A probe composition, a second-generation sequencing library based on the probe composition and its application

Abstract

The present invention discloses a probe composition, a second-generation sequencing library based on the probe composition and its application, and belongs to the field of gene detection technology. The probe composition provided by the present invention is used to detect the variation of a target nucleic acid sequence relative to a non-target nucleic acid sequence, and includes a blocking probe and a capture probe, wherein the blocking probe and the capture probe are designed for the difference sequence between the non-target nucleic acid sequence and the target nucleic acid sequence; the difference ΔG between the Gibbs free energy of the binding of the blocking probe and the non-target nucleic acid sequence and the Gibbs free energy of the binding of the capture probe and the non-target nucleic acid sequence 非 阻滞‑捕获 The difference between the Gibbs free energy of the capture probe and the target nucleic acid sequence and the Gibbs free energy of the blocking probe and the target nucleic acid sequence is ΔG 靶 捕获‑阻滞 The probe composition of the present invention is based on selective targeted enrichment technology and provides a method for constructing a high-throughput library for highly sensitive detection of low-frequency gene variations, which can detect variations as low as 0.1% in nucleic acid samples.

Description

Technical Field

[0001] The present invention relates to the technical field of gene detection, and in particular to a probe composition, a second-generation sequencing library based on the probe composition, and applications thereof. Background Art

[0002] Liquid biopsy is an in vitro diagnostic technology that uses non-solid biological tissues such as blood as specimens for sampling and analysis. The "liquid" in liquid biopsy is mainly blood, but also includes feces, urine, saliva and other body fluid samples. The main application scenarios of liquid biopsy are early screening, diagnosis, medication guidance, monitoring, prognosis management, and non-invasive prenatal testing. In addition, it also includes other diseases such as musculoskeletal system and connective tissue diseases, infectious diseases and parasitic diseases. Depending on the different test objects, liquid biopsy technology has developed several branches, among which cfDNA / ctDNA technology is a common liquid biopsy technology. Free DNA (cfDNA) is a DNA fragment from cells that is free in the blood circulation system. It mainly comes from fragmented DNA in the process of cell apoptosis, DNA fragments of necrotic cells, and exosomes secreted by cells. The most important type of cfDNA is circulating tumor DNA (ctDNA). ctDNA is a DNA fragment from the tumor genome that enters the blood circulation system, carrying information such as mutations, insertions, deletions, rearrangements, copy number abnormalities and / or methylation, and usually accounts for less than 1% of cfDNA.

[0003] Liquid biopsy technology that uses high-throughput sequencing (NGS, also called second-generation sequencing) technology to detect ctDNA is expected to change the diagnosis and treatment of tumors. NGS can sequence thousands of sites at a time and can be applied to tumor screening, targeted drug selection, drug resistance identification, and treatment effect evaluation. However, due to the sequencing library construction process and sequencing platform, the detection limit of NGS technology is generally 2%. The library construction method based on unique molecular tags (UMI) can increase the detection sensitivity of NGS to 0.1%, but this usually requires an ultra-high sequencing depth of more than 25000X, which limits the application of NGS in detecting low-frequency variants below 1%. In addition to UMI-NGS, the most commonly used methods for low-frequency gene variation detection technology include allele block amplification system (ARMS) and digital PCR technology. ARMS and digital PCR technology have a detection sensitivity of up to 0.1%, but can only detect variations in limited sites, and the detection throughput is difficult to improve. Therefore, the market still needs to find a high-throughput sequencing technology that does not require high sequencing depth but can detect low-frequency variations below 1%. Summary of the invention

[0004] In order to solve the above technical problems, the present invention provides a probe composition for variation detection based on selective targeted enrichment technology.

[0005] The first object of the present invention is to provide a probe composition, which comprises a blocking probe and a capture probe, and is used to detect a variation of a target nucleic acid sequence relative to a non-target nucleic acid sequence, wherein the target nucleic acid sequence has at least one base variation relative to the non-target nucleic acid sequence, wherein:

[0006] The blocking probe and the capture probe are designed for the difference sequence between the non-target nucleic acid sequence and the target nucleic acid sequence;

[0007] The Gibbs free energy (G 阻滞 ) Gibbs free energy of binding to capture probes and non-target nucleic acid sequences (G 捕获 ) 非 阻滞-捕获 -9.5~-0.5kcal / mol; the difference between the Gibbs free energy of the capture probe and the target nucleic acid sequence and the Gibbs free energy of the blocking probe and the target nucleic acid sequence is ΔG 靶 捕获-阻滞 It is -8.5~-0.5kcal / mol.

[0008] Furthermore, ΔG 非 阻滞-捕获 It can be -9.5 to -8.5 kcal / mol, -8.5 to -7.5 kcal / mol, -7.5 to -6.5 kcal / mol, -6.5 to -5.5 kcal / mol, -5.5 to -4.5 kcal / mol, -4.5 to -3.5 kcal / mol, -3.5 to -2.5 kcal / mol, -2.5 to -1.5 kcal / mol, -1.5 to -0.5 kcal / mol. Preferably, ΔG 非 阻滞-捕获 It is -4.5~-2.5kcal / mol.

[0009] Furthermore, ΔG 靶 捕获-阻滞 It can be -8.5 to -7.5 kcal / mol, -7.5 to -6.5 kcal / mol, -6.5 to -5.5 kcal / mol, -5.5 to -4.5 kcal / mol, -4.5 to -3.5 kcal / mol, -3.5 to -2.5 kcal / mol, -2.5 to -1.5 kcal / mol, -1.5 to -0.5 kcal / mol. Preferably, ΔG 靶 捕获-阻滞 It is -4.5~-2.5kcal / mol.

[0010] The second object of the present invention is to provide a method for constructing a second-generation sequencing library based on the above-mentioned probe combination, comprising the following steps:

[0011] (1) subjecting the sample DNA fragment, the blocking probe and the capture probe to hybridization reaction;

[0012] (2) capturing target nucleic acid fragments in the sample DNA fragments, and performing end repair and adapter ligation on the captured DNA fragments;

[0013] (3) Performing PCR amplification of the sample index of the adapter ligation product to construct the above-mentioned sequencing library.

[0014] Further, the sample DNA is a gDNA sample or a cfDNA sample, and gDNA and cfDNA can be derived from plasma, serum, blood, urine, sweat, saliva, semen, pleural effusion, ascites, feces, puncture samples, paraffin-embedded tissue sections (FFPE) samples. Therefore, the probe composition of the present invention can be used to prepare liquid biopsy reagents or tissue biopsy reagents.

[0015] Furthermore, if the sample DNA is a gDNA sample, it needs to be genome-interrupted; if the sample is a cfDNA sample, since the cfDNA itself is already a naturally degraded short fragment, no interruption step is required.

