl Downstream primer 0.4μl cDNA template 2μl ddH2O 4μl

[0053] The reaction conditions of the real-time fluorescence quantitative PCR instrument were set as follows: 95°C for 5 min pre-denaturation; 95°C for 10 s denaturation, 60°C for 30 s annealing, 72°C for 45 s extension, 38 cycles; 72°C for 10 min final extension;

[0054] Follow 2 -△△Ct The obtained data were processed by the method to calculate the relative expression levels of lnc-RP11-266K4.9, lnc-HOTAIR, lnc-RP11-272B17.1, lnc-AC005307.1 and lnc-AC091814.2.

[0055] Experimental results refer to Figure 1-Figure 5As can be seen from the figure, during the replicative aging of umbilical cord blood mesenchymal stem cells, the relative expression levels of genes lnc-RP11-266K4.9, lnc-HOTAIR and lnc-AC091814.2 did not change significantly; the relative expression of lnc-RP11-272B17.1 at P12 decreased to a certain extent compared with the expression at P1, but the decrease level was low; the relative expression of lnc-AC005307.1 increased significantly with the increase in the number of passages, among which the relative expression of P6 generation was 1.635±0.109, and the relative expression of P12 generation was 2.992±0.169, which was statistically significant compared with P1 generation. The above results indicate that during the replicative aging of umbilical cord blood mesenchymal stem cells, the relative expression level of lnc-AC005307.1 will increase with the increase in the number of replications. Therefore, the aging of umbilical cord blood mesenchymal stem cells can be detected by detecting the expression level of lnc-AC005307.1.

[0056] Example 3

[0057] Design of ShRNA of lnc-AC005307.1 and verification by quantitative PCR

[0058] (1) Design ShRNA was designed based on the sequence of lnc-AC005307.1 (SEQ ID NO.11), the vector was pENTR™ / H1 / TO, and the specific sequence was:

[0059] Top Strand:

[0060] 5'-CACCGGACGATGAAGCTAGAATTTGAACGCAAATTCTAGCTTCATCGTCC-3', SEQ IDNO.12;

[0061] Bottom Strand:

[0062] 5'-AAAAGGACGATGAAGCTAGAATTTGCGTTCAAATTCTAGCTTCATCGTCC-3', SEQ IDNO.13;

[0063] (2) Umbilical cord blood mesenchymal stem cells were inoculated into 6-well cell culture plates. When the cell density reached 90%, Sh-NC and Sh-lnc-AC005307.1 were transfected. 48 hours after transfection, RNA was extracted to detect the relative expression level of lnc-AC005307.1.

[0064] The experimental results refer to Figure 6Among them, the relative expression level of lnc-AC005307.1 in the cells after transfection with Sh-lnc-AC005307.1 was 0.224±0.057. This result shows that the Sh-lnc-AC005307.1 designed by the present invention can effectively inhibit the expression of lnc-AC005307.1.

[0065] Example 4 Effect of the gene inhibitor of lnc-AC005307.1 on the proliferation of umbilical cord blood mesenchymal stem cells

[0066] (1) P12 umbilical cord blood mesenchymal stem cells transfected with Sh-NC and Sh-lnc-AC005307.1 were prepared into a cell suspension and inoculated into a 96-well plate;

[0067] (2) Add 10 μL CCK-8 to each well at 1d, 2d, 3d, 4d and 5d, and measure the absorbance at 450 n using an ELISA reader.

[0068] The experimental results are shown in Table 1 and Figure 7 As shown:

[0069] Table 1 Absorbance at 450 nm of umbilical cord blood mesenchymal stem cells at different times

[0070] Sh-NC Sh-lnc-AC005307.1 1d 0.240±0.006 0.234±0.012 2d 0.291±0.024 0.368±0.029 3d 0.363±0.027 0.586±0.036 4d 0.429±0.025 0.706±0.040 5d 0.467±0.035 0.790±0.039

[0071] From Table 1 and Figure 7 It can be seen that knocking out AC005307.1 can effectively promote the proliferation of umbilical cord blood mesenchymal stem cells. Therefore, the gene inhibitor of AC005307.1 can be used to prepare a promoter for promoting the proliferation of umbilical cord blood mesenchymal stem cells.

