Detergent-free simultaneous multi-omics sample preparation method using a novel pouch design

Abstract

The present invention provides a two-piece assembly for continuous through-matrix processing of solutions and / or solids, the assembly having an inner vial that holds and contains the matrix and an outer vial configured to receive the inner vial in an upper or lower parking position to allow or prevent the solution from passing through the matrix of the upper vial, respectively. The captured molecules can be treated in situ in the matrix with enzymes and / or chemicals without the need for the use of strong chaotropic agents such as urea or detergents such as SDS.

Description

[0001] Related Applications

[0002] This application claims priority to U.S. Provisional Application Serial No. 62 / 894,201, filed on August 30, 2019. The entire contents of the foregoing application are incorporated herein by reference. Technical Field

[0003] The present application relates to methods and devices for preparing samples containing proteins and / or small molecules and / or DNA / RNA. Background Art

[0004] The combination of omics technologies and techniques is becoming more and more popular and has promoted our understanding of biological systems and human pathology. However, the integration of analysis across omics platforms brings new technical challenges. Parallel sample processing is a potential solution, in which samples are separated and partially processed for different molecular categories (such as proteins and metabolites). However, when the sample amount is limited, as is often the case with clinical materials, or when there is heterogeneity, such as in different tissue sections, it is essential to use simultaneous extraction methods for several molecular categories, however, such methods have been lacking. The only available methods are based on phase separation, such as chloroform-methanol extraction, and are limited by their complexity and laboriousness. They are not practical for the implementation of small sample amounts or high-throughput analysis.

[0005] In chemistry, biochemistry, and clinical and research settings, samples are often required to be processed, such as, but not limited to, chemical or enzymatic reactions, or precipitation or coagulation steps, before the sample is subjected to subsequent steps, which may include filtration, capture, clarification, chromatography, or multiple other processes, all of which require the sample to flow through some type of matrix that is suitable for the process of interest, such as, but not limited to, filtration, capture, clarification, enrichment, or chromatography. Simultaneous Trapping (SiTrap) at least facilitates direct measurement of the proteome and metabolome in the same sample extract. SiTrap represents a method and system for sample preparation and separation on a depth filter to separate organisms into two or many classes of biological parts. SiTrap can be detergent-free and can be extended to nucleic acid polymers (DNA and RNA) as well as lipids, glycans, and other molecular classes. A new type of capsule can achieve maximum SiTrap functionality and improve processing speed and convenience.

[0006] Each processing step typically requires time, i.e., incubation, and the steps are typically sequential, such as precipitation or depletion or enzymatic or chemical reaction followed by some type of chromatography or enrichment or affinity or enzymatic treatment. Such processing is most commonly accomplished by the following steps: performing the reaction in one tube or pouch or container, transferring the contents of the reaction (which may include any precipitants or solid materials (or not, depending)) into some matrix, such as, but not limited to, a filter or porous material or various forms of chromatographic columns (tubular columns, pipette tips, sheets, membranes, centrifugal columns or filters, gravity flow columns, solid phase extraction [SPE] columns, etc.), and then flowing the contents into a second tube or pouch or container. It should be noted that these matrices can be sequential, depending on the needs of the existing system, for example, a filter can be placed before the chromatographic tubular column to prevent clogging.

[0007] After processing on or through a matrix, (1) the flow-through that passes through the matrix, (2) the retentate that does not enter the matrix, or (3) some combination of material bound on, to, or within the matrix is ​​used for further study or analysis; one or more desired and undesired fractions vary depending entirely on the processing performed.

[0008] After any portion of the sample has passed through the matrix, the matrix and / or the retentate are typically further processed such as by washing, chemical or enzymatic treatment, affinity, elution, etc. Depending on the workflow, a treatment that requires time, i.e., one or more incubations, may be applied to the matrix or the retentate, or both. This incubation may be performed at a temperature below or above ambient temperature. Depending on the task at hand, this incubation may also involve the introduction of electromagnetic radiation in the form of light or microwaves or radio waves or ultrasonic energy.

[0009] Because the processing steps (including but not limited to chemical or enzymatic reactions or precipitation or other reactions that cause phase changes) require incubation time, the output side of the matrix must be blocked or blocked in some way to prevent liquid from flowing through the matrix, so that the necessary amount of time can be provided for the process that occurs on or in or on the top of the matrix. In the above example, if the proteinase K solution will drip through, it will not act on the tissue; if the HRP solution will flow through, the ELISA reaction will not occur; and if the biotin elution solution will flow through, elution will not occur. Similarly, if a solution containing salts or other soluble parts flows through, the desired concentration reduction will not occur, and for biopolymers, if incubation is required to achieve phase change, the biopolymer will enter the sample through the matrix, which is considered to be clear of biopolymers to prevent blockage later. In a possible second (or more than second) incubation, if the listed enzymes flow through, they will not process any biomolecules on or in or in or on the top of the matrix, resulting in failure. Therefore, in this treatment, blocking the output side of the matrix is ​​necessary to provide enough time for treatment.

[0010] This requirement to plug or block flow through the matrix can lead to several negative issues. First, plugging is not only annoying, but can also add a significant amount of additional experimental time, especially when processing a large number of samples. The use of the matrix and plugging is usually carried out in the following sequence: 1) Apply the sample to the matrix, perhaps in a spin column (but other formats are certainly possible); 2) Pass the flow-through through the matrix or centrifuge at a positive pressure on the input side of the matrix or at a negative pressure on the output side; 3) Lift the spin column containing the matrix; 4) Plug the column or other bladder that holds the matrix; 5) Close the previous container that held the flow-through; 6) Place the now plugged column in a new tube or container; 7) Open the spin column so that other processing solutions can be added, which may be (but not limited to) an enzyme solution that acts on and in and on the top of the matrix; 8) Recap the column; 9) Incubate the column and matrix at the necessary temperature and for the necessary time; 10) Remove the spin column from the new tube; 11) Remove the column directly above the new tube. 14) possibly eluting or washing the matrix from the matrix, depending on the needs of the system and the nature of the matrix; and 15) repeating this process, using a new tube each time if additional incubations are to be performed, such as first recovering the nucleic acids, then enzymatically treating with glycosidases, then chemically treating with reducing and alkylating agents, and many other possible treatments (e.g., citraconic anhydride or hydroxylamine or NHS or isothiocyanates or many other chemicals and chemical treatments), then washing these reagents away, followed by treating the proteins bound in and on and in and on top of the matrix with proteases. Needless to say, this becomes very tricky for large numbers of samples.

[0011] In addition to the cumbersome nature of stoppers, they can leak, lose sample, and lead to failure. In fact, because the matrix and its pockets are located inside the tube, they cannot be directly seen, so the presence of a leak is often not detected until processing or the experiment is completed. Stoppers can also fall out during removal, also resulting in sample loss due to the inability to recover the sample from the matrix.

[0012] Blockage introduces additional experimental error, as the duration of blockage can be variable and affect the results: some samples may drip more, or samples may have longer or shorter incubation times depending on when they are blocked and unblocked. In fact, due to the nature of the process, the first sample to be blocked in a series will be blocked for a longer period of time than the last sample to receive a blockage, subjecting the samples to additional and undesirable experimental variation.

[0013] Blockages can also cause problems when it is necessary to capture all the material flowing into or out of or near or through the matrix. In fact, especially for small volumes, the stopper itself can retain a large amount of the material that is desired to be obtained by the work. This is especially true if the stopper is a female stopper and covers the end of a nozzle or a flow guide or a connector or a Luer lock: the action of removing the stopper creates a vacuum that fills the stopper with material, which, depending on the process, may be desirable and expensive. In this case, the sample must be sucked back into the pouch on top of the matrix, if possible. This loss of sample can also occur if the stopper is a male stopper: when the stopper is inserted inside the connection on the flow side behind the matrix, the action of removing the stopper creates the same suction, causing the sample to flow out and possibly be lost. To solve this situation, a capture tube can be placed under the connector that has fallen off the matrix, the stopper can be carefully removed and any sample that drips out can be tried. In summary, blockage is an error-prone process that requires a lot of time. Finally, the use of stoppers requires a lot of manual manipulation of the pouch containing the matrix. This manipulation is difficult to translate into automation.

[0014] Therefore, there is a need for an apparatus, method and process that: provides support for one or more matrices that can be used in succession or stacked; provides space before the matrix to which sample can be added and space after the matrix to accommodate the portion of the sample that has passed through the matrix; easily starts and stops the flow through the matrix with minimal manipulation and, importantly, without loosening the stopper; allows easy use of multiple sequential treatments, including treatments on or in the matrix; allows easy introduction of heat or electromagnetic radiation, such as light or sound energy, such as sonication; limits the possibility of treatment failure due to dripping or lack of seal. Summary of the invention

[0015] In one aspect, the present application provides a method for preparing a sample containing one or more fractions of a molecule of interest, the method comprising: exposing the sample to an extraction solvent, wherein the extraction solvent may be substantially neutral, alkaline or acidic, and wherein the extraction solvent may be detergent-free or contain a detergent or a surfactant; exposing the sample and the extraction solvent combination to physical destruction, such as bead beating, sonication or ultrasonic treatment. Preferably, but not mandatory, sonication and ultrasonic treatment are used; in the case of extracting the sample with an alkaline extraction solvent, neutralizing the alkaline extraction solvent with an acid to bring the pH value close to neutral.

[0016] In certain embodiments, where an acidic extraction solvent is used to extract the sample, the acidic extraction solvent is neutralized with a base to bring the pH close to neutral; the sample and the extraction solvent combination are exposed to a molecular coagulant that facilitates the binding of especially larger molecules to a matrix, preferably a porous matrix, or a collection of small particles that can be manipulated and / or retained, wherein the coagulant may consist of a single-phase or multi-phase solution; during the (macro)molecule coagulation step, the sample and the macromolecular coagulant combination are contacted with a matrix suitable for capturing the macromolecules in the presence of the coagulant, and most preferably a matrix that prevents excessive aggregation of the coagulated macromolecules, so that the flow through the matrix is ​​unimpeded; smaller uncondensed and unbound molecules are collected into removable pouches, wherein the class of smaller uncondensed molecules collected depends on the selection and use of the macromolecular coagulant; typically, although not mandatory, the matrix and captured macromolecules are washed to clean them; if the extraction solvent contains a surfactant or detergent, such a step is not optional and such a step is typically always performed after chemical manipulations such as reduction and alkylation; most preferably, different classes of condensed captured molecules are eluted from the capture matrix into removable pouches, wherein the extraction solvent is selected to match the solubility of the captured molecules.

[0017] In certain embodiments, nucleic acids and polynucleic acids, such as DNA and RNA, or free polysaccharides and other types of molecules are water-soluble and can be eluted by passing an aqueous buffer through the capture matrix into a new removable pocket. Similarly, some lipids and some hydrophobic peptides are soluble in organic solvents, such as alcohols, which are merely illustrative examples. Optionally, during this step, physical and / or thermal energy can be added, such as by oscillation or sonication or ultrasound treatment or heating or microwaves or other techniques obvious to those skilled in the art. It should be clearly pointed out that elution can be performed continuously using different elution solvents. For example, the captured DNA and RNA can be eluted with an aqueous buffer, and then the captured lipids can be eluted with an organic extraction solvent, the selection of which depends on the solubility properties of the molecular class of interest; most preferably, before or after the above-mentioned elution of the captured condensed macromolecular class on the capture matrix, the captured molecules are treated with enzymes or chemicals, such as nucleases, proteases, glycosidases, lipases or cyanogen bromide cleavage of proteins, and other enzymes and chemicals that change the state of the condensed macromolecules to facilitate additional downstream processing.

[0018] In certain embodiments, specific classes of molecules can be released from larger molecules and / or processed into smaller molecules, typically with different solubility properties. Such steps can be performed before or after the elution step, and it will be apparent to those skilled in the art that there is great flexibility in sample processing that can produce similar results.

[0019] In embodiments of the present application, exemplary classes of molecules that can be fractionated and / or prepared include amino acids, nucleosides, nucleotides, oligonucleotides, nucleic acids, sugars, carbohydrates, oligosaccharides, polysaccharides, fatty acids, lipids, hormones, metabolites, heterocyclic aromatic compounds, carcinogens, mutagens, compounds of the exposure group such as plasticizers, pesticides, release agents and / or flame retardants, etc., peptides, metabolites, cofactors, inhibitors, drugs, agents, nutrients, vitamins, polypeptides, proteins, glycoproteins, lipoproteins, antibodies, growth factors, cytokines, chemokines, receptors, neurotransmitters, antigens, prions, allergens, antibodies, substrates, biohazardous substances, infectious substances including viruses, protozoa, bacteria and fungi, and waste.

[0020] In certain embodiments, the sample can first be captured on the matrix and then optionally treated with nucleases to form smaller DNA and RNA molecules, which can be eluted and fractionated by adding aqueous buffers, the captured lipids can then be extracted with organic solvents such as ethanol, hexane, methanol, ether or chloroform, alone or in combination, the captured proteins can then be treated in or on the matrix matrix, for example by glycosidases, and the released glycosidases can be eluted with another aqueous eluent, the proteins can then be reduced and alkylated in situ within the capture matrix, they can then be treated with proteases such as trypsin, or by chemical means such as cyanogen bromide or acid degradation or shearing by strong acoustic forces, and the peptides obtained from the captured proteins can be captured in separate fractions.

[0021] In certain embodiments, small molecules such as metabolites are obtained in the first flow-through fraction, the lipid fraction, the nucleic acid fraction, the glycan fraction, and the peptide fraction, all of which are amenable to analysis by mass spectrometry or other detection techniques. Such enzymatic or chemical reactions or elutions can be accelerated by the addition of physical and / or thermal energy, such as by shaking or sonication or ultrasound or heating or microwaves or other techniques apparent to those skilled in the art.

[0022] In certain embodiments, the well can allow molecules or molecular fragments to pass appropriately through one or more secondary matrices, wherein the one or more matrices can provide chromatographic separation or enrichment of various classes or subclasses of molecules.

[0023] In certain aspects, the present application is a method, system and apparatus for preparing samples containing various classes of biomolecules, such as (but not limited to) DNA, RNA, proteins, glycans, small molecules, lipids and other metabolites, as well as small molecules that can be used for mass spectrometry analysis such as LC-MS / MS without solubilization with surfactants.

[0024] In certain aspects, the present application is a method, system and apparatus for preparing a sample containing multiple molecular classes for multi-omics analysis. To date, such attempts have generally involved cell lysis and protein extraction and have failed to produce multiple molecular classes from a single sample. A suitable lysis medium includes 30 mM ammonium acetate. Another suitable lysis medium is 1.8% ammonium hydroxide. Another is 1 M HCl.