[0016] Furthermore, genome fragmentation methods include physical fragmentation and chemical fragmentation, such as Covaris ultrasonic fragmentation, fragmentase enzyme digestion, etc.

[0017] Furthermore, in step (1), when performing the hybridization reaction, the hybridization reaction system also includes a hybridization buffer and a hybridization enhancer, and the hybridization enhancer includes at least one of dimethyl sulfoxide, betaine, urea, formamide or sodium dodecyl sulfate.

[0018] Furthermore, in step (2), the capture probe is modified with biotin (the blocking probe is not labeled with biotin), and after the capture probe is hybridized with the target nucleic acid sequence, magnetic beads modified with streptavidin are used for affinity capture. Specifically, the streptavidin magnetic beads are co-incubated with the system after the hybridization reaction, washed, hot eluted and eluted at room temperature, and finally the streptavidin magnetic beads and the captured target DNA fragments are separated by high temperature heating.

[0019] Furthermore, when performing index PCR amplification, the adapter ligation product is mixed with a primer with an index sequence to perform a PCR reaction. The index sequence can be used to distinguish different sample DNAs.

[0020] Furthermore, the sequencing library constructed above was applied to a second-generation sequencing platform with a sequencing depth of 100X-1000X.

[0021] In the above-mentioned probe composition, the non-target nucleic acid sequence in the sample DNA and the target nucleic acid sequence, the blocking probe, and the capture probe are hybridized at the same time. The present invention optimizes the Gibbs free energy of their binding, and the non-target nucleic acid sequence is bound to the blocking probe, and the capture probe is bound to the target nucleic acid sequence. The capture probe is labeled with biotin and will bind to the subsequent streptavidin magnetic beads; while the blocking probe is not labeled with biotin, the non-target nucleic acid sequence will be lost during the magnetic bead separation process. The captured DNA fragments are end-repaired & A-added, adapter-connected, and index PCR is performed to form the final sequencing library.

[0022] The present invention has the following advantages: (1) The sensitivity of detection is improved, and variation as low as 0.1% can be detected; (2) The target nucleic acid sequence is enriched in the sequencing library, so high-depth sequencing is not required for variation detection, and the amount of sequencing data is also small, which is suitable for desktop sequencing platforms; (3) Compared with the traditional hybridization library construction method, this method can reduce one PCR and shorten the time of library construction. At the same time, for the technical platform for enriching target nucleic acid sequences, most of the existing technologies use quantitative PCR technology, and the number of sites detected in each tube is small. If more sites are needed, they need to be tested separately, which increases the consumption of sample volume, and it is difficult to draw a large amount of blood from tumor patients. The present invention belongs to the field of NGS, and the number of sites that can be detected in each tube ranges from hundreds to thousands, and the requirement for sample volume is lower; (4) In the field of NGS, there is also a huge difference in the number of sites between selective hybridization technology and multiple amplification technology. There is an upper limit to the number of sites for multiplex amplification. When the number reaches a certain level, it is difficult to optimize the reaction conditions to achieve ideal detection results for all sites. The selective hybridization technology of the present invention can easily cover the entire exome, has good amplification, and can increase sites in the existing panel based on scientific research progress without reducing product performance.

[0023] By means of the above scheme, the present invention has at least the following advantages:

[0024] The present invention introduces a blocking probe into the hybridization reaction, and the blocking probe and the capture probe competitively bind to the target nucleic acid sequence / non-target nucleic acid sequence. The blocking probe and the capture probe are designed according to the thermodynamic difference, so that the non-target nucleic acid sequence binds to the blocking probe and the target nucleic acid sequence binds to the capture probe, and the target nucleic acid sequence is enriched in the final sequencing library. The probe composition of the present invention or the second-generation sequencing library constructed based on it can be used to detect low-frequency variations, and has the advantages of high sensitivity (can detect variations as low as 0.1%) and high throughput (can detect thousands of variation sites at the same time), low requirements for sample data volume, and does not rely on high-depth sequencing (average sequencing depth is about 1000X).

[0025] The above description is only an overview of the technical solution of the present invention. In order to more clearly understand the technical means of the present invention and implement it according to the contents of the specification, the following is a description of the preferred embodiments of the present invention in conjunction with detailed drawings. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] In order to make the contents of the present invention more clearly understood, the present invention is further described in detail below based on specific embodiments of the present invention in conjunction with the accompanying drawings.

[0027] Figure 1 It is a schematic diagram of the selective targeted enrichment technical solution of the present invention. DETAILED DESCRIPTION

[0028] The present invention is further described below in conjunction with the accompanying drawings and specific embodiments so that those skilled in the art can better understand the present invention and implement it, but the embodiments are not intended to limit the present invention.

[0029] Example 1

[0030] The present invention is further described in detail below by taking hotspot mutation detection in non-small cell lung cancer and Illumina high-throughput sequencing platform as an example in combination with specific embodiments.

[0031] 1. Design and synthesis of probes

[0032] For the hot spots in the mutation sites of non-small cell lung cancer related genes, the blocking probe and the capture probe are designed and synthesized according to the thermodynamic principle, wherein the capture probe is labeled with biotin, and the blocking probe is not labeled with biotin. The mutation hot spots of non-small cell lung cancer related genes involved in the embodiments of the present invention and the corresponding probe numbers are shown in Tables 1 and 2.

[0033] Table 1 Non-small cell lung cancer gene mutation hotspots and corresponding probe numbers

[0034]

[0035]

[0036] Table 2 Probe sequence information

[0037]

[0038]

[0039]

[0040]

[0041]

[0042] The probe and technical solution in this embodiment can be applied to second-generation sequencing platforms produced by different manufacturers, including but not limited to Illumina, ThermoFisher and BGI.

[0043] 2. Preparation of samples to be tested

[0044] The samples tested in the embodiment of the present invention include 4 cfDNA standards with known gene variation frequencies and 20 plasma samples with unknown gene variation. The cfDNA standard contains 6 single-base variations (SNVs), 1 deletion and 1 insertion, a total of 8 sites, and their variation frequencies are confirmed by digital PCR test, which are 1%, 0.5%, 0.1% and 0%, respectively, and each test is repeated 3 times. Plasma samples are tested for genes using both STE technology and control technology (ARMS PCR technology).

[0045] The specific steps for extracting free DNA from plasma samples are as follows:

[0046] 1. Separate the plasma from 10 mL of freshly collected whole blood within 4 hours, centrifuge at 1600 g for 20 min at 4°C, and transfer the supernatant plasma to a new centrifuge tube. Centrifuge again at 16000 g for 10 min to remove residual cells, and transfer the supernatant plasma to a 15 mL centrifuge tube.