[0072] Example 4 Effect of the gene inhibitor of lnc-AC005307.1 on β-galactosidase in replicative senescence of umbilical cord blood mesenchymal stem cells

[0073] (1) Umbilical cord blood mesenchymal stem cells at P12 were inoculated into 6-well cell culture plates. The sh-NC group and Sh-lnc-AC005307.1 group were transfected with Sh-NC and Sh-lnc-AC005307.1, respectively. The control group was transfected with empty liposomes. Each group had 3 replicates.

[0074] (2) Prepare β-galactosidase staining solution. Every 1 ml of β-galactosidase staining solution contains: 10 μL β-galactosidase staining solution A, 10 μL β-galactosidase staining solution B, 930 μL β-galactosidase staining solution C, and 50 μL X-Gal solution.

[0075] (3) Aspirate the cell culture medium, wash once with PBS, add 1 ml of β-galactosidase fixative to each well, and fix 15 ml at room temperature;

[0076] (4) Aspirate the cell fixative and wash the cells three times with PBS, each time for 3 min;

[0077] (5) Aspirate PBS, add 1 ml of staining solution to each well, incubate at 37°C overnight, and observe and count under a microscope.

[0078] The experimental results are as follows Figure 8 As shown, compared with the control group, cells transfected with Sh-NC had no significant effect on the number of β-galactosidase-positive cells, while the number of β-galactosidase-positive cells decreased significantly after transfection with Sh-lnc-AC005307.1, indicating that the gene inhibitor of lnc-AC005307.1 can effectively reduce the replicative senescence of umbilical cord blood mesenchymal stem cells. Therefore, the gene inhibitor of lnc-AC005307.1 can be used to prepare a replicative senescence inhibitor of umbilical cord blood mesenchymal stem cells.

[0079] Example 5 Effects of the gene inhibitor of lnc-AC005307.1 on the protein expression of proliferation and aging-related genes P21, Cyclin-D1, P16 and Cyclin-E1

[0080] (1) Umbilical cord blood mesenchymal stem cells at P12 were inoculated into 6-well cell culture plates. The sh-NC group and Sh-lnc-AC005307.1 group were transfected with Sh-NC and Sh-lnc-AC005307.1, respectively, with 3 replicates in each group.

[0081] (2) 48 hours after transfection, remove the culture medium, add 100 μl of protein lysis buffer to each well, and fully lyse on ice;

[0082] (3) After lysis for 30 minutes, use a cell scraper to scrape the cells and transfer them to a 2 ml centrifuge tube. Place the tube in a centrifuge and centrifuge at 12,000 rpm for 18 minutes at 4°C. Pipette the supernatant into a new EP tube.

[0083] (4) Detect the concentration of sample protein according to the steps in the BCA assay kit instructions and add loading buffer;

[0084] (5) Prepare electrophoresis gel and assemble the electrophoresis device. After electrophoresis at 90 V constant voltage for 20 min, adjust the constant voltage to 120 V until the bromophenol blue band reaches the bottom of the separation gel;

[0085] (6) Adjust the electroporation clip to 230 mA constant current, end the electroporation after 90 min, remove the PVDF membrane and place it in the blocking solution for 1 h;

[0086] (7) Incubate with corresponding P21, Cyclin-D1, P16 and Cyclin-E1 antibodies in a 4°C refrigerator overnight;

[0087] (8) After washing the membrane thoroughly, incubate with the corresponding secondary antibody at room temperature for 1 h;

[0088] (9) After washing the film thoroughly, develop and expose it.

[0089] The experimental results are as follows Fig. 9 As shown in the figure, it can be seen that transfection of Sh-lnc-AC005307.1 can reduce the expression of pro-aging and anti-proliferation related genes P21 and P16 proteins, and can promote the expression of anti-aging and pro-proliferation related genes Cyclin-D1 and Cyclin-E1 proteins. Therefore, the gene inhibitor of lnc-AC005307.1 can be used to prepare an inhibitor that inhibits the expression of P21 and P16 proteins. At the same time, the gene inhibitor of lnc-AC005307.1 can be used to prepare a promoter that promotes the expression of Cyclin-D1 and Cyclin-E1 proteins.