[0025] In certain embodiments, the method includes a step of in situ reduction and simultaneous alkylation of disulfide bonds of proteins on a capture matrix. This is achieved by heating the sample at 80° C. in 60 mM triethylammonium bicarbonate (TEAB), 10 mM tris(2-carboxyethyl)phosphine (TCEP), 25 mM chloroacetamide (CAA). Other suitable reagents may be used. The use of such reagents prevents the formation of disulfide bonds between cysteine ​​residues, especially the formation of disulfide bonds of different peptides.

[0026] In certain embodiments, centrifugation is performed to drive various media, reagents, buffers, etc., as needed, through the matrix(ies).

[0027] In certain embodiments, pumps and the like may be used to move various media, reagents, buffers, and the like through the matrix(ies) of the present application.

[0028] In certain aspects, the present application provides a sample preparation device for molecules extracted in a liquid medium, the device comprising a vessel having an inlet and an outlet, a matrix disposed between the inlet and the outlet, the matrix being suitable for capturing and retaining particles of molecules of interest from the medium as they flow from the inlet to the outlet.

[0029] In certain embodiments, the matrix is ​​formed from a depth filter material.

[0030] In certain embodiments, the matrix extends across the entire cavity of the vessel such that any flow from the inlet to the outlet must pass through at least a portion of the matrix.

[0031] In one aspect, the present application provides a new multi-part pouch that can accelerate the digestion or solubilization of intact proteins, minimize the number of transfer steps, and provide rapid use. This new pouch first provides the ability to flow through as described herein. It also provides the ability to seal the inner vial in the outer vial, and acoustic energy and heat can be transferred from the outside to the inside. It also provides that the flow through the matrix is ​​most preferably uniform and unidirectional. The inner vial can be sealed on the outer vial, so that a solution can be added to the inner vial, the solution can act on the matrix, and such a solution can penetrate into the matrix by capillary action and centrifugation. The inner vial can then be lifted so that there is space between the inner vial and the outer vial, so that the solution initially added can be centrifuged into the outer vial. Then, the outer vial becomes a container for accommodating the omics sample to be analyzed.

[0032] In one aspect of the present application, a two-piece assembly for continuous processing of solutions and / or solids through a matrix is ​​provided, the assembly having an inner vial for maintaining and containing the matrix and an outer vial configured to receive the inner vial in an upper or lower parking position to allow or prevent the solution from passing through the matrix of the upper vial, respectively. The ability of the outer vial to reversibly seal the inner vial avoids the need for a stopper and eliminates the loss of the sample on the stopper. The inner vial has an inner chamber that receives a sample that may contain solids and liquids, and the solid may be formed by the liquid by processing. The outer vial has an inner chamber that can alternately seal the inner vial in a lower parking position, or receive a sample that flows from the inner vial through the matrix into a receiving space of the outer vial in an upper parking position. The tops of the inner and outer vials have openings, and are both provided with caps or covers to protect the sample and seal the sample space. The inner vial cap additionally has a vent to allow gases to escape in the event of heating, and the inner vial bottom has an opening to allow flow through the substrate it supports. In a preferred embodiment, the inner vial and the outer vial are substantially cylindrical. The inner vial and the outer vial have a locking or parking or support system so that the inner vial can be supported in a lower or upper parking position. In a preferred embodiment, the support system consists of ridges and U-shaped stops; those skilled in the art will recognize that many other embodiments are possible, as long as the upper and lower positions can be maintained. The inner vial supports the substrate at its lower portion.

[0033] In certain embodiments, in the upper parking position, the outer vial is configured to receive a sample placed in the sample holding space of the upper vial, and when the upper vial is in the upper parking position, the sample flows from the upper vial through the matrix supported by the inner vial, through the opening at the bottom of the lower vial.

[0034] In certain embodiments, in the lower parking position, the outer vial is configured to seal the inner vial and block flow-through through the matrix to allow incubation of the contents of the inner vial while also reducing the dead volume of the solution in the inner vial. In the lower parking position, the inner and outer vials can be centrifuged to expel any air in the matrix and allow solutions to fully contact the matrix, such as, but not limited to, solutions containing enzymes or chemicals, to allow them to act on materials and molecules held within or on top of the matrix.

[0035] In one aspect of the present application, a kit is provided, comprising the inner vial and the outer vial, wherein the inner vial contains a matrix to meet the needs of the desired sample processing, and optionally any reagents or solutions or materials for implementing the steps of the kit.

[0036] In one aspect of the present application, a sample processing method is provided, the method comprising passing a solution having a solvent, which may be of interest, soluble contaminants, and insoluble solid components through a matrix of the present application, so that soluble materials that have no affinity for the matrix pass through the outer vial, materials bound to the matrix are retained, and any insoluble materials are retained in or on the matrix.

[0037] In one aspect of the present application, a method for sample processing is provided, the method comprising solubilizing some desired components of a sample, such as biomolecules, including metabolites, lipids, proteins, nucleic acids, polysaccharides and proteins; capturing or trapping or separating some fractions of molecules of interest, such as biopolymers, usually and not only by adding coagulants, including mild precipitants, such as but not limited to a variety of organic solvents, possibly by inducing a phase change or coagulation or binding of the molecules, and in all cases causing retention of the molecules of interest, which can then be captured in or on or on top of or within the matrix, or by providing an affinity for the molecules of interest to the matrix. After separating the sample fractions that are not captured or retained by the matrix, the retained molecules can be subjected to extensive treatment, including chemical and / or enzymatic and / or chromatographic treatments, which result in the release of the desired components of the retention material, which can then be eluted. The sample can be driven through the matrix by positive pressure on the input side of the matrix or negative pressure on the output side or centrifugation. BRIEF DESCRIPTION OF THE DRAWINGS

[0038] Figure 1 Proteins captured and digested from nonionic detergent lysates are shown. Figure 1 A Protein capture in cellulose depth filter tips. 3% octylglucoside (OG) and 3% poloxamer 407 (P407) lysate was prepared from MDA-MB-231 cells in 30 mM ammonium acetate by sonication on ice. Lysate was either loaded immediately into the tip or diluted with an equal volume of methanol in 30 mM ammonium acetate (final methanol concentration – 50%). Captured proteins were eluted with 2X Laemmli buffer. Figure 1 B SiTrap type in-tip digestion of MDA-MB-231 cell lysate prepared with 3% octylglucoside. Capture tips are made of quartz or cellulose material. Digestion is performed according to the SiTrap protocol. Digestion products are eluted with 2X Laemmli buffer. Samples are analyzed on NuPAGE 4-12% Bis-Tris protein gels. Block flow diagram of the general method for denaturing biochemical reagents using an activated cleaning solution mist.

[0039] Figure 2MDA MB 231 cells were lysed by probe sonication on ice using 30 mM ammonium acetate (AA), 1.8% ammonium hydroxide (AH), or 3% SDS in 30 mM ammonium acetate (SDS). The lysates were centrifuged at 11,000 x g for 2 min to remove debris. For AA and SDS lysates, 4 volumes of methanol in 30 mM acetate were added to the sample; for AH lysates, an equal volume of 1 M acetic acid was added to the sample, followed by 2 volumes of methanol. The proteins were then captured in a cellulose depth filter and then eluted with 2X Laemmli buffer before running on a NuPAGE 4-12% Bis-Tris protein gel.

[0040] Figure 3 SiTrap processing of cellular material is shown. Figure 3 A Basic protocol. Cell pellets are sonicated or otherwise physically disrupted and / or heated in the presence of an excess of 30 mM ammonium acetate (AA) or 1.8% ammonium hydroxide (AH). For AA extraction, four volumes of methanol in 30 mM AA are added to the lysate. For AH extraction, an equal volume of 1 M acetic acid is added to the lysate, followed by two volumes of methanol. The resulting mixture is loaded into a SiTrap unit (1), proteins are captured in a depth filter trap, and the flow-through is collected (2, 3). After washing with 50% methanol, proteins are denatured, reduced, and alkylated in situ by heating at 80°C in a solution of 60 mM triethylammonium bicarbonate (TEAB), 10 mM tris(2-carboxyethyl)phosphine (TCEP), 25 mM chloroacetamide (CAA) (4). After washing (5), enzymes are introduced to the captured proteins (6). After digestion, peptides are eluted from the SiTrap tips (7). Peptides are concentrated from Stage tips for downstream analysis by mass spectrometry. Figure 3 B- Figure 3 D Proteomic comparison of SiTrap ammonium hydroxide (AH), SiTrap ammonium acetate (AA), and standard SDS-based digests of MDA-MB-231 cells. Figure 3 B Boxplot of the number of proteins identified (at least two peptides were required for protein identification). Figure 3 C Distribution of proteins in the major GO cell component categories. Figure 3 D shows a Venn diagram of the distribution of the number of proteins identified with at least two peptides for each of the three sample preparation methods.

[0041] Figure 4 Digestion of cell lysate by SiTrap using cellulose tips is shown. MDA-MB-231 cells were incubated with 30 mM ammonium acetate (AA) Figure 4 A or 1.8% ammonium hydroxide (AH) Figure 4 B was lysed by probe sonication on ice. 30 μg of lysate was loaded into SiTrap tips according to the protocol and flow-through was collected (FT1). The captured proteins were reduced and alkylated in situ with 10 mM TCEP and 25 mM chloroacetamide in 60 mM TEAB at 80°C (FT2) for 30 min, digested with trypsin at 47°C for 45 min and eluted with 2X Laemmli buffer. The samples were run on NuPAGE 4-12% Bis-Tris protein gels.

[0042] Figure 5 Volcano plot significance analysis of metabolomics and proteomics analysis data of normal and tumor kidney sections is shown. The significance cutoff for the false discovery rate (FDR) was set to 0.05. Figure 5 A The results of metabolomics analysis showed that short-chain acylcarnitines (C5, C5:1, and C3) and polyunsaturated free fatty acids (C20:5, C20:4, C22:6) were reduced in tumor samples. Figure 5 B The results of proteomic analysis showed that the enzymes in the carnitine pathway, carnitine O-acetyltransferase (CRAT), carnitine O-palmitoyltransferase 2 (CPT2) and carnitine O-palmitoyltransferase 1 (CPT1A) were down-regulated in tumor samples. The enzymes in the polyunsaturated fatty acid pathway, acyl-CoA thioesterase 1 (ACOT1) and long-chain fatty acid CoA ligase (ACSL1) were also observed to be down-regulated in tumor samples.

[0043] Figure 6 SiTrap proteomic and metabolomic analysis of renal tumors identified dysfunctional acylcarnitine (AC) metabolism. Figure 6 A Metabolomic analysis identified a decrease in short-chain acylcarnitines (C5, C5:1, and C3) in tumor samples. The Y axis represents relative concentrations centered around the mean. Figure 6 B Proteomic analysis showed that carnitine O-acetyltransferase (CRAT), carnitine O-palmitoyltransferase 2 (CPT2), and carnitine O-palmitoyltransferase 1 (CPT1A) were downregulated in tumor samples. The Y axis represents the label-free quantification (LFQ) intensity value.

[0044] Figure 7 Shown is 0.5 μl of human serum from healthy volunteers digested directly by SiTrap technology (6 replicates in total) or diluted with 20 mM TEAB buffer and processed by fractionation using SiTrap quartz tips. SiTrap treatment produces two fractions, capture and flow-through (3 replicates each, 6 samples in total). MS results of trypsin digestion of 6 samples in each method are combined.

[0045] Figure 8 Show that human kidney FFPE tissue is dewaxed by standard xylene / ethanol treatment and then cracked in 30mM ammonium acetate by probe sonication. Approximately 50 μg of the resulting protein lysate is processed by SiTrap or SDS method. SDS in the sample is removed by standard protocol and flow-through (FT) is collected. Similar to SiTrap, the protein is digested by two consecutive digestions of 1.25 μg trypsin (Promega) (trypsin concentration 0.07 μg / μl) in 100mM ammonium bicarbonate at 48C for 1 hour. The digestion product is eluted continuously with 50% acetonitrile in 500mM ammonium bicarbonate and 0.2% formic acid. The remaining material is eluted with 2X Laemmli buffer.

[0046] Fig. 9 A schematic diagram showing the use of the assembly is shown. Fig. 9 In A, the matrix 117 is contacted with the solution 120, which is first applied to the inner sample holding space of the inner vial, perhaps for a treatment requiring incubation, with the inner and outer vials in their lowered parked positions. Fig. 9 In B, the inner vial has been moved to the upper parking position and the solution 124 has passed through the matrix 117. Depending on the matrix, it may have molecules bound to it or material that may not be able to pass through the matrix (matrix retained material 123). Fig. 9 In C, treatment solution 127 has been applied to act on materials bound or retained in or on or through the matrix 117 as well as any materials that may not enter the matrix. Fig. 9 C, the nested assembly is exposed and its lower region 273 is exposed to heat or acoustic energy, such as ultrasound or light or electromagnetic radiation, such as microwaves, to accelerate or promote the reaction, the details of which depend entirely on the experimental system. After the treatment is completed, as Fig. 9 D, the vials are moved to their upper parking position; in this view, the inner vial's stopper 153 and the outer vial's support mechanism 174 are not visible. The solution that has acted on the matrix and its retentate 125 is pushed through the matrix 117 by positive or negative pressure or by centrifugation to transfer the now processed sample 126 to the bottom of the outer vial in its sample collection area. After the process is completed, the sample is ready for storage or further analysis, such as Fig. 9 As shown in E.

[0047] Fig.10 The complete assembly of the inner vial is shown, which rotates to engage the locking mechanisms of the inner and outer vials, three of which in this embodiment hold the inner vial in an upper parked position within the outer vial, and how the sample in the inner space of the inner vial flows through the matrix supported by the inner vial to the receiving space of the outer vial.

[0048] Fig.11is another view of the inner and outer vial assemblies showing the other side of the assemblies with the two locking mechanisms engaged to maintain the upper parked position.

[0049] Fig.12 The inner and outer vials are shown assembled in a lower parked position, with the inner vial sealed relative to the outer vial to transfer externally applied treatments and seal the inner vial while a pin is used to eliminate dead space for output of the inner vial.

[0050] Fig.13 Both sides of the inner vial are shown.

[0051] Fig.14 is a cross-sectional view of the lower parking position of the nested inner and outer vials, showing the location of the matrix, the pins for removing dead volume and the sample collection area, and the tight interface between the inner and outer vials through the entire lower area of ​​the inner and outer vials.

[0052] Fig.15 An embodiment of an application arranged in a 96-well plate format is shown wherein the inner plate supporting the matrix of the inner vials is in a lowered parked position with the outer plate and held in place by a movable hinged tongue stop; the array is unchanged in terms of the seal and handling transfer capabilities between the inner and outer vials / plates.