[0047] 2. Add 160 μL of proteinase K and 400 μL of sample lysis buffer to the 15 mL centrifuge tube containing plasma, vortex and mix the tube, and incubate at 60°C for 20 min.

[0048] 3. While incubating, add free DNA lysis / binding solution and nanomagnetic beads in turn to another centrifuge tube (add 5 mL of free DNA lysis / binding solution and 60 μL of nanomagnetic beads to each reaction) to prepare a nanomagnetic bead binding solution of appropriate reaction volume and mix well.

[0049] 4. After the incubation, equilibrate the centrifuge tube to room temperature, add the prepared nanomagnetic bead binding solution to the lysed plasma sample, and invert 10 times to mix.

[0050] 5. Oscillate the centrifuge tube at 1000 rpm for 10 minutes, then place it on a magnetic rack and let it stand for 5 minutes until the solution in the tube becomes clear.

[0051] 6. Carefully discard the supernatant, remove the centrifuge tube from the magnetic stand, add 1 mL of washing solution, and vortex to resuspend the nanomagnetic beads.

[0052] 7. Transfer the resuspended nanomagnetic bead solution into a new 1.5 mL centrifuge tube and place it on a magnetic rack for 2 minutes to allow the solution in the tube to clarify.

[0053] 8. Carefully discard the supernatant, remove the centrifuge tube from the magnetic rack, add 1 mL of washing solution, and vortex to resuspend the nanomagnetic beads. After a short centrifugation, place it on the magnetic rack and let it stand for 2 minutes until the solution in the tube is clear.

[0054] 9. Carefully discard the supernatant, remove the centrifuge tube from the magnetic rack, add 1 mL of freshly prepared secondary washing solution, and vortex to resuspend the nanomagnetic beads. After a short centrifugation, place it on the magnetic rack and let it stand for 2 minutes until the solution in the tube is clear.

[0055] 10. Carefully discard the supernatant including the residual liquid at the bottom of the tube, place the centrifuge tube on the magnetic rack, open the lid for 3 minutes and let it dry at room temperature.

[0056] 11. Remove the centrifuge tube from the magnetic rack, add 45 μL of elution buffer, shake the centrifuge tube thoroughly to resuspend the nanomagnetic beads, and let it stand at room temperature for 5 minutes.

[0057] 12. After briefly centrifuging the centrifuge tube, place it on a magnetic rack for 2 minutes to allow the solution in the tube to clarify. Collect 43 μL of supernatant (cfDNA) and store it in another clean centrifuge tube.

[0058] 13. Take 1 μL of cfDNA and use Qubit reagent to measure the concentration of cfDNA. The concentration measurement results of 20 cfDNA samples are shown in Table 3.

[0059] Table 3 Results of cfDNA concentration determination in 20 plasma samples

[0060]

[0061] 3. Library construction and high-throughput sequencing

[0062] 1. The steps for sample concentration and hybridization are as follows:

[0063] (1) Take 30 ng of cfDNA sample and place it in a 1.5 mL low-adsorption centrifuge tube and add 0.1X TE to 50 μL, then add 7.5 μL Human cotDNA and 104 μL Ampure XP Beads. Vortex to mix and incubate at 25°C for 10 min.

[0064] (2) Place the centrifuge tube on a magnetic rack for 5 minutes until the liquid is completely clear, and use a pipette to remove the supernatant.

[0065] (3) Slowly add 200 μL of freshly prepared 80% ethanol along the wall of the centrifuge tube, let it stand for 30 seconds, and use a pipette to discard the supernatant.

[0066] (4) Repeat the above steps once.

[0067] (5) Place the centrifuge tube on a magnetic rack and use a 10 μL pipette tip to remove a small amount of residual ethanol, being careful not to suck up the magnetic beads.

[0068] (6) Dry the magnetic beads at room temperature for 2-5 minutes until the ethanol is completely evaporated.

[0069] (7) Add 9.5 μL of hybridization buffer, 3 μL of hybridization enhancer, 3 μL of capture probe and 3 μL of blocking probe to the centrifuge tube in sequence, mix well, and incubate at room temperature for 5 min.

[0070] (8) Place the centrifuge tube on a magnetic rack for 5 min until the liquid is completely clear. Use a pipette to transfer 17 μL of the supernatant to a new 0.2 mL PCR tube. Centrifuge briefly, place the tube in a PCR instrument, and start the following PCR program: 95°C, 30 sec (DNA denaturation reaction); 65°C, 16 hrs (hybridization reaction); 65°C, ∞.

[0071] 2. The steps of streptavidin magnetic bead capture are as follows:

[0072] (1) Take out the streptavidin beads 30 minutes in advance and place them at room temperature for equilibrium. Vortex to mix well and transfer 50 μL into a 1.5 mL low-absorption centrifuge tube.

[0073] (2) Add 100 μL Bead Wash Buffer to the centrifuge tube, gently pipette and mix 10 times, centrifuge briefly, place on a magnetic rack for a few minutes, wait until the liquid is completely clear, and use a pipette to discard the supernatant. Remove the centrifuge tube from the magnetic rack.

[0074] (3) Repeat the above steps twice.

[0075] (4) Add 17 μL of magnetic bead suspension to the centrifuge tube, gently pipette to mix, and incubate the centrifuge tube at 65°C for 5 min.

[0076] (5) After the hybridization reaction is completed, add 17 μL of resuspended streptavidin magnetic beads to the hybridization system and mix gently with a pipette.

[0077] (6) Incubate at 65°C for 45 min. Mix by gently pipetting every 15 min to ensure that the beads are completely resuspended.

[0078] (7) After the incubation, add 100 μL of 65°C Wash Buffer 1 to the PCR tube and mix the hybridization system containing the magnetic beads by pipetting.

[0079] (8) Place the PCR tube on the magnetic rack for 30 seconds. After the liquid is completely clear, use a pipette to remove the supernatant.

[0080] (9) Remove the PCR tube from the magnetic rack, add 150 μL 65°C Wash Buffer 2, mix by gently pipetting, and place in the PCR instrument for incubation for 5 min.

[0081] (10) Repeat steps 8 and 9 once.

[0082] (11) Centrifuge the PCR tube briefly and place it on a magnetic rack for 1 min. After the liquid is completely clear, remove the supernatant and add 150 μL of room temperature Wash Buffer 1. Vortex to mix and incubate at room temperature for 2 min.

[0083] (12) Centrifuge the PCR tube briefly and place it on a magnetic rack for 1 min. After the liquid is completely clear, remove the supernatant and add 150 μL of room temperature Wash Buffer 3. Vortex to mix and incubate at room temperature for 2 min.