[0090] Example 6 Effect of the gene inhibitor of lnc-AC005307.1 on β-galactosidase in oxidative stress aging of umbilical cord blood mesenchymal stem cells

[0091] (1) Experimental grouping: control group: idling liposomes, experimental group 1: idling liposomes + H2O2 treatment for 2 h, experimental group 2: transfection of Sh-NC + H2O2 treatment for 2 h, experimental group 3: transfection of lnc-AC005307.1 + H2O2 treatment for 2 h, each group was set up with 3 replicates;

[0092] (2) Prepare β-galactosidase staining solution. Every 1 ml of β-galactosidase staining solution contains: 10 μL β-galactosidase staining solution A, 10 μL β-galactosidase staining solution B, 930 μL β-galactosidase staining solution C, and 50 μL X-Gal solution.

[0093] (3) Aspirate the cell culture medium, wash once with PBS, add 1 ml of β-galactosidase fixative to each well, and fix 15 ml at room temperature;

[0094] (4) Aspirate the cell fixative and wash the cells three times with PBS, each time for 3 min;

[0095] (5) Aspirate PBS, add 1 ml of staining solution to each well, incubate at 37°C overnight, and observe and count under a microscope.

[0096] The experimental results are as follows Fig.10As shown in the figure, it can be seen from the results of the control group and experimental group 1 that H2O2-induced senescence can significantly increase the proportion of β-galactosidase-positive cells, indicating that senescence induction is successful; from the results of experimental groups 1, 2, and 3, it can be seen that transfection of Sh-NC has no significant effect on reducing cell senescence, while transfection of Sh-lnc-AC005307.1 can significantly reduce the proportion of β-galactosidase-positive cells, that is, reduce the senescence of umbilical cord blood mesenchymal stem cells. Therefore, from the above results, it can be seen that the gene inhibitor of AC005307.1 can effectively inhibit the oxidative stress senescence of umbilical cord blood mesenchymal stem cells.