[0053] Fig.16 An embodiment of an application arranged in a 96-well plate format is shown, wherein an inner plate supporting a matrix of inner vials is supported in an upper parked position by a movable hinged tongue stop to allow the contents of the inner plate to flow through the matrix of the wells of the inner plate to reach the sample collection area of ​​the outer plate.

[0054] Fig.17 An embodiment of a locking mechanism for establishing a lower and an upper parking position is shown, the locking mechanism consisting of a post with corresponding notches providing these two positions.

[0055] Fig.18 An embodiment of a locking mechanism for establishing two positions is shown that will allow or inhibit flow through the matrix via a side release design where the outer vial seals or does not seal the inner vial depending on the rotational position.A snap fit locking mechanism can provide a seal.

[0056] Fig.19 An embodiment of a locking mechanism for establishing lower and upper parking positions is shown, the locking mechanism consisting of a buckle that holds the inner vial at various vertical heights within the outer vial.

[0057] Fig. 20An embodiment of a locking mechanism for establishing lower and upper parking positions is shown, the locking mechanism consisting of a plurality of thin or thick ridges that retain the inner vial at various vertical heights within the outer vial.

[0058] Fig.21 and Fig. 20 Similarly, possible embodiments of a locking mechanism are shown for establishing lower and upper parking positions consisting of multiple ridges to hold an inner vial at various vertical heights within an outer vial, but with the added advantage of release wherein the ridges are disengaged by rotation into a gap lacking interlocking ridges.

[0059] Fig. 22 A possible embodiment of a locking mechanism for establishing lower and upper parking positions consisting of a coarse thread is shown, wherein the inner vial is tightened to seal or loosened to allow flow from the inner vial to the outer vial.

[0060] Fig.23 Various transformations of the SARS-CoV-2 nucleoprotein peptide WYFYYLGTGPEAGLPYGANK are shown.

[0061] Fig.24 Various transformations of the SARS-CoV-2 nucleoprotein peptide DGIIWVATEGALNTPK are shown.

[0062] Fig.25 Reversible SiTrap capture and release of RNA from detergent-containing and detergent-free conditions was demonstrated.

[0063] Component Legend

[0064] 101 inner vial

[0065] 109 external vial

[0066] 111 Inner and outer vials are assembled in the lower parking position to hold and process the solution in the inner vial space 122 and / or the material on or on top of or in or within the matrix 117

[0067] The inner vial 113 and the outer vial are assembled in the upper parking position so that the solution passes from the space 122 of the inner vial through the matrix 117 to the sample receiving space 222 of the outer vial.

[0068] 115 Inner and outer panel assemblies including means for supporting an upper parking position and a lower parking position.

[0069] 117 The matrix is ​​held in place by the inner vial

[0070] 120 Samples were first added to the inner vial in the park position before processing.

[0071] 122 Space within the inner vial for containing a sample including a solid and / or liquid sample and / or a processing reagent in an upper or lower parking position

[0072] 123 Materials that may be retained by the matrix

[0073] 124 may be an initial flow-through fraction lacking coagulated material, having had certain substances depleted by affinity for matrix 117, may contain no insoluble material, and the like.

[0074] 125 The treated solution when passed through the matrix of the inner vial, said matrix having acted on the material retained or bound in or on or by the matrix

[0075] 126 The processed solution has been passed through the inner vial matrix

[0076] 127 is a treatment solution applied to act on the material (such as 123) retained by or in the substrate 117 and / or any material thereon

[0077] 129 The opening of the inner vial, whose surface interfaces with the rib sealing mechanism 248

[0078] 137 Vent port of inner bottle cap

[0079] 145D pin, which is constructed to plug the inner vial and remove the dead space from the inner vial output to the bottom of the matrix

[0080] The locking / stopping / stopping member / supporting mechanism of the inner vial 153 engages with the supporting mechanism 174 of the outer vial to form a supported upper parking position to allow the contents held inside the inner vial to flow through the matrix into the sample holding space (receiving space) 222 of the outer vial

[0081] 168 The movable hinge of the outer vial, which connects the outer vial cap 217 with the outer vial body

[0082] 174 The support mechanism of the outer vial, intersecting with the locking / stopping / stopper / support mechanism 153 of the inner vial

[0083] 185 Hinge of inner vial

[0084] 195 Sample collection area at the lowest depth of the outer vial

[0085] 203 Output of external vial; as shown, external dimensions fit Luer lock holder

[0086] 217 Cap of outer vial with tongue 299 for opening and closing

[0087] The sample holding space in the outer vial 222 can receive and hold the flow-through of the sample passing through the matrix

[0088] The sample receiving space in the outer plate 226 can receive and hold the flow-through of the sample through the matrix supported by the inner plate.

[0089] 237 Cap of inner vial with tongue 281 for opening and closing

[0090] 248 Rib sealing mechanism of the inner vial cap, which seals the top of the inner vial

[0091] 256 Rib sealing mechanism of the outer vial cap, which seals the top of the inner vial

[0092] 269 ​​The bottom opening of the inner vial is used to receive the flow from the matrix and transmit it out of the inner vial

[0093] The lower region of the outer vial 273 can fit snugly to receive the inner vial when the inner vial is in the lowered parking position and transmit heat and acoustic energy from the exterior of the outer vial to the inner vial, the matrix receiving the inner vial, and any sample in the inner vial

[0094] 276 A tight interface between the inner and outer vials that facilitates flow from the outside of the outer vial to the inside of the inner vial, its contents and a treatment medium such as heat or light or electromagnetic radiation or acoustic energy (e.g., sonication)

[0095] 281 Tongue of inner vial cap, for manual or automatic opening and closing

[0096] 299 Tongues for external vial caps, for manual or automatic opening and closing

[0097] 303 inner plate, plate support implementation scheme, support equivalent to 96 inner vials

[0098] 308 outer plates, plate support implementation, support equivalent to 96 outer vials

[0099] 311 The hinge area of ​​the outer panel allows the inner panel to be compressed and sealed in the lower parking position, or maintained in the upper parking position to promote flow through the substrate to the outer panel.

[0100] 326 The outer panel support member presses the inner panel downward so that it is sealed with the outer panel in the lower parking position

[0101] 331 Supports for the outer plate which hold the inner plate in an upper parked position to allow solution flow

[0102] Throughout the drawings, unless otherwise indicated, the same reference numerals and characters are used to represent similar features, elements, components or parts of the illustrated embodiments. In addition, although the present disclosure will now be described in detail with reference to the drawings, it is done in conjunction with exemplary embodiments and is not limited to the specific embodiments shown in the drawings and appended claims. DETAILED DESCRIPTION

[0103] With reference to certain aspects and exemplary embodiments of the application in detail, examples are shown in the attached structures and drawings. Various aspects of the application will be described in conjunction with exemplary embodiments, including methods, materials and examples, and this description is non-restrictive, and the scope of the application is intended to cover all equivalents, substitutes and modifications that are generally known or incorporated herein. Unless otherwise defined, all technical and scientific terms used herein have the same meanings as those of ordinary skill in the art to which the application belongs. Those skilled in the art will recognize that many techniques and materials similar or equivalent to those described herein can be used in the practice of aspects of the application and embodiments. The described aspects and embodiments of the application are not limited to described methods and materials.

[0104] As used in this specification and the accompanying numbered paragraphs, the singular forms "a," "an," and "the" include plural referents unless the content clearly dictates otherwise.

[0105] In this article, ranges can be expressed as from "about" a specific value and / or to "about" another specific value. When such ranges are represented, another embodiment includes from said specific value and / or to said another specific value. Similarly, when numerical values ​​are expressed as approximate values ​​by using the antecedent "about", it should be understood that the specific value constitutes another embodiment. It should be further understood that the endpoints of each range are important for the other endpoint and are independent of the other endpoint. It should also be understood that many values ​​are disclosed herein, and in addition to the value itself, each value is also disclosed herein as "about" that specific value. For example, if the value "10" is disclosed, then "about 10" is also disclosed. It should also be understood that when the value "less than or equal to" the value, "greater than or equal to the value" is disclosed, the possible range between these values ​​is also disclosed, as appropriately understood by those skilled in the art. For example, if the value "10" is disclosed, then "less than or equal to 10" and "greater than or equal to 10" are also disclosed.

[0106] The present application is directed, at least in part, to a two-piece "processing and containment" assembly comprising an inner vial that holds and supports a matrix, which may be a continuous plurality of matrices, such as a porous capture surface, followed by a chromatographic medium, as is common in SPE such as C4, C8, C18 or ion exchange resins such as SCX, SAX or metal binding surfaces such as IMAC, which facilitates processing of a sample into multiple fractions; and an outer vial that seals the inner vial during an incubation process and / or a reaction step in a lower parking position, which then serves as a containment pouch in an upper parking position. The upper and lower parking positions are provided by a locking mechanism between the inner and outer vials in the lower parking position, allowing the inner vial to be sealed at the very bottom of the outer vial, while in the upper parking position, subject to minimal rotation, allowing the inner vial to be supported in the upper parking position, allowing its contents to pass through the matrix into the sample containment space of the outer vial. The combination of the sealed pouch and sealing capability in the outer vial, and the pin for removing the dead space of the inner vial output, minimizes sample loss, minimizes elution volume, and maximizes throughput. The inner vial is used as a reaction vessel in the capture and processing steps. The reaction can occur in the inner vial, including on the top or in or on the substrate contained in the inner vial. In the lower parking position, the inner vial, outer vial assembly can be centrifuged to ensure that the surface and holes of the substrate contained by the inner vial have been completely purged of air and exposed to the processing reagent. The assembly can be disposable.

[0107] The assembly can be manufactured in multiple formats such as 96-well plates; many other multiple samples can be considered. Some workflows can utilize multiple outer vials to first capture the initial flow-through, followed by the results of other processing steps received by the material retained inside the inner vial and on, on top of, within or in its matrix. In a preferred embodiment, the molecules are forced to bind to or in the matrix by adding reagents, or to condense to themselves or on the matrix or on the molecules themselves, thereby allowing all uncondensed molecules to pass through the matrix. After the inner vial currently containing the condensed material retained by the matrix has been placed in a new outer vial in the lower parking position, reagents are added to the sealed interior of the lower vial to process the material retained on the top of or in or within or on the matrix.

[0108] Processing can include various elutions from the chromatographic medium, such as salt fractions from ion exchange or organic solvent fractions from reverse phase, as well as the above-mentioned chemical, enzymatic, thermal, sonic or other types of processing. The present application simplifies sample processing and eliminates the need for manual processing of plugs. By integrating the condensation or precipitation step or chemical treatment step with the matrix processing (including filtration and binding, including binding to the chromatographic surface (which can be simply continuous by stacking the matrix)) into a two-part assembly, the present application promotes high throughput, including through automation, robustness and reproducibility, and cost-effectiveness, which is crucial for large-scale processing such as in personalized or precision medicine.

[0109] Proteins and DNA and polysaccharides and other molecules and biopolymers are captured by a combination of at least two capture mechanisms. Any precipitant particles such as protein or biopolymer precipitants are physically captured in the filter pores, and in the presence of a coagulant, the protein material in the solution is adsorbed on the matrix by intentionally adjusting the chaotropic properties of the solvent (comprising the analyte molecules) through non-covalent interactions with the matrix surface. Importantly, the flow-through after this capture contains the extracted physiological small molecules, does not include pollutants, and preserves volatile or non-interfering buffer components. Therefore, the application stipulates that the flow-through is a suitable medium for analyzing metabolites and other unbound molecules. Importantly and surprisingly, the biomolecules such as captured proteins can still be reduced and alkylated in the trap, thereby promoting downstream in-situ protein digestion and proteomic analysis. Other chemical and enzymatic treatments of proteins and other captured molecules can be surprisingly carried out in situ. A significant unexpected advantage of the application is that the captured molecules can be treated in situ in the matrix with enzymes and / or chemicals, without the need to use strong chaotropic agents such as urea or detergents such as SDS.

[0110] The methods and systems of the present invention may involve the use of an extraction solvent that has strong solubility despite the absence of detergents. For example, the preferred buffer of the present application is 1.8% ammonium hydroxide, and the proteomics results unexpectedly show its ability to recover proteins similar to SDS. Unexpectedly, the capture of molecules from a neutral (or neutralized) extraction solution supplemented with a mild chaotropic coagulant (e.g., an aqueous methanol composition described herein) in the absence of detergents or chaotropes provides very favorable conditions for the methods of the present application, namely, capturing molecules in a native or near-native state and capturing them at a high surface area to volume ratio, which makes the molecules particularly sensitive to enzymatic or chemical treatments and / or manipulations within the capture matrix, while also allowing selective recovery of various types of molecules. For example, proteins captured in this way are highly sensitive to proteases. In addition, capture in a native state allows the use of enzymes that require the native tertiary structure of biomolecules. By way of non-limiting example, the enzyme FabRICATOR digests IgG at a specific site below the hinge region to produce a homogenous collection of F(ab')2 and Fc / 2 fragments. FabRICATOR can be used to enzymatically treat antibodies in the workflow of this application, in contrast to FabRICATOR which cannot be used after other sample preparation techniques such as protein precipitation.

[0111] Another specific and preferred embodiment of the present application is to add two volumes of methanol to the sample, first extract with 1.8% ammonium hydroxide sonication (by probe or other means), and then neutralize by adding an equal volume of 1 M acetic acid. A coagulant may be additionally added to the neutralized solution, particularly such as two volumes of methanol, although other ratios may be advantageous. This particular approach is unique and completely surprising because upon neutralization, the biomolecules immediately form enzyme-sensitive aggregates that can be captured, separated from smaller non-aggregated molecules, washed, and further extracted and / or processed by chemical or enzymatic means.