[0084] (13) Centrifuge the PCR tube briefly and place it on a magnetic rack for 1 minute. After the liquid is completely clear, remove the supernatant and add 150 μL of room temperature Wash Buffer 4. Vortex to mix and incubate at room temperature for 2 minutes.

[0085] (14) Centrifuge the PCR tube briefly and place it on a magnetic rack for 1 min. After the liquid is completely clarified, remove the supernatant and then use a 10 μL pipette tip to remove a small amount of residual buffer.

[0086] (15) Remove the PCR tube from the magnetic rack, add 42 μL of Nuclease Free Water, gently pipette up and down 10 times, and incubate at room temperature for 5 min.

[0087] (16) After instant centrifugation, the PCR tube was placed on a PCR instrument at 95°C for 5 min, and then immediately placed on a magnetic stand for 30 sec. After the liquid was completely clear, 40 μL of the supernatant was transferred to a new 0.2 mL PCR tube using a pipette.

[0088] 3. The steps for end repair and 3' end A addition are as follows:

[0089] (1) Add 6 μL End Repair & A-Tailing Buffer and 4 μL End Repair & A-tailing Enzyme to the 0.2 mL PCR tube containing the sample, mix well, and centrifuge briefly.

[0090] (2) Place the PCR tube into the PCR instrument and start the following PCR program: 20°C, 30 min; 65°C, 30 min; 4°C, ∞.

[0091] 4. The steps for connecting the connector are as follows:

[0092] (1) After the previous step of reaction is completed, add 2 μL Adapter, 26 μL Ligation Buffer, and 2 μL DNA Ligase to the PCR tube in sequence, mix well, and centrifuge briefly.

[0093] (2) Place the PCR tube into the PCR instrument and start the following PCR program: 20°C, 15 min; 4°C, ∞.

[0094] 5. The steps for purifying the ligation product are as follows:

[0095] (1) After the previous step is completed, add 40 μL of Ampure XP Beads that have been pre-equilibrated to room temperature into the PCR tube, mix well, and incubate at 25°C for 5 min.

[0096] (2) Centrifuge the PCR tube briefly and place it on a magnetic rack for 5 minutes until the liquid is completely clear. Use a pipette to remove and discard the supernatant.

[0097] (3) Slowly add 200 μL of freshly prepared 80% ethanol along the wall of the centrifuge tube, let it stand for 30 seconds, and use a pipette to discard the supernatant.

[0098] (4) Repeat the above steps once.

[0099] (5) Place the centrifuge tube on a magnetic rack and use a 10 μL pipette tip to remove a small amount of residual ethanol, being careful not to suck up the magnetic beads.

[0100] (6) Dry the magnetic beads at room temperature for 2-5 minutes until the ethanol is completely evaporated.

[0101] (7) Remove the PCR tube, add 21 μL of Nuclease Free Water to the PCR tube, suspend and mix the magnetic beads, and incubate at 25°C for 5 min.

[0102] (8) Centrifuge the PCR tube briefly and place it on a magnetic rack for 5 min until the liquid is completely clear. Use a pipette to carefully transfer 20 μL of the supernatant into a new 0.2 mL PCR tube.

[0103] 6. The steps of PCR amplification are as follows:

[0104] (1) Add 25 μL of 2X HiFi PCR MasterMix and 5 μL of Amplification PrimerMix to the PCR tube containing the purified ligation product, mix well, and centrifuge briefly.

[0105] (2) Place the PCR tube into the PCR instrument and start the following PCR program: 98°C, 2 min; (98°C, 15 sec; 60°C, 30 sec; 72°C, 30 sec) x 14 cycles; 72°C, 2 min; 4°C, ∞.

[0106] 7. The steps for library purification are as follows:

[0107] (1) Add 50 μL of Ampure XP Beads pre-equilibrated to room temperature to the PCR tube containing the amplified product, mix well, and incubate at 25°C for 5 min.

[0108] (2) Centrifuge the PCR tube briefly and place it on a magnetic rack for 5 minutes until the liquid is completely clear. Use a pipette to remove and discard the supernatant.

[0109] (3) Slowly add 200 μL of freshly prepared 80% ethanol along the wall of the centrifuge tube, let it stand for 30 seconds, and use a pipette to discard the supernatant.

[0110] (4) Repeat the above steps once.

[0111] (5) Place the centrifuge tube on a magnetic rack and use a 10 μL pipette tip to remove a small amount of residual ethanol, being careful not to suck up the magnetic beads.

[0112] (6) Dry the magnetic beads at room temperature for 2-5 minutes until the ethanol evaporates completely.

[0113] (7) Remove the PCR tube, add 21 μL TE Solution to the PCR tube, suspend the magnetic beads and mix well, and incubate at 25°C for 5 min.

[0114] (8) Centrifuge the PCR tube briefly and place it on a magnetic rack for 5 min until the liquid is completely clear. Use a pipette to carefully transfer 20 μL of the supernatant into a new 0.2 mL PCR tube for storage.

[0115] 8. The steps of high-throughput sequencing are as follows:

[0116] After the constructed NGS library passed QC, 2x150 bp paired-end sequencing was performed on the Illumina NovaSeq 6000 platform, with an average sequencing depth of 1000X.

[0117] 4. Bioinformatics Data Analysis

[0118] The NGS raw data generated by NovaSeq 6000 were identified for variants within the target range after removing adapter sequences, filtering low-quality data, and comparing with the genome reference. The test results of the standard and plasma samples are shown in Tables 4 and 5, respectively.

[0119] Table 4 Test results of 4 standards with known gene mutation frequencies, repeated 3 times

[0120]

[0121]

[0122] Note: + indicates that the test result of the site is positive, - indicates that the test result of the site is negative.

[0123] Table 5 Gene mutation detection results of 20 plasma samples

[0124]

[0125]

[0126] From the results in Table 4, it can be seen that this protocol can stably detect SNVs and INDELs with a mutation frequency as low as 0.1% for 30 ng of cfDNA standard, with a sensitivity and specificity of 100%.

[0127] From the results in Table 5, it can be seen that 20 plasma samples were tested using both the STE technology of the present invention and the control technology. The test results of 17 samples (8 wild-type and 9 variants) were completely consistent between the two methods, and there were differences in the test results of 3 samples. Among the 3 samples with inconsistent test results, 2 samples detected by STE technology exceeded the coverage of the control technology A product: Sample No. 14 detected TP53 R175H mutation by STE, while the control technology detected it as wild type; Sample No. 19 detected KRAS Q61H mutation by STE, while the control technology detected it as wild type; 1 sample STE detected one more mutation than the control technology: Sample No. 5 detected EGFR 19DEL and EGFR T790M by STE technology, while the control technology only detected EGFR 19DEL and did not detect EGFR T790M.