[0097] Technical features not described in the present invention can be achieved through or by adopting existing technologies and will not be described in detail here. Of course, the above description is not a limitation of the present invention, and the present invention is not limited to the above examples. Changes, modifications, additions or substitutions made by ordinary technicians in this technical field within the essential scope of the present invention should also fall within the scope of protection of the present invention. Sequence Listing <110> Qingdao Starcell Cell Medicine Co., Ltd. <120> Gene inhibitors that promote proliferation of umbilical cord blood mesenchymal stem cells <160> 13 <170> SIPOSequenceListing 1.0 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <400> 1 cggcaaagga cagaacgttg 20 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <400> 2 ccagaacgct gtgtccatct 20 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <400> 3 tgcacattgg cgagagaagt 20 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <400> 4 cttccctcct ctggctctct 20 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <400> 5 aaggaatcca agctggctgg 20 <210> 6 <211> twenty one <212> DNA <213> Artificial Sequence <400> 6 accgaaactg caacgaaatc t 21 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <400> 7 tgcactcagc ctccttaagc 20 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <400> 8 gagatgggcg agaatccctg 20 <210> 9 <211> 20 <212> DNA <213> Artificial Sequence <400> 9 ggaagccctg gtgacttgaa 20 <210> 10 <211> 20 <212> DNA <213> Artificial Sequence <400> 10 ccttgccctc tgtccttctg 20 <210> 11 <211> 960 <212> DNA <213> Human <400> 11 ctgggaggca gagaccctgt cttcaggtgt tggctgaaag aaatggtaac ttattttagc 60 agccttgagc tttctcatgc gggcacatga agaggactag tgtcatctta gggaatgcgg 120 cctcgcacca ttggaaacaa tgattctaaa gaccatttcc acatggagaa gctgccagaa 180 caagcactgc tacccttgga ggccattgac attgtgaggt cgctgggact gaaaggaggt 240 tgaccagaag ttctgtttgg caatgcaaag ccaggaggaa aagttaatgg agtttgtccc 300 ccgggtccca agaaagctga cccaggacga tgaagctaga atttgtgttc taggaggtgc 360 tgcttcttcc aggaaagtct actcaaagca cacactgtga gctgctgcat gtctcttgag 420 ctagttcact gcagttttca tgatgaaagt gatctgtttc agtaaacttt ctgttatttg 480 agagcatggg aaaaatattt gctgtgattt cccaattccc cattttttct gattctttgt 540 tgcagtttcc acaactttgt tatcaggctg tgacagaggt ttgtgaactg atgaaagctc 600 cagagcctcc caggccctct gagtctgatg cctgcactcc acaatcaggc ctcaagctca 660 gggcgcctgc caccaaccca cgctgggctt caggggcagg cagcacttga atggggtttg 720 gttattgtct ttctttattt tctcttattt taagccttaa aaaaaaaaag ataaggtctt 780 gctctattgc ccaggctgga gagaaatggt gtgatcatag ctcactgcag ctttgaattc 840 ctgggttcaa ccgatcctcc cacctaagcc tcccgagtaa ccaggactgc aagtatgcac 900 caccacaccc agttaattaa atttgtgtgt gtgtgtgtgt gtagaggtgg gttcttgctt 960 <210> tgttgcccag gctggtcttg aactcttgag ttcagacaat cctgccacctcaacctcaca 1020 aagtgctgga attacaggcg tgagccactg cactcagcct ccttaagccatttgcttaag 1080 tggctttatt gcaaaacaat atcagaataa caaagaaata taaggtcaaactttccctgt 1140 tcccatctag tccaataagc attgctgctc ttgccaggga ttctcgcccatctccatgtg 1200 ccagtgcaat ccatactggt tgttctcctt ggctacccca catctgagtctctgccttgt 1260 ctgcattctt ccccacttta tgaagagatg agtcagtgcc tgattttttctgcctctctt 1320 gtcactaggg cacagccatg tgcatgggcc ctgtcactca gaagcccccatccaccaaca 1380 acatggctct gggggcctcc tctctctgga agaattggca gttttagcaagaaaggtttt 1440 cagaggcagc aatgatggtg gagatgtcca gggccagtgg caggtcaaaccattctctgt 1500 gtcatttggg gcagtgttta tgctgtccct cattttggtt ccctaagcctccgaacatgt 1560 acgtgaattt 1570 12 <211> 50 <212> DNA <213> Artificial Sequence <400> tgttgcccag gctggtcttg aactcttgag ttcagacaat cctgccacctcaacctcaca 1020 aagtgctgga attacaggcg tgagccactg cactcagcct ccttaagccatttgcttaag 1080 tggctttatt gcaaaacaat atcagaataa caaagaaata taaggtcaaactttccctgt 1140 tcccatctag tccaataagc attgctgctc ttgccaggga ttctcgcccatctccatgtg 1200 ccagtgcaat ccatactggt tgttctcctt ggctacccca catctgagtctctgccttgt 1260 ctgcattctt ccccacttta tgaagagatg agtcagtgcc tgattttttctgcctctctt 1320 gtcactaggg cacagccatg tgcatgggcc ctgtcactca gaagcccccatccaccaaca 1380 acatggctct gggggcctcc tctctctgga agaattggca gttttagcaagaaaggtttt 1440 cagaggcagc aatgatggtg gagatgtcca gggccagtgg caggtcaaaccattctctgt 1500 gtcatttggg gcagtgttta tgctgtccct cattttggtt ccctaagcctccgaacatgt 1560 acgtgaattt 1570 12 caccggacga tgaagctaga atttgaacgc aaattctagc ttcatcgtcc 50 <210> 13 <211> 50 <212> DNA <213> Artificial Sequence <400> 13 aaaaggacga tgaagctaga atttgcgttc aaattctagc ttcatcgtcc 50

Claims

1. Use of primers for detecting the expression level of lnc-AC005307.1 gene in the preparation of a kit for detecting aging of umbilical cord blood mesenchymal stem cells, characterized in that: The lnc-AC005307.1 is highly expressed in senescent cells of umbilical cord blood mesenchymal stem cells; The gene sequence of the lnc-AC005307.1 is shown as SEQ ID NO.11, and the sequences of the primers are shown as SEQ ID NO.7 and SEQ ID NO.

8.

2. Use of a gene inhibitor in the preparation of a drug for inhibiting aging of umbilical cord blood mesenchymal stem cells, characterized in that: The gene inhibitor is ShRNA that specifically targets and inhibits the expression of lnc-AC005307.1; The gene sequence of lnc-AC005307.1 is shown in SEQ ID NO.11; The sequences of the ShRNA are shown in SEQ ID NO.12 and SEQ ID NO.13.

Images