[0112] definition

[0113] As used herein, the term "virus" may include, but is not limited to, influenza virus, herpes virus, polio virus, norovirus, and retrovirus. Examples of viruses include, but are not limited to, human immunodeficiency virus types 1 and 2 (HIV-1 and HIV-2), human T-cell lymphotropic virus types I and II (HTLV-I and HTLV-II), hepatitis A virus, hepatitis B virus (HBV), hepatitis C virus (HCV), hepatitis D virus (HDV), hepatitis E virus (HEV), hepatitis G virus (HGV), parvovirus B19 virus, hepatitis A virus, hepatitis G virus, hepatitis E virus, transfusion transmitted virus (TTV), Epstein-Barr virus, human cytomegalovirus type 1 (HCMV-1), human herpes virus type 6 (HHV-6), human herpes virus type 7 (HHV-7), human herpes virus type 8 (HHV-8), influenza A virus including H1N1 and H5N1 subtypes, human metapneumovirus, severe acute respiratory syndrome The subject is infected with a SARS coronavirus, SARS-CoV-2, Middle East respiratory syndrome (MERS), Hantavirus, and RNA viruses from Arenaviridae (e.g., Lassa fever virus (LFV)), Pneumoviridae (e.g., human metapneumovirus), Filoviridae (e.g., Ebola virus (EBOV), Marburg virus (MBGV), and Zika virus); Bunyaviridae (e.g., Rift Valley fever virus (RVFV), Crimean-Congo hemorrhagic fever virus (CCHFV), and Hantavirus); Flaviviridae (West Nile virus (WNV), dengue virus (DENV), yellow fever virus (YFV), GB virus C (GBV-C; formerly known as hepatitis G virus (HGV)); Rotaviridae (e.g., rotavirus), and combinations thereof. In one embodiment, the subject is infected with HIV-1 or HIV-2.

[0114] The genetically diverse orthocoronavirus subfamily is divided into four genera (α, β, γ and δ coronaviruses). Human CoVs are limited to the α and β subgroups. Exemplary human CoVs include severe acute respiratory syndrome coronavirus-2 (SARS-CoV-2), severe acute respiratory syndrome coronavirus (SARS-CoV), Middle East respiratory syndrome coronavirus (MERS-CoV), HCoV-229E, HCoV-OC43, HCoV-NL63 and HCoV-HKU1.

[0115] Non-limiting examples of subgroup 1a alphacoronaviruses and their GenBank accession numbers include FCov.FIPV.79.1146.VR.2202 (NV_007025), transmissible gastroenteritis virus (TGEV) (NC_002306; Q811789.2; DQ811786.2; DQ811788.1; DQ811785.1; X52157.1; AJ011482.1; KC962433.1; AJ271965 .2; JQ693060.1; KC609371.1; JQ693060.1; JQ693059.1; JQ693058.1; JQ693057.1; JQ693052.1; JQ693051.1; JQ693050.1; porcine reproductive and respiratory syndrome virus (PRRSV) (NC_001961.1; DQ811787) and any subtypes, clades or subclades thereof, including those currently known (e.g., those found in database) or subsequently in Any other subgroup 1a coronavirus identified in the database.

[0116] Non-limiting examples of subgroup 1b alpha coronaviruses and their GenBank accession numbers include HCoV.NL63.Amsterdam.I (NC_005831), BtCoV.HKU2.HK.298.2006 (EF203066), BtCoV.HKU2.HK.33.2006 (EF203067), BtCoV.HKU2.HK.46.2006 (EF203065), BtCoV.HKU2.GD.430.2006 (EF203064), BtCoV.1A.AFCD62 (NC_010437), BtCoV.1B.AFCD307 (NC_010436), BtCoV. v.HKU8.AFCD77(NC_010438), BtCoV.512.2005(DQ648858); porcine epidemic diarrhea virus(NC_003436, DQ355224.1, DQ355223.1, DQ355221.1, JN601062.1, JN601061.1, JN601060.1, JN601059.1, JN601058.1, JN601057.1, JN601056.1, JN601055.1, JN601054.1, JN601053.1, JN 601052.1, JN400902.1, JN547395.1, FJ687473.1, FJ687472.1, FJ687471.1, FJ687470.1, FJ687469.1, FJ687468.1, FJ687467.1, FJ687466.1, FJ687465.1 , FJ687464.1, FJ687463.1, FJ687462.1, FJ687461.1, FJ687460.1, FJ687459. 1. FJ687458.1, FJ687457.1, FJ687456.1, FJ687455.1, FJ687454.1, FJ687453 , FJ687452.1, FJ687451.1, FJ687450.1, FJ687449.1, AF500215.1, KF476061. 1. KF476060.1, KF476059.1, KF476058.1, KF476057.1, KF476056.1, KF476055 .1, KF476054.1, KF476053.1, KF476052.1, KF476051.1, KF476050.1, KF47604 9.1, KF476048.1, KF177258.1, KF177257.1, KF177256.1, KF177255.1), HCoV.229E (NC_002645) and any isoforms, clades or subclades thereof, including those currently known (e.g., as found in . database) or subsequently in Any other subgroup 1b coronavirus identified in the database.

[0117] Non-limiting examples of subgroup 2a beta coronaviruses and their GenBank accession numbers include HCoV.HKU1.C.N5 (DQ339101), MHV.A59 (NC_001846), PHEV.VW572 (NC_007732), HCoV.OC43.ATCC.VR.759 (NC_005147), bovine enteric coronavirus (BCoV.ENT) (NC_003045), and any subtypes, clades, or subclades thereof, including those currently known (e.g., those found in database) or subsequently in Any other subgroup 2a coronavirus identified in the database.

[0118] Non-limiting examples of subgroup 2b betacoronaviruses and their GenBank accession numbers include human SARS CoV-2 isolates such as Wuhan-Hu-1 (NC_045512.2) and any CoV-2 isolate comprising a genome sequence listed by the following GenBank accession numbers, such as MT079851.1, MT470137.1, MT121215.1, MT438728.1, MT470115.1, MT358641.1, MT449678.1, MT438742.1, LC529905.1, MT438756.1, MT438751.1, MT460090.1, MT449643.1, MT385425.1, MT019529.1, MT449638.1, MT374105.1, MT449644.1, MT385421.1, MT365031.1, MT385424.1, MT334529.1, MT466071.1, MT461669.1, MT449639.1, MT415321 .1. MT385430.1, MT135041.1, MT470179.1, MT470167.1, MT470143.1, MT365029.1, MT114413.1, MT192772.1, MT135043.1, MT049951.1; Human SARS CoV-1 isolates, such as SARS CoV.A022 (AY686863), SARSCoV.CUHK-W1 (AY278554), SARSCo V.GD01 (AY278489), SARSCoV.HC.SZ.61.03 (AY515512), SARSCo V.SZ16 (AY304488), SARSCoV.Urbani (AY278741), SARSCoV.civet010 (AY572035), SARSCoV.MA.15 (DQ497008); bat SARS CoV isolates, such as BtSARS.HKU3.1 (DQ022305), BtSARS.HKU3.2 (DQ084199), BtSARS.HKU3.3 (DQ084200), BtSARS.Rm1 (DQ412043), Bt CoV.279.2005 (DQ648857), BtSARS.Rf1 (DQ412042), BtCoV.273.2005 (DQ648856), BtSARS.Rp3 (DQ071615), and any subtypes, clades, or subclades thereof, including those currently known (e.g., those found in database) or subsequently in Any other subgroup 2b coronavirus identified in the database.

[0119] Non-limiting examples of subgroup 2c beta coronaviruses and their GenBank accession numbers include Middle East respiratory syndrome coronavirus (MERS) isolates such as Riyadh 22012 (KF600652.1), Al-Hasa_18_2013 (KF600651.1), Al-Hasa_17_2013 (KF600647.1), Al-Hasa_152013 (KF600645.1), Al-Hasa_16_2013 (KF600644.1), Al-Hasa_21_2013 (KF600634), Al-Hasa_22_2013 (KF600635.1), Al-Hasa_22_2013 (KF600636.1), Al-Hasa_22_2013 (KF600637.1), Al-Hasa_22_2013 (KF600638.1), Al-Hasa_22_2013 (KF600639.1), Al-Hasa_22_2013 (KF600634.1), Al-Hasa_22_2013 (KF600637.1), Al-Hasa_22_2013 (KF600639 ...9.1), Al-Hasa_22_2013 (KF60063 19_2013(KF600632), Buraidah_1_2013(KF600630.1), Hafr-Al-Batin_1_2013(KF600628. 1), Al-Hasa_122013(KF600627.1), Bisha.ltoreq.1_2012(KF600620.1), Riyadh_3_2013(K F600613.1), Riyadh_1_2012 (KF600612.1), Al-Hasa_3_2013 (KF186565.1), Al-Hasa_1_2013 (KF186567.1), Al-Hasa_2_2013 (KF186566.1), Al-Hasa_4_2013 (KF186564.1); Beta coronavirus Eng land 1-N1 (NC_019843), SA-N1 (KC667074); human beta coronavirus 2c Jordan-N3 / 2012 (KC776174.1); human beta coronavirus 2c EMC / 2012 (JX869059.2); any bat coronavirus subgroup 2c isolate, such as bat coronavirus Taper / CII_KSA_287 / Bisha / Saudi Arabia (KF493885.1), bat coronavirus Rhhar / CI I_KSA 003 / Bisha / Saudi Arabia / 2013 (KF493888.1), bat coronavirus Pi kuh / CII_KSA_001 / Riyadh / Saudi Arabia / 2013 (KF493887.1), bat coronavirus Rhhar / CII_KSA 002 / Bisha / SaudiArabia / 2013(KF493886.1), bat coronavirus Rhhar / CII_KSA_004 / Bisha / Saudi Arabia / 2013(KF493884.1), bat coronavirus BtCoV.HKU4.2(EF065506), bat coronavirus BtCoV.HKU4.1 (NC_009019), bat coronavirus BtCoV.HKU4.3 (EF065507), bat coronavirus BtCoV.HKU4.4 (EF065508), bat coronavirus BtCoV133.2005 (NC_008315), bat coronavirus BtCoV.HKU5.5 (EF065512), bat coronavirus BtCoV.HKU5.1 (NC_009020), bat coronavirus BtCoV.HKU5.2 (EF065510), bat coronavirus BtCoV.HKU5.3 (EF065511) and bat coronavirus HKU5 isolate (KC522089.1); any In addition, subgroup 2c, such as KF192507.1, KF600656.1, KF600655.1, KF600654.1, KF600649.1, KF600648.1, KF600646.1, KF600643.1, KF600642.1, KF600640.1, KF600 639.1, KF600638.1, KF600637.1, KF600636.1, KF600635.1, KF600631.1, K F600626.1, KF600625.1, KF600624.1, KF600623.1, KF600622.1, KF600621 .1, KF600619.1, KF600618.1, KF600616.1, KF600615.1, KF600614.1, KF60 0641.1, KF600633.1, KF600629.1, KF600617.1, KC869678.2; KC522088.1, KC522087.1, KC522086.1, KC522085.1, KC522084.1, KC522083.1, KC52208 2.1, KC522081.1, KC522080.1, KC522079.1, KC522078.1, KC522077.1, KC5 22076.1, KC522075.1, KC522104.1, KC522104.1, KC522103.1, KC522102.1 , KC522101.1, KC522100.1, KC522099.1, KC522098.1, KC522097.1, KC5220 96.1, KC522095.1, KC522094.1, KC522093.1, KC522092.1, KC522091.1, KC 522090.1, KC522119.1, KC522118.1, KC522117.1, KC522116.1, KC522115.1. KC522114.1, KC522113.1, KC522112.1, KC522111.1, KC522110.1, KC522109.1, KC522108.1, KC522107.1, KC522106.1, KC522105.1; bat coronavirus HKU4 isolates (KC522048.1, KC522047.1, KC522046,1, KC522045.1, KC522044.1, KC522047 ... C522043.1, KC522042.1, KC522041.1, KC522040.1, KC522039.1, KC522038.1,, KC522037.1,, KC522036.1,, KC 522048.1, KC522047.1, KC522046.1, KC522045.1, KC522044.1, KC522043.1, KC522042.1, KC522041.1, KC5220 40. 1. KC522039.1, KC522038.1, KC522037.1, KC522036.1, KC522061.1, KC522060.1, KC522059.1, KC522058.1 , KC522057.1, KC522056.1, KC522055.1, KC522054.1, KC522053.1, KC522052.1, KC522051.1, KC522050.1, KC5 22049.1, KC522074.1, KC522073.1, KC522072.1, KC522071.1, KC522070.1, KC522069.1, KC522068.1, KC522067.1, KC522066.1, KC522065.1, KC522064.1, KC522063.1, KC522062.1) and any subtypes, clades or subclades thereof, including those currently known (e.g., as found in. database) or subsequently in Any other subgroup 2c coronavirus identified in the database.

[0120] Non-limiting examples of subgroup 2d betacoronaviruses and their GenBank accession numbers include BtCoV.HKU9.2 (EF065514), BtCoV.HKU9.1 (NC_009021), BtCoV.HkU9.3 (EF065515), BtCoV.HKU9.4 (EF065516), and any subtypes, clades, or subclades thereof, including those currently known (e.g., those found in database) or subsequently in Any other subgroup 2d coronavirus identified in the database.

[0121] Non-limiting examples of subgroup 3 gammacoronaviruses include IBV.Beaudette.IBV.p65 (DQ001339) or currently known (e.g., as found in database) or subsequently in Any other subgroup 3 coronavirus identified in the database.

[0122] Coronaviruses defined by any isolate or genome sequence in subgroups 1a, 1b, 2a, 2b, 2c, 2d, and 3 described above can be targeted.

[0123] As used herein, the term "bacteria" shall refer to a member of a large group of unicellular microorganisms having a cell wall but lacking organelles and an organized nucleus. Synonyms for bacteria may include the terms "microorganism, microbe," "bacteria," "bacillus," and "prokaryotes." Exemplary bacteria include, but are not limited to, Mycobacterium species, including Mycobacterium tuberculosis; Staphylococcus species, including S. epidermidis, S. aureus, and methicillin-resistant S. aureus; Streptococcus species, including S. pneumoniae, S. pyogenes, S. mutans, and S. spp. ), S. agalactiae, S. equi, S. canis, S. bovis, S. equinus, S. anginosus, S. sanguis, S. salivarius, and S. mitis; other pathogenic Streptococcal species, including Enterococcus species, such as E. faecalis and Enterococcus faecium; Haemophilus influenzae, Pseudomonas species, including P. aeruginosa, P. pseudomallei, and P. mallei; Salmonella species, including S. enterocolitis, S. typhimurium, S. enteritidis, S. bongo bongori and S. choleraesuis; Shigella species, including S. flexneri, S. sonnei, S. dysenteriae and S. boydii; Brucella species, including B. melitensis, B. suis, B. abortus and B. pertussis.pertussis; Neisseria, including N. meningitidis and N. gonorrhoeae; Escherichia coli, including enterotoxigenic E. coli (ETEC); Vibrio cholerae, Helicobacter pylori, Geobacillus stearothermophilus, Chlamydia trachomatis, Clostridium difficile, Cryptococcus neoformans, neoformans), Moraxella species, including M.catarrhalis, Campylobacter species, including C.jejuni; Corynebacterium species, including C.diphtheriae, C.ulcerans, C.pseudotuberculosis, C.pseudodiphtheriticum, C.urealyticum, C.hemolyticum, C.equi; Listeria monocytogenes, Nocardia asteroides, Bacteroides species, Actinomycetes species, Treponema pallidum pallidum, Leptospirosa, Klebsiella pneumoniae; Proteus species, including Proteus vulgaris; Serratia species, Acinetobacter, Yersinia species, including Y. pestis and Y. pseudotuberculosis.pseudotuberculosis); Francisella tularensis, Enterobacter species, Bacteriodes species, Legionella species, Borrelia burgdorferi, etc. As used herein, the term "targeted bioterrorism agent" includes, but is not limited to, anthrax (Bacillus antracis), plague (Yersinia pestis), and tularemia (Franciscella tularensis). .