[0128] Samples with inconsistent test results were verified using digital PCR technology. Sample 14 TP53 R175H and sample 19 KRAS Q61H were verified by digital PCR, and both mutations were true mutations, with mutation frequencies of 1.25% and 3.50%, respectively. Since these two sites were not within the detection range of the control technology kit, it was normal that they were not detected. Sample 5 EGFRT790M mutation was verified by digital PCR, and its mutation frequency was 0.09%.

[0129] The above data show that the STE technology of the present invention can stably detect gene variations as low as 0.1% under the premise of lower NGS sequencing depth.

[0130] Obviously, the above embodiments are merely examples for clear explanation and are not intended to limit the implementation methods. For those skilled in the art, other different forms of changes or modifications can be made based on the above description. It is not necessary and impossible to list all the implementation methods here. The obvious changes or modifications derived from these are still within the protection scope of the invention. Sequence Listing <110> Shanghai Pulmonary Hospital, Yuer Gene Technology (Suzhou) Co., Ltd., Shanghai Yuer Gene Technology Co., Ltd. <120> A probe composition, a second-generation sequencing library based on the probe composition and its application <160> 64 <170> SIPOSequenceListing 1.0 <210> 1 <211> 120 <212> DNA <213> (Artificial sequence) <400> 1 ggcagccagg aacgtactgg tgaaaacacc gcagcatgtc aagatcacag attttgggct 60 ggccaaactg ctgggtgcgg aagagaaaga ataccatgca gaaggaggca aagtaaggag 120 <210> 2 <211> 120 <212> DNA <213> (Artificial sequence) <400> 2 caacccccac gtgtgccgcc tgctgggcat ctgcctcacc tccaccgtgc agctcatcac 60 gcagctcatg cccttcggct gcctcctgga ctatgtccgg gaacacaaag acaatattgg 120 <210> 3 <211> 120 <212> DNA <213> (Artificial sequence) <400> 3 ctggatccca gaaggtgaga aagttaaaat tcccgtcgct atcaaggaat taagagaagc 60 aacatctccg aaagccaaca aggaaatcct cgatgtgagt ttctgctttg ctgtgtgggg 120 <210> 4 <211> 120 <212> DNA <213> (Artificial sequence) <400> 4 tggccaccat gcgaagccac actgacgtgc ctctccctcc ctccaggaag cctacgtgat 60 ggccagcgtg gacaaccccc acgtgtgccg cctgctgggc atctgcctca cctccaccgt 120 <210> 5 <211> 120 <212> DNA <213> (Artificial sequence) <400> 5 caaccaagct ctcttgagga tcttgaagga aactgaattc aaaaagatca aagtgctggg 60 ctccggtgcg ttcggcacgg tgtataaggt aaggtccctg gcacaggcct ctgggctggg 120 <210> 6 <211> 120 <212> DNA <213> (Artificial sequence) <400> 6 attcgtccac aaaatgattc tgaattagct gtatcgtcaa ggcactcttg cctacgccac 60 cagctccaac taccacaagt ttatattcag tcattttcag caggccttat aataaaaata 120 <210> 7 <211> 120 <212> DNA <213> (Artificial sequence) <400> 7 acacaaagaa agccctcccc agtcctcatg tactggtccc tcattgcact gtactcctct 60 tgacctgctg tgtcgagaat atccaagaga caggtttctc catcaattac tacttgcttc 120 <210> 8 <211> 120 <212> DNA <213> (Artificial sequence) <400> 8 tgattttgca gaaaacagat ctgtattttat ttcagtgtta cttacctgtc ttgtctttgc 60 tgatgtttca ataaaaggaa ttccataact tcttgctaag tcctgagcct gttttgtgtc 120 <210> 9 <211> 120 <212> DNA <213> (Artificial sequence) <400> 9 tccacaaaat ggatccagac aactgttcaa actgatggga cccactccat cgagatttca 60 ctgtagctag accaaaatca cctattttta ctgtgaggtc ttcatgaaga aatatatctg 120 <210> 10 <211> 120 <212> DNA <213> (Artificial sequence) <400> 10 ccacattaca tacttaccat gccactttcc cttgtagact gttccaaatg atccagatcc 60 aattctttgt cccactgtaa tctgcccatc aggaatctcc caatcatcac tcgagtcccg 120 <210> 11 <211> 120 <212> DNA <213> (Artificial sequence) <400> 11 attcatctac aaagtggttc tggattagct ggattgtcag tgcgcttttc ccaacaccac 60 ctgctccaac caccaccagt ttgtactcag tcatttcaca ccagcaagaa cctgttggaa 120 <210> 12 <211> 120 <212> DNA <213> (Artificial sequence) <400> 12 acagaggaag ccttcgcctg tcctcatgta ttggtctctc atggcactgt actcttcttg 60 tccagctgta tccagtatgt ccaacaaaca ggtttcacca tctataacca cttgttttct 120 <210> 13 <211> 120 <212> DNA <213> (Artificial sequence) <400> 13 aaaatgacaa agaacagctc aaagcaattt ctacacgaga tcctctctct gaaatcactg 60 agcaggagaa agattttcta tggagtcaca ggtaagtgct aaaatggaga ttctctgttt 120 <210> 14 <211> 120 <212> DNA <213> (Artificial sequence) <400> 14 cttagataaa actgagcaag aggctttgga gtatttcatg aaacaaatga atgatgcaca 60 tcatggtggc tggacaacaa aaatggattg gatcttccac acaattaaac agcatgcatt 120 <210> 15 <211> 120 <212> DNA <213> (Sunshine) <400> 15 ccagggcatc tggatccctg atggggagaa tgtgaaaatt ccagtggcca tcaaagtgtt 60 gagggaaaac acatccccca aagccaacaa agaaatctta gacgtaagcc cctccaccct 120 <210> 16 <211> 120 <212> DNA <213> (Sunshine) <400> 16 tgtgtggtct cccataccct ctcagcgtac cttgtcccc aggaagcata cgtgatggct 60 ggtgtgggct ccccatatgt ctcccgcctt ctgggcatct gcctgacatc cacggtgcag 120 <210> 17 <211> 120 <212> DNA <213> (Sunshine) <400> 17 cccaactaca gaaatggttt caaatgaatc tgtagactac cgagctactt ttccagaagg 60 tatatttcag tttattgttc tgagaaatac ctatacatat acctcagtgg gttgtgacat 120 <210> 18 <211> 120 <212> DNA <213> (Artificial sequence) <400> 18 ctttctgtag gctggatgaa aaattcacag tcaaggttgc tgattttggt cttgccagag 60 acatgtatga taaagaatac tatagtgtac acaacaaaac aggtgcaaag ctgccagtga 120 <210> 19 <211> 120 <212> DNA <213> (Artificial sequence) <400> 19 aatgaaggtg ccatcattct tgaggaggaa gtagcgtggc cgccaggtct tgatgtactc 60 ccctacagac gtgcgggtgg tgagagccac gcacactcta cccgtcagac cctcgccagg 120 <210> 20 <211> 120 <212> DNA <213> (Artificial sequence) <400> 20 tggatcccaa ctgcctaccg ttgccatccg ggctttacgc aaataagtaa gaaggtctcc 60 tccctccatc agttccagga taatgtattg gggttcattc agcagacaaa ctccaagctg 120 <210> 21 <211> 120 <212> DNA <213> (Artificial sequence) <400> 21 cgggcgaggg cgggtctctc ggaggaagga cttgaggtct ccccccgcca tgagctccag 60 caggatgaac cggggcaggg attgcaggct caccccaatg cagcgaacaa tgttctggtg 120 <210> 22 <211> 120 <212> DNA <213> (Sunshine) <400> 22 tgtggcttta cctgatgatc agggcttcca tgaggaaatc cagttcgtcc tgttcagagc 60 acacttcagg cagcgtctgg gcagagaagg ggagggtggg gaggaggagg aggctgtgag 120 <210> 23 <211> 120 <212> DNA <213> (Sunshine) <400> 23 acacagatca gcgacaggat gacaggaaga gcacagtcac tttgactcac cggtggatga 60 agtggttttc ctccaaatac tgacagccac aggcaatgtc ccgagccacg tgcagaaggt 120 <210> 24 <211> 120 <212> DNA <213> (Sunshine) <400> 24 tcttcggcgt ctgcaccgag ggccgcccc tgctcatggt ctttgagtat atgcggcacg 60 gggacctcaa ccgcttcctc cggtaccagc acctggcctc agcgctggcc ccggcccctg 120 <210> 25 <211> 120 <212> DNA <213> (Sunshine) <400> 25 ctggggtcag gtgcagggga agacaatcct tgcttacctg aggaacttat tcaggtctcc 60 atgcttcatg tattcaaaga ccatgatgag ggggtcccca tcgccgcaca ctccatagaa 120 <210> 26 <211> 120 <212> DNA <213> (Sunshine) <400> 26 cttctttgcg gagattctct tctctgtgc gccggtctct cccaggacag gcacaaacac 60 gcacctcaaa gctgttccgt cccagtagat taccactact caggatagga aaagagaagc 120 <210> 27 <211> 120 <212> DNA <213> (Sunshine) <400> 27 ggtggcaagt ggctcctgac ctggagtctt ccagtgtgat gatggtgagg atgggcctcc 60 ggttcatgcc gcccatgcag gaactgttac acatgtagtt gtagtggatg gtggtacagt 120 <210> 28 <211> 120 <212> DNA <213> (Sunshine) <400> 28 cctcctccca gagaccccag ttgcaaacca gacctcaggc ggctcatagg gcaccaccac 60 actatgtcga aaagtgtttc tgtcatccaa atactccaca cgcaaatttc cttccactcg 120 <210> 29 <211> 120 <212> DNA <213> (Artificial sequence) <400> 29 gtctctccag ccccagctgc tcaccatcgc tatctgagca gcgctcatgg tggggggcagc 60 gcctcacaac ctccgtcatg tgctgtgact gcttgtagat ggccatggcg cggacgcggg 120 <210> 30 <211> 120 <212> DNA <213> (Artificial sequence) <400> 30 ggttattctg atttcccatt cttttcttta cttaaatagg gcaagttcac tacagcaagt 60 gatgtgtggg cctttggggt tactttgtgg gagactttca ccttttgtca agaacagccc 120 <210> 31 <211> 120 <212> DNA <213> (Artificial sequence) <400> 31 gctggaggag ctagagcttg atgagcagca gcgaaagcgc cttgaggcctttcttaccca 60 gaagcagaag gtgggagaac tgaaggatga cgactttgag aagatcagtg agctgggggc 120 <210> 32 <211> 120 <212> DNA <213> (Artificial sequence) <400> 32 agtttgtggt ctgccagcta aaggtgaaga tatattcctc caattcagga cccacacgac 60 gggaagacaa gttcatgtac tttgagttcc ctcagccgtt acctgtgtgt ggtgatatca 120 <210> 33 <211> 120 <212> DNA <213> (Sunshine) <400> 33 ggcagccagg aacgtactgg tgaaaacacc gcagcatgtc aagatcacag attttgggcg 60 ggccaaactg ctgggtgcgg aagagaaaga ataccatgca gaaggaggca aagtaaggag 120 <210> 34 <211> 120 <212> DNA <213> (Sunshine) <400> 34 caacccccac gtgtgccgcc tgctgggcat ctgcctcacc tccaccgtgc agctcatcat 60 gcagctcatg cccttcggct gcctcctgga ctatgtccgg gaacacaaag acaatattgg 120 <210> 35 <211> 120 <212> DNA <213> (Sunshine) <400> 35 tctgtcatag ggactctgga tcccagaagg tgagaaagtt aaaattcccg tcgctatcaa 60 aacatctccg aaagccaaca aggaaatcct cgatgtgagt ttctgctttg ctgtgtgggg 120 <210> 36 <211> 120 <212> DNA <213> (Artificial sequence) <400> 36 tgcgaagcca cactgacgtg cctctccctc cctccaggaa gcctacgtga ttggccagcg 60 ggccagcgtg gacaaccccc acgtgtgccg cctgctgggc atctgcctca cctccaccgt 120 <210> 37 <211> 120 <212> DNA <213> (Artificial sequence) <400> 37 caaccaagct ctcttgagga tcttgaagga aactgaattc aaaaagatca aagtgctggc 60 ctccggtgcg ttcggcacgg tgtataaggt aaggtccctg gcacaggcct ctgggctggg 120 <210> 38 <211> 120 <212> DNA <213> (Artificial sequence) <400> 38 attcgtccac aaaatgattc tgaattagct gtatcgtcaa ggcactcttg cctacgccat 60 cagctccaac taccacaagt ttatattcag tcattttcag caggccttat aataaaaata 120 <210> 39 <211> 120 <212> DNA <213> (Artificial sequence) <400> 39 acacaaagaa agccctcccc agtcctcatg tactggtccc tcattgcact gtactcctcg 60 tgacctgctg tgtcgagaat atccaagaga caggtttctc catcaattac tacttgcttc 120 <210> 40 <211> 120 <212> DNA <213> (Artificial Sequence) <400> 40 tgattttgca gaaaacagat ctgtatttat ttcagtgtta cttacctgtc ttgtctttgt 60 tgatgtttca ataaaaggaa ttccataact tcttgctaag tcctgagcct gttttgtgtc 120 <210> 41 <211> 120 <212> DNA <213> (Artificial Sequence) <400> 