[0124] As used herein, the term "fungus" shall refer to any member of the group of saprophytic and parasitic spore-producing eukaryotic organisms, typically filamentous organisms, formerly classified as plants that lack chlorophyll and include molds, rusts, mildews, smuts, mushrooms, and yeasts.Exemplary fungi include, but are not limited to, Aspergillus species, Dermatophytes, Blastomyces derinatitidis, Candida species, including C. albicans and C. krusei; Malassezia furfur, Exophiala werneckii, Piedraia hortai, Trichosporon beigeli, Pseudallescheria boydii, Madurella grisea, Histoplasma capsulatum, Sporothrix schenckii, schenckii), Histoplasma capsulatum, Tinea species, including T. versicolor, T. pedis, T. unguium, T. cruris, T. capitus, T. corporis, T. barbae; Trichophyton species, including T. rubrum, T. indigoferum, T. rubrum, T. indigoferum, T. schenckii, Histoplasma capsulatum, Tinea species, including T. versicolor, T. pedis, T. unguium, T. cruris, T. capitus, T. corporis, T. barbae; erdigitale), T. tonsurans, T. violaceum, T. yaoundei, T. schoenleinii, T. megninii, T. soudanense, T. equinum, T. erinaceid, and T. verrucosum; Mycoplasma genitalia; Microsporum species, including M. audouini, M. ferrugineum, M. canis, M. nanum, M. distortum, M. gypseum, M. fulvum, and the like.

[0125] As used herein, the term "protozoa" shall refer to any member of a diverse group of eukaryotic organisms that are primarily unicellular, exist singly or in aggregates, are generally non-photosynthetic, and are generally further divided according to their ability and mode of movement, such as pseudopodia, flagella, or cilia. Exemplary protozoa include, but are not limited to, Plasmodium (malaria parasite) species, including P. falciparum, P. vivax, P. ovale, and P. malariae; Leishmania species, including L. major, L. tropica, L. donovani, L. infantum, L. chagasi, L. mexicana, L. panamensis, L. braziliensis, and L. guyanensi; Cryptosporidium, Isospora belli, and L. cytomegalovirus; belli, Toxoplasma gondii, Trichomonas vaginalis, and Cyclospora species.

[0126] "Capture," "retention," and related terms in the context of a matrix and biomolecules (including macromolecules and macromolecular fragments) refer to the interaction of the matrix and the molecules such that the molecules, particularly macromolecules, are retained on and / or in the matrix after exposure of the molecules to a coagulant. The interaction is typically non-covalent and can be an intermolecular interaction or a simple retention based on size. The specific nature of the interaction is not important. However, the matrix can retain molecules, particularly macromolecules, such as (but not limited to) DNA, RNA, proteins, and polysaccharides, after the addition of a coagulation medium, allow washing as needed, prevent excessive aggregation, allow capture of smaller molecules in the flow-through to separate small molecules from macromolecules, allow chemical and / or enzymatic treatments such as with (but not limited to) proteases, nucleases, and glycosidases, and the matrix allows molecules or molecular portions to be eluted at the end, most preferably in a separate elution step. If desired, the bound molecules can be washed with a solvent that does not dissolve the captured molecules; accordingly, different classes of molecules are elutable and can therefore be fractionated with different solvents.

[0127] Hereinafter, "matrix" means "a matrix or a combination of matrices".

[0128] The term "analyte" herein refers to one or more molecules to be analyzed, including proteins, DNA, RNA, glycans, lipids, small molecules such as metabolites, drugs and vitamins, etc. Analytical techniques that can be used to analyze analytes are well known to those skilled in the art and include mass spectrometry, NMR, antibody assays, nanopores, nucleic acid labeling techniques, and many other techniques.

[0129] The term "contaminant" herein refers to a moiety that interferes with downstream processing and / or analysis. Contaminants may include salts, buffers, chaotropes, detergents, or components naturally present in the sample, such as phospholipids, or components added to the sample by the user during other sample processing steps, such as reducing and alkylating agents.

[0130] The term "robustness" as used herein refers to the ability of a system, assembly or component thereof to produce highly reproducible results in the methods of the present application.

[0131] The term "throughput" in this context refers to the speed with which a single sample can be processed, or the speed and ability to process multiple samples in parallel, often through automation.

[0132] The term "ease of use" herein refers to the ability to maintain all desired aspects of sample handling and operation, including recovery and separation of analytes, robustness, and throughput, with minimal prior training and with minimal potential for perturbations in sample processing that could result in failed treatments.

[0133] As referred to herein, "strong chaotropes" are agents that cause complete denaturation of biomolecules and generally prevent capture and binding to capture matrices. Chaotropes are a variety of compounds that can cause disorder in biomacromolecules and supramolecular assemblies, especially disrupting hydrogen bonds. They tend to disrupt phospholipid membranes and weaken or unfold the three-dimensional structure of proteins and nucleic acids. The exact mechanism by which chaotropes work is complex and depends on the specific substance; at the same concentration, some are more disordered than others, so we recognize stronger and weaker chaotropes. Urea and guanidine salts are generally considered strong chaotropes, which, at sufficiently high concentrations, will cause complete denaturation and generally dissolution of biological samples and their molecules at high concentrations such as 8M or 6M. Strong chaotropes should be avoided when selecting the extraction solvent of the present invention because they inhibit coagulation and therefore prevent binding.

[0134] As mentioned herein, "mild chaotropic agent" is a chaotropic agent that does not completely denature biomolecules and helps to bind to the capture matrix. Mild chaotropic agent gives molecular structure freedom and promotes protein extension and denaturation, while biopolymers are not completely linearized and biomolecules are denatured. This mild chaotropic agent reduces the order in the protein structure formed by water molecules in the hydration shell around the hydrophobic amino acids in the body, which allows the binding surface between molecules and with the matrix to present a typical hydrophobic internal region, resulting in binding. Many types of molecules are chaotropic agents, which can affect various degrees of disorder in biomolecules, including but not limited to alcohol and other organic solvents, such as benzene, sugar, glycerol, zwitterions, even vanillin and many other compounds (see Timson, DJ (2020). The roles and applications of chaotropes and kosmotropes in industrial fermentation processes. World Journal of Microbiology and Biotechnology, 36 (6). doi: 10.1007 / s11274-020-02865-8). As with general chaotropic science, with respect to the present invention, the determination of how strongly chaotropic a given reagent is is empirical and depends on the ability of the chaotrope to promote condensation of analyte molecules of interest to an existing binding matrix. Mild chaotropes only work in the context of a combination of an extraction solvent and a molecular condensing agent.

[0135] As referred to herein, "molecular coagulant" refers to a reagent or a combination of reagents that, when mixed with an extraction solvent that may have been pH-adjusted, promotes retention and binding of analytes of interest in a protein trap by, in particular, non-covalent mechanisms such as hydrophobic or hydrophilic interactions or ionic interactions. The selection of molecular coagulants should be such that they do not cause excessive aggregation of coagulated analyte molecules, which will hinder the flow through the binding or capture matrix, although they can promote intermolecular interactions to make it easier for analyte molecules to bind to the capture matrix. In multiple embodiments, although coagulants promote binding, they do so in most of the natural states of biomolecules. A possible coagulant can be easily tested by first determining whether it will hinder sample processing, which indicates that it will cause excessive aggregation, secondly whether it promotes binding (e.g., analyzing the presence or absence of, for example, proteins that flow through, if the molecular class is of interest), and thirdly whether it hinders subsequent processing steps, (such as with reducing and alkylating agents, followed by trypsin treatment). An effective molecular coagulant must not hinder sample processing, must promote binding, and must not hinder subsequent processing on or within the matrix.

[0136] As referred to herein, "extraction solvent" shall mean a solvent having the ability to dissolve or substantially dissolve one or more classes of desired analyte molecules that may be dissolved or substantially dissolved under conditions of agitation such as physical agitation or thermal agitation or sonic or ultrasonic agitation. Although in principle the extraction solvent may contain components such as urea or detergents, the presence of such non-volatile compounds may interfere with downstream analysis. Examples of extraction solvents include hydrophobic organics selected to dissolve the hydrophobic components of the sample (such as lipids and hydrophobic proteins), which are then made less hydrophobic by the addition of a more polar molecular coagulant, thereby causing the hydrophobic components to bind to the matrix, volatile acids and bases such as hydrochloric acid or formic acid or acetic acid or other volatile acids, or ammonium hydroxide or tetramethylammonium hydroxide, all of which can be neutralized, compatible with mass spectrometry, and can be mixed with a molecular coagulant to cause the analytes to aggregate on the matrix.

[0137] The extraction solvent and molecular coagulant should preferably be a volatile mixture, or a mixture that does not interfere with downstream analysis, or a mixture that can easily and quickly remove interfering components to non-interfering levels. The selection of the extraction solvent and molecular coagulant must be such that, once combined, they will produce conditions that promote the binding of the analyte to the matrix. The extraction solvent and molecular coagulant can be a mixture that can dissolve the substance of interest, is easy to handle or does not interfere with downstream analysis and processing, and must have conditions (temperature, time, pH, concentration, etc. All of which can vary depending on the type of matrix) that promote the binding or coagulation or capture of one or more types of molecules of interest to the matrix.

[0138] Capture Matrix

[0139] A two-piece sample processing assembly with an integrated matrix is ​​disclosed herein, which improves the speed and simplicity of sample processing requiring an incubation step, which previously required repeated application and removal of the stopper, resulting in delays, non-reproducibility, inability to automate, and sample loss. The assembly can be used in any situation where some fractions of the sample must pass through the matrix, and the material retained on or in the matrix or retained by the matrix will be further processed with a reagent that requires time to operate, i.e., requires incubation under certain conditions such as time, temperature, etc. Therefore, the assembly can be used in many analytical fields from environmental analysis to clinical sample analysis. Although the exact use scheme depends entirely on the composition of the matrix and the processing accepted by the sample, the steps of producing metabolites, lipids, nucleic acids, polysaccharides, and protein samples are disclosed herein. In a plurality of embodiments, the assembly will be manufactured by injection molding of plastics and is disposable to prevent sample crossover and contamination. Especially the assembly system in the lower parking position is particularly considered to be exposed to conditions that are conducive to providing processing for samples that are combined or retained on or in the matrix by the matrix. This processing can particularly include temperature and acoustic energy, but other processing is also possible.

[0140] Preferably, matrix is ​​porous or fibrous material that can be penetrated by the medium that comprises macromolecule.This porous or fibrous material can also be formed by powder or sheet or bead.In addition, matrix should be the suitable material that allows macromolecule to be reversibly captured by matrix.Matrix provides ultrasonic nucleation promotion characteristic by its pore and rough surface, and this reduces cavitation threshold (super) sonication bubble nucleation, growth and collapse, thereby promotes (super) sonication to act on matrix and within effect.Therefore, the method herein can accelerate sonication or sonication step.

[0141] The presence of such a matrix allows the aggregation of macromolecules to be moderated from the medium to which the coagulant has been added. If such a matrix is ​​not present, the macromolecules will tend to aggregate together in an uncontrolled manner. This is undesirable because it makes further processing of the macromolecules more difficult or impossible. For example, digestion of captured proteins with proteases would be hampered without first disrupting the aggregates with chaotropic agents such as concentrated urea or detergents, all of which would then interfere with downstream analysis. Similarly, nucleases may not be able to reach DNA aggregated with proteins and other coaggregating molecules, or glycosidases may not be able to reach glycans, including those attached to proteins.

[0142] Essentially, the capture of macromolecules in the matrix also allows their sequential elution, which is essential for generating multiple classes of analytes for multi-omics analysis. Furthermore, capturing macromolecules in the matrix allows washing (rinsing) of the matrix and macromolecules to remove any contaminants and / or separate different molecular classes while ensuring that the captured molecules are not lost or overly diluted, which would make further processing problematic.

[0143] There are many materials that may be suitable for use as a matrix in the present application, so the selection of a particular material group is not limited. Various exemplary suitable materials and the general properties of these materials will be described below, but it will be apparent to the skilled person that other materials may be used, including beads used in chromatography, or otherwise producing surfaces for sample processing, such as C18 surfaces (on beads or on membranes) or mixed beds, which, for example, contain mixed reverse phase and ion exchange media, or any other material that meets the following criteria, and may have other properties.

[0144] Although many other matrices are possible, particularly preferred matrices comprise depth filter materials.

[0145] The key consideration in the context of the present application is that the matrix (usually a depth filter) is able to bind and retain (usually large (larger)) molecules supplemented with a coagulation medium, and retain these molecules during subsequent washing and processing steps, keeping them in a form so that enzymes can be used to change the physical state of the retained molecules, particularly to reduce the size of larger molecules such as proteins, DNA and RNA or polysaccharides, or to release portions of such as polysaccharides or lipids or ubiquitination or other molecular features of interest from captured molecules, which can be achieved by chemical and / or enzymatic treatments. The suitability of any presumed matrix can be evaluated by testing it in the scheme described in the following examples. One of ordinary skill will be able to identify alternative suitable matrix materials.

[0146] As a general guide, matrices are usually:

[0147] - Suitable for capturing and retaining fine and very fine particles, e.g., from a few micrometers (e.g., 20 μm or less, 10 μm or less, 5 μm or less, or 2 μm or less) to the submicron size range (e.g., down to 0.2 μm or even 0.1 μm in size);

[0148] - Essentially inert to sample molecules;

[0149] - the ability to reversibly capture (i.e. retain) molecules such as proteins and DNA or RNA or lipids or glycans from a sample when the sample is exposed to a coagulation medium;

[0150] - Allows chemical and / or enzymatic treatment of captured molecules, for example proteases can be used to digest proteins in situ, or nucleases can be used to produce DNA or RNA of smaller size, or glycosidases can release glycans from proteins or not bind to surfactants and therefore retain the surfactant to any significant extent.

[0151] The capture matrix can be a depth filter, but is nevertheless necessarily porous, and in some embodiments can be produced with enzymes for sample processing, for example with proteases or nucleases or lipases or glycosidases.