41 tccacaaaat ggatccagac aactgttcaa actgatggga cccactccat cgagatttct 60 ctgtagctag accaaaatca cctattttta ctgtgaggtc ttcatgaaga aatatatctg 120 <210> 42 <211> 120 <212> DNA <213> (Artificial Sequence) <400> 42 ccacattaca tacttaccat gccactttcc cttgtagact gttccaaatg atccagatct 60 aattctttgt cccactgtaa tctgcccatc aggaatctcc caatcatcac tcgagtcccg 120 <210> 43 <211> 120 <212> DNA <213> (Artificial sequence) <400> 43 attcatctac aaagtggttc tggattagct ggattgtcag tgcgcttttc ccaacaccat 60 ctgctccaac caccaccagt ttgtactcag tcatttcaca ccagcaagaa cctgttggaa 120 <210> 44 <211> 120 <212> DNA <213> (Artificial sequence) <400> 44 acagaggaag ccttcgcctg tcctcatgta ttggtctctc atggcactgt actcttcttt 60 tccagctgta tccagtatgt ccaacaaaca ggtttcacca tctataacca cttgttttct 120 <210> 45 <211> 120 <212> DNA <213> (Artificial sequence) <400> 45 aaaatgacaa agaacagctc aaagcaattt ctacacgaga tcctctctct gaaatcacta 60 agcaggagaa agattttcta tggagtcaca ggtaagtgct aaaatggaga ttctctgttt 120 <210> 46 <211> 120 <212> DNA <213> (Artificial sequence) <400> 46 cttagataaa actgagcaag aggctttgga gtatttcatg aaacaaatga atgatgcacg 60 tcatggtggc tggacaacaa aaatggattg gatcttccac acaattaaac agcatgcatt 120 <210> 47 <211> 120 <212> DNA <213> (Sunshine) <400> 47 ccagggcatc tggatccctg atggggagaa tgtgaaaatt ccagtggcca tcaaagtgtc 60 gagggaaaac acatccccca aagccaacaa agaaatctta gacgtaagcc cctccaccct 120 <210> 48 <211> 120 <212> DNA <213> (Sunshine) <400> 48 cataccctct cagcgtaccc ttgtccccag gaagcatacg tgatggctat acgtgatggc 60 ggtgtgggct ccccatatgt ctcccgcctt ctgggcatct gcctgacatc cacggtgcag 120 <210> 49 <211> 120 <212> DNA <213> (Sunshine) <400> 49 cccaactaca gaaatggttt caaatgaatc tgtagactac cgagctactt ttccagaagt 60 tatatttcag tttattgttc tgagaaatac ctatacatat acctcagtgg gttgtgacat 120 <210> 50 <211> 120 <212> DNA <213> (Sunshine) <400> 50 cttctgtag gctggatgaa aaattcacag tcaaggttgc tgattttggt cttgccagaa 60 acatgtatga taaagaatac tatagtgtac acaacaaaac aggtgcaaag ctgccagtga 120 <210> 51 <211> 120 <212> DNA <213> (Sunshine) <400> 51 aatgaaggtg ccatcattct tgaggaggaa gtagcgtggc cgccaggtct tgatgtactt 60 ccctacagac gtgcgggtgg tgagagccac gcacactcta cccgtcagac cctcgccagg 120 <210> 52 <211> 120 <212> DNA <213> (Sunshine) <400> 52 tggatcccaa ctgcctaccg ttgccatccg ggctttacgc aaataagtaa gaaggtctct 60 tccctccatc agttccagga taatgtattg gggttcattc agcagacaaa ctccaagctg 120 <210> 53 <211> 120 <212> DNA <213> (Sunshine) <400> 53 cgggcgaggg cgggtctctc ggaggaagga cttgaggtct ccccccgcca tgagctccat 60 caggatgaac cggggcaggg attgcaggct caccccaatg cagcgaacaa tgttctggtg 120 <210> 54 <211> 120 <212> DNA <213> (Artificial Sequence) <400> 54 tgtggcttta cctgatgatc agggcttcca tgaggaaatc cagttcgtcc tgttcagagt 60 acacttcagg cagcgtctgg gcagagaagg ggagggtggg gaggaggagg aggctgtgag 120 <210> 55 <211> 120 <212> DNA <213> (Artificial Sequence) <400> 55 acacagatca gcgacaggat gacaggaaga gcacagtcac tttgactcac cggtggatgc 60 agtggttttc ctccaaatac tgacagccac aggcaatgtc ccgagccacg tgcagaaggt 120 <210> 56 <211> 120 <212> DNA <213> (Artificial Sequence) <400> 56 tcttcggcgt ctgcaccgag ggccgccccc tgctcatggt ctttgagtat atgcggcaca 60 gggacctcaa ccgcttcctc cggtaccagc acctggcctc agcgctggcc ccggcccctg 120 <210> 57 <211> 120 <212> DNA <213> (Artificial Sequence) <400> 57 ctggggtcag gtgcagggga agacaatcct tgcttacctg aggaacttat tcaggtctct 60 atgcttcatg tattcaaaga ccatgatgag ggggtcccca tcgccgcaca ctccatagaa 120 <210> 58 <211> 120 <212> DNA <213> (Sunshine) <400> 58 cttctttgcg gagattctct tcctctgtgc gccggtctct cccaggacag gcacaaacat 60 gcacctcaaa gctgttccgt cccagtagat taccactact caggatagga aaagagaagc 120 <210> 59 <211> 120 <212> DNA <213> (Sunshine) <400> 59 ggtggcaagt ggctcctgac ctggagtctt ccagtgtgat gatggtgagg atgggcctct 60 ggttcatgcc gcccatgcag gaactgttac acatgtagtt gtagtggatg gtggtacagt 120 <210> 60 <211> 120 <212> DNA <213> (Sunshine) <400> 60 cctcctccca gagaccccag ttgcaaacca gacctcaggc ggctcatagg gcaccaccat 60 actatgtcga aaagtgtttc tgtcatccaa atactccaca cgcaaatttc cttccactcg 120 <210> 61 <211> 120 <212> DNA <213> (Artificial sequence) <400> 61 gtctctccag ccccagctgc tcaccatcgc tatctgagca gcgctcatgg tggggggcagt 60 gcctcacaac ctccgtcatg tgctgtgact gcttgtagat ggccatggcg cggacgcggg 120 <210> 62 <211> 120 <212> DNA <213> (Artificial sequence) <400> 62 ggttattctg atttcccatt cttttcttta cttaaatagg gcaagttcac tacagcaaga 60 gatgtgtggg cctttggggt tactttgtgg gagactttca ccttttgtca agaacagccc 120 <210> 63 <211> 120 <212> DNA <213> (Artificial sequence) <400> 63 gctggaggag ctagagcttg atgagcagca gcgaaagcgc cttgaggcctttcttacccc 60 gaagcagaag gtgggagaac tgaaggatga cgactttgag aagatcagtg agctgggggc 120 <210> 64 <211> 120 <212> DNA <213> (Artificial sequence) <400> 64 agtttgtggt ctgccagcta aaggtgaaga tatattcctc caattcagga cccacacgat 60 gggaagacaa gttcatgtac tttgagttcc ctcagccgtt acctgtgtgt ggtgatatca 120