[0152] The matrix is ​​retained in the inner vial by a variety of techniques known to those skilled in the art including hermetic sealing or plastic welding or heat welding or ultrasonic welding, or by the physical size of the matrix and friction as it is forced into the narrowed bottom of the inner vial or the use of adhesives or frits or a support system such as a screen or plastic scaffolding which may include supports or retaining rings or screens, etc.

[0153] Matrix can be any porous matrix, such as filter material, chromatographic material, material with affinity, film, glass frit, SPE material, filter, depth filter etc.. In the case of losing chromatographic beads, glass frit can be provided at the bottom and top, or only provided at the bottom. Suitable materials for the matrix of the application include porous matrix, such as sintered material or porous plastic or with a limited or approximately limited porosity film. Exemplary materials include porous polyethylene (PE), polypropylene (PP), polytetrafluoroethylene (PTFE) and sintered polytetrafluoroethylene. Suitable materials can also include porous materials, various filters made by sintered glass or other materials, including paper or glass or depth filter, glass membrane filter, film with a specific molecular weight cutoff, or with a film of a specific pore size such as 0.2 micron, 2 microns, 20 microns or the like. Except film and sheet material, matrix can also include loose beads or powder, specifically depending on use. If powder is lost, the size (particle diameter) of the particle can be a size similar to liquid chromatography, or can be slightly larger or slightly smaller, to provide control of the power required for moving solvent through the matrix material. Similarly, the pore size of porous substrates, including membranes, can be modified to alter the flow rate of solutions through the substrate.The substrate can be hydrophilic or hydrophobic, and can be selected to be wettable by water or organic solvents.

[0154] Those skilled in the art will recognize that a variety of surfaces or media may be used for one or more matrices, including materials useful for SPE materials, reverse phase materials such as bonded phase silica and including, for example, C4, C8 or C18 packing materials, or chelating surfaces to capture materials such as metals, or polymer particles presenting a hydrophobic surface, or ion exchange resins such as SCX, SAX, which present a negatively or positively charged surface, or weak cationic or ion exchange, or gel filtration materials having particles with pores of a given size to promote retention of analytes of a certain given radius or molecular weight, or based on affinity. Supports, including surfaces for metal affinity chromatography such as IMAC, or other affinities, such as but not limited to antibodies to antigens or haptens or PTMs of peptides, such as phosphorylated YST or ubiquitin or acetylation or methylation or lipidation or antibodies to specific motifs or titanium dioxide to capture phosphorylated residues or silicon carbide for nucleic acid (DNA and RNA) affinity, or streptavidin for biotinylated moieties or fluorinated surfaces to capture halogenated compounds, or antibody-based capture materials such as protein A or G, or chelators or any similar matrix material for chromatography such as high performance liquid chromatography. The matrix may be composed in part or in whole of a monolithic material having any of the above affinities or other affinities.

[0155] The device may include a secondary matrix, possibly a hydrophobic matrix arranged between the primary matrix and the outlet, ie downstream of the primary matrix. Those skilled in the art will appreciate that many other matrices are possible.

[0156] Suitably, the secondary matrix extends across the entire cavity of the vessel so that any flow from the inlet to the outlet must pass through at least a portion of the secondary matrix.

[0157] The outlet may lead to a reservoir or storage vessel suitable for collecting various media, reagents, buffers, etc. that have passed through the matrix, in particular different fractions of different molecules having different solubilities.

[0158] The eluted molecules or fragments can be appropriately transferred to a secondary matrix. Suitably, the secondary matrix can be a hydrophobic matrix, such as a stationary hydrophobic phase suitable for reverse phase chromatography (RPC). Most of the post RPC matrices are based on silica matrices, such as silica with bonded alkyl chains, but any inert hydrophobic solid phase can be used in theory. Particularly preferred hydrophobic matrices include silica bonded by octadecyl carbon chains (C18), silica bonded by C8, or a combination of the two, but other suitable matrices include silica bonded by cyano groups and silica bonded by phenyl groups. Substituted secondary matrices can be ion exchange chromatography, hydrophobic interaction chromatography, or affinity chromatography based on macromolecular affinity reagents such as aptamers or antibodies, or chemicals such as IMAC or titanium dioxide for phosphorylation. Similarly, RNA can be enriched with oligothymidine, or polysaccharides can be enriched with boron affinity chromatography or lectins. Those skilled in the art will appreciate that in many different embodiments, such as may be incorporated herein, where the loose beads are held by a frit, or a derivatized membrane, such as Empore C18. The secondary matrix may have a variety of roles, for example: it serves as a mechanical support for the primary matrix, it serves as a protective filter, capturing stray particles and shed fiber material from the primary matrix, it aids in the final cleanup of captured and processed molecules and molecular fragments; and it may perform chromatographic separations of captured and processed molecules and molecular fragments.

[0159] In some preferred embodiments of the present application including a reverse phase secondary matrix, the present application includes the following steps: using a series of eluents or eluent gradients with increasing hydrophobicity to elute the molecules and molecular fragments captured and processed from the hydrophobic secondary matrix. Therefore, the method can provide a certain degree of chromatographic separation of molecules and molecular fragments captured and processed based on their hydrophobicity. This allows the population of captured molecules or their fragments to be parsed based on hydrophobicity, which helps in later analysis. For this purpose, a secondary matrix comprising C8 bonded silica is very useful. A suitable eluent series includes, in sequence, 5% ACN in water, 10% ACN in water, 15% ACN in water, and then 60% acetonitrile in 0.5% formic acid (FA) solution; this series allows four fractions to be obtained from the captured molecules.

[0160] The device may be a modified pipette tip. Other types of vessels are contemplated, such as vessels suitable for automated and / or high throughput sample preparation and / or spin columns.

[0161] capture

[0162] In particular, capture of macromolecules is achieved by a combination of two capture mechanisms after the addition of a coagulation medium. Any precipitated particles are physically captured in the filter pores, while other materials in the solution are adsorbed on the filter through non-covalent interactions with the filter surface. Those skilled in the art will recognize that there are many different solutions that can specifically cause coagulation of a particular class or combination of classes of biomolecules such as lipids, polysaccharides, proteins, peptides, nucleic acids. For example, coagulation and capture of proteins is promoted by the addition of organic solvents such as methanol, other alcohols, or many other organic solvents.

[0163] Alternatively, capture of lipids is facilitated by the use of aqueous solvents, and lipids and other small molecules can be separated in the flow-through by using a biphasic organic solution such as a mixture of methanol, water, and methyl tert-butyl ether (MTBE), which also results in precipitation and / or binding of proteins and DNA and RNA and glycans in the capture matrix.

[0164] In the case of size-based retention, i.e., in the case where particles are captured in the pores due to their size or the size of aggregated particles or microparticles, elution can be achieved after chemical and / or enzymatic treatment to reduce the macromolecules to a smaller size. By non-limiting example, the captured protein can be broken into smaller protein fragments (peptides) by protease or chemical treatment or by acoustic energy shearing. Similarly, polysaccharides can be released from the captured protein by treatment with glycosidases, or larger polysaccharides can be processed into smaller fragments by glycosidases, and lipids can be released from the captured material, the material including proteins (for lipidated proteins) or larger lipids broken into smaller fragments, as non-limiting examples for library generation, nucleases or acoustic wave shearing can produce shorter lengths of DNA and RNA. The method relies on capturing one or more classes of molecules, while another or other molecules remain soluble, and therefore subsequent analysis is performed through the pores.

[0165] The capacity (and therefore the volume) of the matrix should generally be sufficient to capture substantially all (macro)molecules in the sample without becoming clogged, regardless of the mechanism by which the (macro)molecules are retained. However, it is obvious that the required matrix capacity depends inter alia on the concentration of the molecules in the sample. A suitable matrix volume can be determined by trial and error, and generally no problems are encountered if a matrix volume greater than that strictly required is provided, except that more reagents may be required for wetting, washing and enzymatic or chemical treatment of the sample and elution of the resulting treated molecules.

[0166] The coagulant causes some parts or fractions of biomolecules to adhere or be captured or retained on or within the matrix in a reversible manner. Typically, although not exclusively, this will include proteins, DNA, RNA and polysaccharides. Most typically small molecules such as (but not limited to) metabolites will pass through. However, by changing the one or more extraction solvents used, other classes of molecules, such as (and not limited to) lipids, can be captured and retained. If the time is long enough, proteins and DNA / RNA in particular can precipitate and form a suspension of fine particles; this precipitation is not mandatory. It is essential that the coagulant does not cause severe precipitation, making the precipitant insensitive to enzymatic treatment (e.g., using digestion trypsin or LysC or PNGase F or nuclease), especially under aqueous conditions. It is worth noting that although the sample can be clarified by, for example, centrifugation after exposure to the extraction solvent, the entire sample, including the debris, can also be loaded; any further extraction and / or chemical and / or enzymatic treatment steps will then be performed on it.

[0167] Depth Filter

[0168] A depth filter is a filter that uses a porous filter media to retain particles throughout the media, rather than just on the surface of the media (as is the case with membrane / surface filters). Depth filters are often used when the fluid to be filtered contains a large number of particles, because they can retain a large number of particles before clogging relative to other types of filters (for more information on depth filters and other filters, see Derek B Purchas and Ken Sutherland, Handbook of Filter Media (2nd Edition), Elsevier Advanced Technology (2002)).

[0169] Depth filters typically have a random network of pore channels of varying sizes and geometries. They are made from a variety of solid materials. Materials of construction include various forms of quartz, polymers, cellulose, and glass, either alone or in combination. The processes used to make depth filters do not result in a regular arrangement of solid matrices. Instead, there is a range of pore sizes in a given structure, including pores that are both much larger and much smaller than the nominal pore size rating.

[0170] Depth filters are typically made from one or more of the following materials:

[0171] ·quartz;

[0172] Fiberglass;

[0173] ·polymer;

[0174] Cellulose; and

[0175] Cellulose with other additives, such as diatomaceous earth.

[0176] Preferred depth filters for use in this application are formed from cellulose, packed cellulose, quartz, glass fibers, or polymers.The filter material should generally be inert to the molecules being processed and the reagents used in the method to avoid undesired reactions.

[0177] Depth filters are not usually characterized by a defined pore size like membrane filters (surface filters), and the pore size is often highly variable. Therefore, defining a specific pore size for a depth filter based matrix is ​​imprecise. Depth filters are usually referred to by target particle size retention, e.g., 5 μm, 1 μm, etc. Depth filters come in a variety of physical forms, from sheets to tubular columns to pleated filters.

[0178] Particularly preferred depth filters for use in this application include quartz, borosilicate depth filters, cellulose and / or cellulose plus diatomaceous earth or mineral or carbon or other materials, many forms of which are available from many suppliers such as Ahlstrom, Eaton, EMD Millipore, ErtelAlsop, Filtrox, HOBRA- Pall, Sartorius, Whatman or alternatives to proprietary compositions and structures may be obtained as long as the material substantially matches the properties of a depth filter.

[0179] Depth filters have a random network of pore channels of varying sizes and geometries. They are made from a variety of solid materials. Materials of construction include various forms of plastics, cellulose, and glass, either alone or in combination. The processes used to make depth filters do not result in a regular arrangement of solid matrices. Rather, there is a range of pore sizes in a given structure, including pores that are much larger and much smaller than the pore size rating.

[0180] The random nature of the structure does not allow for specifying a definite upper limit on the size of particles that can pass through the filter. A portion of the particles in the filtrate will exceed the pore size rating. Depth filters can also retain a large portion of particles that are smaller than the pore size rating. Because depth filters capture particles throughout the structure, they generally exhibit high particle handling capabilities. This makes them particularly useful in applications where the solution being filtered has a high particle loading. Depth filters are not considered sterilizing grade.

[0181] Different grades of depth filters may have different pore sizes, i.e., grade 4 (20-25 μm pores), grade 598 (8-10 μm pores), and grade 3 (6 μm pores) may be used, and a degree of retention will be achieved, but finer or coarser filters may provide improved performance, depending on the nature of the molecules allowed through and the molecules desired to be retained on the filter. Thus, it is indicated that depth filters with a capture range from 15 μm to 0.1 μm (or even smaller) are preferred, for example, about 15 μm or finer, about 5 μm or finer, about 1 μm or finer, about 0.5 μm or finer are suitable.

[0182] Depth filters are often used as pre-filters because they are an economical way to remove ≥98% of suspended solids and protect downstream components from fouling or clogging. Their high capacity is attributed to the fact that contaminants are captured and retained throughout the depth of the filter.

[0183] Conventional depth filters can be made from the following materials:

[0184] ·quartz

[0185] Fiberglass

[0186] ·polymer

[0187] Cellulose

[0188] Cellulose and fillers such as diatomaceous earth

[0189] Quartz.Filter media is made from pure micro-quartz fibers. This media can be produced with or without glass fibers and binders. Media without glass fibers and binders are particularly suitable for emission control at high temperatures of 900-950°C and anywhere absolute purity of the filter media is required. Very good filtration performance, minimal metal content, excellent weight and dimensional stability.

[0190] Fiberglass. As the name implies, fiberglass depth filters are made of glass fibers. In sheet form, the fibers are initially held together only by mechanical interactions. To improve handling characteristics, the filters are sometimes treated with a polymer binder such as polyvinyl alcohol, which serves to hold the matrix together. Fiberglass filters are also susceptible to fiber shedding. If desired, a membrane filter can be placed downstream to retain any fibers. Examples include GF / D (Whatman), the filter material used in the examples above.

[0191] Polymer. Polymer depth filters are made from plastic fibers of various lengths, morphologies, and diameters. To increase the strength of these filters and reduce the extent of fiber shedding, the filters may be calendered, a process that runs the material between cylindrical rollers to apply pressure and / or heat. Most polymer depth filters are hydrophobic in nature. For low pressure water filtration, the filter may require a surface treatment to make it wettable. Polymer depth filters are generally very strong and easy to handle.

[0192] Cellulose. As the name implies, cellulose depth filters are made of cellulose fibers. The fibers can be derived from relatively coarse sources, such as wood pulp, or highly purified sources, such as cotton. The filters are made using techniques very similar to papermaking, and are very economical. While they are generally easy to handle when dry, their mechanical properties are very weak when wet. Cellulose filters tend to shed fibers during manufacture into devices and when used for filtering. If desired, a membrane filter can be placed downstream to retain any fibers. Cellulose fibers can also be a source of contaminants, however the ability to embed cellulose filters into other materials, such as diatomaceous earth, provides unique opportunities. Various such highly purified forms can be useful.

[0193] Buffer

[0194] Conventional precipitation methods for mass spectrometry preparation are harsh and result in violent precipitation and aggregation, which makes them quite insensitive to enzyme activity. Taking proteins as an example, exemplary precipitants in prior art methods include trichloroacetic acid (TCA), typically a 100% w / v solution (500 g TCA in 350 ml dH2O). See, e.g., Curr Protoc Protein Sci. February 2010; Section: Unit-16.12. Such precipitated proteins must be treated with strong chaotropic agents to make them sensitive to protease action. Exemplary chaotropic agents for such purposes include urea (e.g., 8 M concentration) and the like, or use detergents and the like.

[0195] The present application may involve the use of buffers that can be considered mildly chaotropic, etc. For example, preferred buffers for the present application are based on methanol and ammonium acetate. One specific embodiment is 50% methanol and 50% 30mM ammonium acetate as the coagulant, containing 3% non-ionic detergent. Another specific and preferred embodiment is four volumes of methanol as the coagulant containing 30mM ammonium acetate (prepared from a 1M ammonium acetate aqueous stock solution in anhydrous methanol), which is added to a sample extracted by probe sonication in 30mM ammonium acetate. Another specific embodiment is 50% methanol and 30mM ammonium acetate as the washing solution. These compositions have much less chaotropic effects on biomolecules, including those that precipitate and aggregate, including (but not limited to) DNA and proteins, which is completely different from urea or guanidine hydrochloride.

[0196] Suitably, the coagulant comprises a mixture of an aqueous solution and an organic solvent, most typically in the range of two parts methanol to one part aqueous extraction solution to ten parts methanol to one part aqueous extraction solution. It will be apparent to those skilled in the art that methanol is only one representative organic solvent and that many other solvents may be used for the same purpose.

[0197] The aqueous extraction solution may be neutral, such as 30 mM ammonium acetate at approximately pH 7 in a particular embodiment, or basic, such as 1.8% ammonium hydroxide, or acidic, such as 1 M HCl or formic acid.

[0198] When proteins are captured in their native state, e.g., for subsequent enzymatic processing, near-neutral aqueous extraction solvents are the preferred embodiment. The extraction solution may contain detergents, which are generally undesirable because they interfere with downstream analysis of molecular species that are not bound to the capture matrix. Depending on the type and class of molecules desired, the concentration of a buffer such as ammonium acetate in the neutral aqueous extract may vary from 1 mM to as high as multiple molar. Similarly, the concentration of the base may vary from less than 1% to maximum solubility, e.g., a maximum of 35.6% w / w for ammonium hydroxide; typically 1%–5% base is most suitable, although other embodiments are possible.

[0199] In alkaline extractions, ammonium hydroxide is preferred due to its volatility. The acid concentration in the acidic aqueous extraction solution ranges between 10 mM and multiple molar, again optimized depending on the desired class of molecules. It should be noted that in preferred embodiments, volatile acids, bases, and buffers are desired because they can be removed by rapid vacuum. It should also be noted that capture is best near neutral pH, and that while the extraction solution is typically aqueous, there is no reason it must be aqueous as long as it enables the capture and fractionation mechanisms described below. It will be apparent to one skilled in the art that there are many buffers, acids and bases, and coagulants, and the substances described in this paragraph are intended only as illustrative examples and not limiting.

[0200] Acidic or alkaline extraction is generally advantageous because at non-physiological pH values, enzymes that may degrade the sample, such as but not limited to proteases, phosphatases, lipases, glycosidases, nucleases, etc., are inactive or have low activity.

[0201] To determine the desired coagulant concentration, a sample solution extracted with an extraction solvent is typically exposed to different concentrations of coagulant, allowed to flow through a capture matrix (usually a depth filter), and then the flow-through is first concentrated and then analyzed for the class of molecules to be captured. For example, in an embodiment where the flow-through containing small molecules such as metabolites and proteins as well as DNA and RNA and polysaccharides is retained on the trap, proteins will be analyzed by, for example, SDS PAGE and DNA by, for example, polyacrylamide gels, each gel being displayed by their respective stains (e.g., colloidal Coomassie, lectins, and ethidium bromide, as well as many other stains for proteins, nucleic acids, and polysaccharides). If the desired protein class is not captured, different coagulants or different concentrations must be tried until reversible capture of the molecular class is achieved. In one test, it was found that a six-to-one volume excess of methanol provided good capture for an aqueous solution containing antibodies.

[0202] Other methods of condensing molecules onto a matrix are also suitable for use in this application. For example, salts can be used to drive "salting out" precipitation. In these embodiments, the downstream effects of such condensation methods must be considered. For example, PEG can be used to exclude substances from solution, but PEG will make downstream analysis almost impossible.

[0203] The suitability of any coagulant used for the present application can be tested using the following method. Specifically, any coagulant should be able to capture biomolecules or molecules that have been dissolved with an extraction solution (if it is not close to neutrality, then neutralized to near neutrality before capture) on a capture matrix, and the molecules so retained should be able to be treated with enzymes such as (but not limited to) nucleases, proteases (usually trypsin), glycosidases, and many other enzymes or alternatively various chemicals in the device and / or on the capture matrix, without the need for solubilization with strong reagents such as chaotropes (such as urea or surfactants or detergents). As described above, if the time is too long, the molecules will aggregate and precipitate, which may cause enzymes such as proteases to no longer be effective. Therefore, the sensitivity to enzymatic and / or chemical treatment should be evaluated immediately after the molecules on the capture matrix are captured, or ideally, after the molecules are captured in the depth filter capture matrix as described above. The time course of sample exposure to the coagulant can also be performed. In addition, the coagulant should not prevent the use of mass spectrometry to extract and possibly process the molecules for downstream analysis.

[0204] The sample, including the sample extraction solvent and coagulant, is typically contacted with the capture matrix, although the matrix may also process any precipitation or debris from the sample, and the vessel holding the capture matrix may hold the coagulant and the extraction solvent may be added directly to the coagulant.

[0205] In the case where the extraction solvent / coagulant mixture is added to the matrix, the matrix can have been infiltrated by a fluid medium (phase), i.e. a solution and a fluid that is usually compatible with the composition of the extraction solvent / coagulant mixture. Preferably, the fluid medium that infiltrates the matrix is ​​slightly chaotropic. For example, it can comprise short-chain alcohols, such as aqueous solutions of methanol, ethanol or propanol, or other organic solvents. Most preferably, a methanol-water solution, such as usually comprising 60% or higher.

[0206] An exemplary and generally preferred extraction solvent / coagulant mixture is sample extraction with one volume of 30 mM ammonium acetate mixed with four volumes of coagulant, particularly for this example, methanol containing 30 mM ammonium acetate, whereby anhydrous methanol is supplemented to 30 mM ammonium acetate from a 1 M aqueous ammonium acetate stock solution.

[0207] The step of washing the capture matrix with captured molecules is not mandatory for the captured endogenous molecules, but if the protein is reduced and alkylated or otherwise chemically manipulated on the capture matrix, it is mandatory; This usually occurs after reclaiming small molecules such as lipids and metabolites. Washing also removes pollutants, and any suitable washing solution that makes pollutants solubilize or the reducing / alkylating agent (or any other chemical treatment, such as cutting or deamidation or oxidation reagent) that does not solubilize the molecules concerned can be used. Suitable liquids are various methanol aqueous solutions containing the above-mentioned ammonium acetate. However, other liquids will be suitable, and the suitability of any presumed washing solution can be easily tested. Usually mild chaotropic agents can be used for this purpose. Ideally, they should be compatible with mass spectrometry.

[0208] In some cases, it may be desirable to remove the wash liquid, for example where the presence of the liquid may adversely affect the activity of subsequently applied processing enzymes such as proteases or nucleases or glycosidases, and replace it with another buffer. This is readily accomplished by a first wash step using aqueous methanol to remove the reducing and alkylating agents (other organic solvent compositions may be used) and a second rinse step using, for example, water or aqueous ammonium bicarbonate to remove residual methanol solution. The aqueous buffer containing agents such as ammonium bicarbonate or acetate and many other reagents known to those skilled in the art, as well as any necessary cofactors, may then be used for downstream processing purposes.

[0209] deal with

[0210] In the present application, after the small molecules have been separated and captured in the flow-through of the solvent extraction solution combined with the coagulation solution, an enzyme (such as a protease or a nuclease or a glycosidase) for processing the captured molecules is applied. Digestion of proteins with proteases is a conventional step in preparing proteins for mass spectrometry. Typical proteases include trypsin or LysC, but it can be any other suitable protease, such as chymotrypsin and many other proteases. For example, 0.07 μg / μl trypsin (03708985001, Roche or V5111, Promega) in 50 mM ammonium bicarbonate can be used in the embodiments of the present application. Polysaccharides can be cut or processed or released enzymatically. N-linked polysaccharides can be released together with peptide-N-glucosidase F (PNGase F). PNGase F releases most polysaccharides, except those polysaccharides with 1-3 linked fucose in the reducing end GlcNAc. In this case, the enzyme peptide-N-glucosidase A (PNGase A) is used. For O-linked polysaccharide release and subsequent analysis, there are fewer enzymes comparable to PNGase F. Typically, release of O-linked glycans is achieved by chemical methods such as β-elimination. However, Genovis provides an o-protease (OpeRATOR) for the specific digestion of O-glycans of glycoproteins, an endoglycosidase (O-glycosidase) for O-glycans of core 1 and core 3 (OglyZOR), and an exoglycosidase (SialEXO) acting on sialic acid; all of these enzymes can be used in embodiments of the present application, most preferably applied to the capture matrix.

[0211] Enzymes (such as proteases or nucleases or glycosidases or lipases or other enzymes) for processing captured molecules are usually added to the medium of the permeation matrix. A variety of enzymes can be used continuously or in parallel. For example, macromolecules can be separated and captured in the capture matrix as described above, while capturing small molecules. Polysaccharides can be released or cut with PNGase F, and because they are highly water-soluble, they can be recovered by water washing. Leave the protein, then the protein can be reduced and alkylated in situ, and then digested with protease as described above. In another example, when the nucleic acid of the sample is not concerned, nuclease and protease can be added simultaneously, as long as the protease does not digest the nuclease immediately.

[0212] Suitably, the method includes a step of desalting the captured molecule and / or its fragment. Desalting can be achieved by flushing the molecule with a salt-free buffer and / or water and / or a mixture of water and an organic solvent such as methanol. Desalting can be performed within a capture matrix, in which case the molecule is simply washed, or in some embodiments, the application has other affinities, such as C8 or C18 (see below).

[0213] Elution

[0214] Any suitable agent can be used to elute the molecule and its fragment. Water can be used to dissolve polysaccharides, and DNA and RNA can be solubilized. DNA and RNA can be solubilized in TE buffer (1mM EDTA 10mM tris pH8.0). Alkaline solutions (such as ammonium bicarbonate) or acidic solutions (such as trifluoroacetic acid) or saline solutions (such as sodium chloride) and aqueous solutions supplemented with organic matter such as 10% acetonitrile are suitable for eluting proteins / fragments from the matrix. It is worth noting that, independent of any other treatment of other molecular classes, high concentrations of formic acid (60% or 80% or more, keeping the solution low temperature to avoid formylation) or 8M urea or 6M GuHCl or alkalis such as 1.8% ammonium hydroxide can be used to elute the captured protein from the depth filter. It should be noted that sonication helps any of these reagents, and carbamylation caused by urea can be limited by using amine-containing buffers.

[0215] The method may further comprise eluting the captured and processed molecules and molecular fragments from the secondary matrix using a suitable elution solution, for example, for embodiments using reverse phase capture, a suitable elution solution is 70% acetonitrile, 0.5% formic acid in H2O.

[0216] Preferably, the present application uses, at least in part, a condensation medium that substantially comprises methanol or another alcohol or an organic solvent. This medium can be used not only for capture in the capture matrix, but also for washing. A particularly preferred medium is a buffer having a roughly neutral pH (e.g., 6.5 to 7.5) comprising methanol or another alcohol (typically 60% or more v / v methanol) and ammonium acetate or other buffers having a pKa of about neutrality, such as specifically 80% methanol containing 30 mM ammonium acetate. This formulation and composition can only be achieved after the extraction solvent is combined with the condensation medium. Other suitable media for the present application will be apparent to those skilled in the art.

[0217] The methods provided are suitable for processing samples containing many common surfactants. SDS is commonly used as a surfactant for solubilization and extraction of membrane-bound proteins from cells, but other surfactants are also used, including sodium cholate, sodium deoxycholate, n-dodecyl-β-D-maltoside, Triton X-114, NP-40 (Thermo Scientific), and Brij35 (Thermo Scientific). However, surfactants hinder downstream analysis.

[0218] Where the device is a pipette tip or spin column, it preferably comprises a layer of primary matrix and a layer of secondary matrix, the layers being arranged such that the primary matrix is ​​upstream of the secondary matrix relative to the net direction of flow through the device. Typically, the primary and secondary matrices are disposed in a tapered portion of the device, with the secondary matrix closer to the narrow tip end (nozzle) and the primary matrix closer to the wide end.

[0219] The primary and / or secondary substrates may each comprise one or more flat layers (e.g., a disk for a vessel that is circular in cross section) of a relevant material (e.g., a depth filter or hydrophobic silica). Two or more layers of the relevant material may be stacked to provide the desired overall depth, thereby providing the desired volume and capacity of the substrate. Alternatively, a thicker and therefore more capacious material may be used.

[0220] The matrix may be held in the device in any suitable manner, such as mechanically (e.g. by friction with the walls of the device, or using clips, frames or other support means) or by an adhesive or the like (provided such adhesive or the like is compatible with the method).

[0221] The device is suitable for installation in a centrifuge to facilitate driving various media, reagents, buffers, etc. through the matrix.

[0222] Alternatively, the device may be adapted to be connected to one or more pumps to drive various media, reagents, buffers, etc. through the matrix.

[0223] The device may suitably be a microfluidic device.

[0224] The device may be provided in conjunction with a holder, for example a support that allows the device to be mounted in a centrifuge or other piece of laboratory equipment.

[0225] The present application provides a system including a device and related sample processing equipment.

[0226] In certain embodiments, the trap can be combined with a computer control system or with microfluidics and / or other devices that allow automated sample processing described below. In an exemplary embodiment, the computer system includes a memory, a processor and optionally an auxiliary storage device. In some embodiments, the computer system includes multiple processors and is configured as multiple, for example, blade servers or other known server configurations. In a specific embodiment, the computer system also includes an input device, a display device, and an output device. In some embodiments, the memory includes a RAM or a similar type of memory. In a specific embodiment, the memory stores one or more applications for the processor to execute. In some embodiments, the auxiliary storage device includes a hard disk drive, a floppy disk drive, a CD-ROM or a DVD drive or other types of non-volatile data storage. In a specific embodiment, the processor executes one or more applications stored in the memory or auxiliary memory or received from the Internet or other networks. In some embodiments, the processing of the processor can be implemented in software, such as a software module, for execution by a computer or other machine. These applications preferably include executable instructions to perform the functions and methods described above and shown in the figures of this article. The application preferably provides a GUI, through which the user can view one or more applications and interact with one or more applications. In other embodiments, the system includes remote access to control and / or view the system.