Claims

1. Use of a probe composition in the preparation of a liquid biopsy reagent, characterized in that: The probe composition is used to detect the variation of the target nucleic acid sequence relative to the non-target nucleic acid sequence in the liquid biopsy DNA sample, and the probe composition includes a blocking probe and a capture probe, wherein the capture probe is selected from one or more of the sequences shown in SEQ ID NO.1-32, the blocking probe is selected from one or more of the sequences shown in SEQ ID NO.33-64, and the capture probe is modified with biotin; The application is: The single strand formed after the denaturation of the liquid biopsy DNA sample is mixed with the probe composition for hybridization reaction, the target nucleic acid fragments in the DNA sample are captured, the captured target nucleic acid fragments are end-repaired and adapter-ligated, the adapter-ligated products are indexed PCR amplified, a second-generation sequencing library is constructed, and the library is sequenced at a sequencing depth of 1000X; The liquid biopsy DNA sample is cfDNA; the probe composition is used to detect mutations in genes EGFR, KRAS, BRAF, NRAS, PIK3CA, HER2, MET, AKT1, ROS1, ALK, NTRK1, NTRK3, TP53, DDR2, MAP2K1 or PTEN; When the capture probe is the sequence shown in SEQ ID NO.1, the blocking probe is the sequence shown in SEQ ID NO.33; When the capture probe is the sequence shown in SEQ ID NO.2, the blocking probe is the sequence shown in SEQ ID NO.34; When the capture probe is the sequence shown in SEQ ID NO.3, the blocking probe is the sequence shown in SEQ ID NO.35; When the capture probe is the sequence shown in SEQ ID NO.4, the blocking probe is the sequence shown in SEQ ID NO.36; When the capture probe is the sequence shown in SEQ ID NO.5, the blocking probe is the sequence shown in SEQ ID NO.37; When the capture probe is the sequence shown in SEQ ID NO.6, the blocking probe is the sequence shown in SEQ ID NO.38; When the capture probe is the sequence shown in SEQ ID NO.7, the blocking probe is the sequence shown in SEQ ID NO.39; When the capture probe is the sequence shown in SEQ ID NO.8, the blocking probe is the sequence shown in SEQ ID NO.40; When the capture probe is the sequence shown in SEQ ID NO.9, the blocking probe is the sequence shown in SEQ ID NO.41; When the capture probe is the sequence shown in SEQ ID NO.10, the blocking probe is the sequence shown in SEQ ID NO.42; When the capture probe is the sequence shown in SEQ ID NO.11, the blocking probe is the sequence shown in SEQ ID NO.43; When the capture probe is the sequence shown in SEQ ID NO.12, the blocking probe is the sequence shown in SEQ ID NO.44; When the capture probe is the sequence shown in SEQ ID NO.13, the blocking probe is the sequence shown in SEQ ID NO.45; When the capture probe is the sequence shown in SEQ ID NO.14, the blocking probe is the sequence shown in SEQ ID NO.46; When the capture probe is the sequence shown in SEQ ID NO.15, the blocking probe is the sequence shown in SEQ ID NO.47; When the capture probe is the sequence shown in SEQ ID NO.16, the blocking probe is the sequence shown in SEQ ID NO.48; When the capture probe is the sequence shown in SEQ ID NO.17, the blocking probe is the sequence shown in SEQ ID NO.49; When the capture probe is the sequence shown in SEQ ID NO.18, the blocking probe is the sequence shown in SEQ ID NO.50; When the capture probe is the sequence shown in SEQ ID NO.19, the blocking probe is the sequence shown in SEQ ID NO.51; When the capture probe is the sequence shown in SEQ ID NO.20, the blocking probe is the sequence shown in SEQ ID NO.52; When the capture probe is the sequence shown in SEQ ID NO.21, the blocking probe is the sequence shown in SEQ ID NO.53; When the capture probe is the sequence shown in SEQ ID NO.22, the blocking probe is the sequence shown in SEQ ID NO.54; When the capture probe is the sequence shown in SEQ ID NO.23, the blocking probe is the sequence shown in SEQ ID NO.55; When the capture probe is the sequence shown in SEQ ID NO.24, the blocking probe is the sequence shown in SEQ ID NO.56; When the capture probe is the sequence shown in SEQ ID NO.25, the blocking probe is the sequence shown in SEQ ID NO.57; When the capture probe is the sequence shown in SEQ ID NO.26, the blocking probe is the sequence shown in SEQ ID NO.58; When the capture probe is the sequence shown in SEQ ID NO.27, the blocking probe is the sequence shown in SEQ ID NO.59; When the capture probe is the sequence shown in SEQ ID NO.28, the blocking probe is the sequence shown in SEQ ID NO.60; When the capture probe is the sequence shown in SEQ ID NO.29, the blocking probe is the sequence shown in SEQ ID NO.61; When the capture probe is the sequence shown in SEQ ID NO.30, the blocking probe is the sequence shown in SEQ ID NO.62; When the capture probe is the sequence shown in SEQ ID NO.31, the blocking probe is the sequence shown in SEQ ID NO.63; When the capture probe is the sequence shown in SEQ ID NO.32, the blocking probe is the sequence shown in SEQ ID NO.

64.

2. The use according to claim 1, characterized in that: The liquid biopsy DNA sample comes from at least one of plasma, serum, blood, urine, sweat, saliva, semen, pleural effusion, ascites, feces, puncture specimen and paraffin-embedded tissue section specimen.

3. The use according to claim 1, characterized in that: The hybridization reaction system also includes a hybridization enhancer.

4. The use according to claim 1, characterized in that: The capture comprises the steps of incubating the hybridization product obtained by the hybridization reaction with magnetic beads modified with streptavidin and then separating them.

Images