[0227] The system may be adapted to perform several steps of the method of the present application, for example at least the steps of molecule capture, transfer of the molecules to a matrix, fractionation and washing if necessary, subsequent treatment with an enzyme and subsequent fractionation.

[0228] Furthermore, the system may also be adapted to perform one or more of cell lysis, biomolecule extraction, and elution of biomolecule fragments from a matrix.

[0229] The present application provides a kit, which includes a device and one or more containers, wherein the container includes at least one of the following: a buffer medium for the device; a reagent for cell lysis and membrane-bound protein solubilization; an enzyme, including (for example) a protease, a nuclease, a glycosidase, a lipase, etc.; a detergent / rinsing agent as required; and a plurality of elution reagents, which are selected according to the properties of the biomolecule class as described herein. Various suitable media, reagents, etc. are discussed herein.

[0230] Spin column assembly

[0231] There is still a need for a simple, efficient and repeatable sample preparation tool that is compatible with a small amount of sample, which produces separated fractions of different classes of molecules from the sample from the same biological sample, usually (but not necessarily) a biological sample such as a biopsy or blood sample or other biological fragment. The present application provides a two-part nested system of an inner vial and an outer vial that is elegant and easy to use to meet these experimental needs. The inner vial has space to retain and support one or more substrates and other components familiar in the art, such as glass frits and membranes. The inner vial and the outer vial are interfaced in two positions, namely the "lower" and "upper" parking positions. In the lower parking position, the outer column seals the inner vial, prevents outflow of the inner vial, and allows the reaction to occur under any incubation conditions required within and on top of the matrix and within the volume of the inner vial. The inner vial can then be lifted to the upper parking position, where the solution can flow from the inside of the inner vial through the matrix to the inside of the outer vial. The outer vial then becomes a container for the flow-through of any incubation step, and there is no problem of stopper loss because the outer vial replaces the stopper.

[0232] The two-piece system does not need any obstruction to affect incubation or reaction, thereby reducing processing to the greatest extent and improving sample processing speed and sample recovery to the greatest extent. The system has an upper parking position and a lower parking position, which is realized by the locking mechanism between the inner bottle and the outer bottle in engagement or separation, and this locking mechanism stops or allows the matrix to flow out. In a preferred embodiment, the locking mechanism comprises an inverted U-shaped stopper outside the inner bottle and a support column inside the outer bottle, and this support column can engage the middle part of the U to be supported in the upper parking position or break away from the support column, so that the inner bottle is in place to the bottom of the outer bottle. In the upper parking position, the content and the matrix of the inner bottle can be transported to the outer bottle by a porous matrix, for example, by positive pressure or centrifugation, or by suitably applying negative pressure. In the lower parking position, the inner bottle is sealed by the outer bottle, allowing the processing that needs incubation, such as a coagulation step. The inner vial is tightly interfaced with the outer vial and sealed, allowing the inner vial and its matrix and contents to receive heat, light, electromagnetic radiation (such as microwaves), acoustic energy (such as sonication), pressure, or any other variety of treatments applied to the outside of the outer vial. The use of such external treatments, especially sonication and heat and pressure, can significantly reduce the reaction time of chemical and enzymatic reactions, or the time required to solubilize materials.

[0233] The present application conveniently provides a method for preventing contamination by immersing a solution to carry out such treatment (including but not limited to, for example, ultrasonic treatment and incubation) to a sample; in such a process, a device with a stopper cannot be relied upon to maintain sealing. In the lower parking position, the dead volume is minimized by a pin, which fills most of the void space in the output below the matrix. This allows the reaction of the minimum reaction volume and the maximum elution concentration, such as but not limited to an enzymatic reaction on, in, within or at the top of the matrix, or especially eluting from a chromatographic medium such as C18 or SCX. After the subsequent processing steps, once the outer vial receives the flow-through of the matrix or sample, the outer vial can be closed and sealed with its integrated cap to become a storage container for elution or processing materials; multiple outer vials can be used for multiple processing steps to produce multiple fractions, and the outer vial avoids sample transfer and matrix clogging. Therefore, the adsorption loss aggravated during frequent sample transfers is minimized. The outer vial has an inclined lower surface facing the flat surface of the D-shaped pin, thereby firstly forming an area into which the sample flows due to gravity and / or centrifugal force, and secondly providing sufficient space so that the sample can be removed or extracted or sampled by standard means, such as pipette tips or aspiration needles, as well as many other sample transportation and processing techniques. The design of the inner and outer vials can remain the same, but can be easily changed using many different matrices, allowing the system to be applied to many processing workflows. Finally, the Luer lock output of the inner vial is standard, easily connecting the inner vial to many other consumables and devices, such as the Sep-Pak C18 disposable SPE unit or a vacuum manifold, allowing the system to be flexible to accommodate the maximum number of workflows.

[0234] Representative embodiments of the spin column assembly 113 are described in detail at Figure 10-14 , and a representative embodiment of the 96-well plate format 115 is described in detail in Fig.15 and 16 It will be apparent to those skilled in the art that these are merely representative embodiments and that they are not limiting.

[0235] The inner vial 101 includes an opening 129 into which a liquid and / or solid sample can be deposited; a space 122 for containing the sample; a hinge 185 connected to a lid 237 having a tongue 281 for opening and closing; and a rib sealing mechanism 248 for sealing the inner vial during incubation, and the sealing mechanism has a vent that allows air pressure to equalize between the interior and exterior of the inner vial. The sample holding space 122 is connected to and exposed to a porous matrix 117 that is located in a conical section at the bottom of the inner vial to provide a better seal during manufacturing and operation by centrifugation or positive or negative pressure, although the cone is only a representative shape and is not limiting, and the matrix 117 is open at the bottom to a bottom opening 269 of the inner vial, which, in the specific embodiment presented, has the external dimensions of a Luer lock, but may have other dimensions. In the embodiment presented, the inner vial has three inverted U-shaped stops 153 (see Fig.13 ), if rotated to the correct angular offset between the inner and outer vial caps, the stopper may interface with the support (support mechanism 174) on the interior of the outer vial to support the inner vial 101 in an upper parked position, such as Fig.10 and 11 In this upper parking position, the sample can pass from space 122 through matrix 117, through bottom opening 269 of the inner vial and into sample receiving space 222 of the outer vial. However, if the inner vial is positioned so that the inner vial cap 237 and the outer vial cap 217 are directly above each other, as shown in FIG. Fig.12 and 14 As shown, the inner vial can pass through the bottom of the outer vial sealed by the tight interface 276 with the outer vial and the D pin 145 of the outer vial; this is the lower parking position (see Fig.12 and 14 ). In this way, the combination of the inner and outer vials eliminates the need for stoppers when processing through a matrix, especially when incubation is required. The output channel or bottom opening 269 of the inner vial 101 is designed to precisely fit the space at the bottom of the outer vial 109, especially the slope of the outer vial that provides the sample collection space (collection area 195).

[0236] The outer vial 109 comprises a vial having an opening configured to be in an upper parking position ( Fig.10 and 11 ) receives the inner vial 101, wherein the support rod engages in the stopper 153 of the inner vial, or in the lower parking position ( Fig.12 and 14), wherein the outer vial seals the inner vial via a tight interface 276 and a D pin 145. In the most preferred embodiment, the D pin 145 almost touches the substrate 117, thereby occupying most or all of the dead space of the output channel or bottom opening 269 of the inner vial. The outer vial has a lid 217 attached by a hinge 168, the lid having a tongue 299 for opening and closing it and a rib sealing mechanism 256 that interfaces with the lid 217. When the lid of the inner vial is aligned, the support rod does not engage the inner vial and the inner vial is closed by Fig.12 and 14 The lower parking position shown. The tight interface 276 is intentionally tight to most effectively transfer treatments, such as, but not limited to, transferring heat, light, ultrasonic energy, or electromagnetic energy applied to the outside of the outer vial at the bottom area of ​​the assembly to the inside of the inner vial, including to the matrix 117 and any materials bound on, in, or on top of the matrix, and any solution held in the sample holding space 122 of the inner vial. The bottom of the outer vial is tilted to form a sample collection area 195, which is directly opposite the flat side of the D pin; the D pin shape provides enough space for a normal-sized pipette tip to pass through the bottom of the sample collection area 195. The low nature of the sample collection area 195 allows the solution held in the sample holding space 222 of the outer vial to flow downward by gravity or centrifugation and be recovered by standard means, such as nearly quantitative pipetting. The D pin 145 and the form-fitting tight interface 176 between the inner and outer vials eliminate the need for stoppers when processing through the matrix.

[0237] Sample processing begins in the inner vial 101. When the inner vial 101 and the outer vial 109 are in an upper parked position maintained by using the locking / stopping / stopper / support mechanism 153 provided to the inner vial and the locking / stopping / support mechanism 174 provided to the outer vial, samples that do not require initial incubation or samples that have been incubated with the necessary reagents in a separate pouch can be immediately applied to the inner vial's internal sample holding space 112 through the upper opening 129 (see Fig.10 and 11 ). The sample may contain solid or coagulated or precipitated or flocculent material, or beads or other insoluble components, all of which may or may not be loaded with any liquid, depending on the experimental requirements. In the absence of an initial incubation, the inner and outer vial assembly 113 is then typically closed with a cap 237 that interfaces with the opening 129 of the inner vial having a rib sealing mechanism 248.

[0238] Alternatively and depending on the circumstances, the inner vial can be placed in the lower parking position ( Fig.12 and 14) and the inner space 122 can be preloaded with reagents, such as clotting reagents or precipitation or solubilization reagents. The sample can then be introduced directly into the liquid reagents and incubated in the inner vial for the desired time under the desired conditions.

[0239] During incubation, the inner vial 101 can be sealed with its cap 237 for incubation, the cap being bent at its hinge 185, which is operated manually or automatically by operating the tongue 281 to open or close. The incubation, which requires heat, causes the gas also contained in the interior space 122 to expand; therefore, the cap 237 of the inner vial has a vent 137 to allow the internal pressure to equalize with the atmosphere outside the inner vial 101. This same vent 137 provides that no vacuum is established during the transfer of the sample from the interior space 122 of the inner vial to the internal sample holding space 222 of the outer vial; this step occurs when the two parts are engaged in the upper parked position.

[0240] In the lower parking position ( Fig.12 and 14 ), the lower region 273 of the inner vial 101 and the outer vial 109 nest very tightly because the inner dimensions of the outer vial are determined to precisely match the outer dimensions of the inner vial at the interface 276. This tight interface facilitates flow from the outside of the outer vial to the inside of the inner vial, its contents, and substrate treatments, such as heat or light or electromagnetic radiation or acoustic energy, such as ultrasound treatment; such treatments are provided to the inner vial 101 and its contents by treating the lower region 273 of the engaged nested assembly 113 in the lower parked position, for example by placing at least the lower region 273 in an ultrasound bath, or by placing it in an incubator, or exposing it to light or microwaves, or other treatment methods. Exposure to such treatments can accelerate and promote chemical and enzymatic reactions, as well as solubilize or physically disrupt materials within the assembly.

[0241] In the lower parked position, the outer vial D pin 145 occupies primarily the dead space inside the output of the inner vial. This is important for minimizing reaction or elution volume, maintaining maximum concentration of analyte, and minimizing waste of potentially expensive reagents such as mass spectrometry grade enzymes (e.g., proteases).

[0242] When in the lower parked position, the tight fit seals the inner vial 101 to the outer vial 109 in the lower region 273, sealing the inner vial and preventing outflow from its interior space 122 or matrix 117, thereby eliminating the need for a stopper. The tightness of the interface 276 is also important because its volume is negligible, typically <10 μL and often <2 μL, depending on manufacturing consistency, so that any leakage from the interior space 122 of the inner vial 101 is confined to a small space because the solution level in the interface 276 is equal to the solution level on the interior space 122 of the inner column; if leakage of this volume occurs, it is negligible and acceptable. In fact, it is advantageous to fill any space remaining at the interface 276 with solution by centrifugation to promote the flow of external treatments (such as heat or ultrasound treatments) from the outside of the outer vial to the interior of the inner vial, including its matrix and contents. Those skilled in the art will recognize that the application can be scaled to much larger or smaller than the example provided, and these examples provided herein are not restrictive, and the exemplary dead volumes listed herein will vary with the scale of carrying out a specific embodiment. As previously mentioned, the application is scaled to fit a standard desktop centrifuge. The form specifically considered comprises the standard size for laboratory and analysis settings, such as pipe from 0.2mL to 2mL, comprising 0.5 and 1.7mL size, and conical tubes, such as 15 and 50mL conical tubes (Falcon tubes).

[0243] Regardless of whether the sample requires an initial incubation, after the incubation is complete, Fig.12 and 14 After any potential treatment, such as time or heat or ultrasound, is applied to the lower parking position shown, the inner vial 101 can be returned to the upper parking position within the outer vial 109, as shown. Fig.10 and 11 As shown. The sample in the sample holding space 122 of the inner vial can then be passed through the matrix 117 by centrifugation, gravity flow, or positive or negative pressure. Applying positive pressure requires that the lid 237 remain open. The typical force of the centrifuge assembly is 4,000g; it can be higher or lower, depending on the use and the strength of the matrix 117.

[0244] If the matrix has affinity or chromatography or filtration functions, the first fraction will be the flow-through fraction of the portion that passes through the matrix 117; this fraction will enter the sample holding space 222 of the outer vial. If necessary, washing can then be performed by moving the inner vial 101 to a new outer vial 109, which can capture the wash solution if necessary. Alternatively, the wash solution can go directly into the flow-through, depending on the needs of the experiment.

[0245] Whether washed or not, the material bound or retained in, on or by the matrix 117 is ready for further processing. The inner column is pulled up to disengage the locking / support mechanism 153, and the inner vial, which may be in a new outer vial, is placed in the lower parking position to seal the inner vial with the outer vial. The processing reagent is then added to the interior of the inner vial through the opening 129, into the sample holding and processing space 122. Most typically, the assembled inner and outer vials will be subjected to centrifugation to displace all air from the matrix 117 and fill any dead space with the processing reagent. The most common processing reagents include: elution solutions, such as aqueous buffers for eluting nucleic acids or hydrophobic solvents for dissolving lipids or other hydrophobic compounds, in both cases and others, heat and / or sonication may be applied to help dissolve and elute the fractions of interest; enzymes, such as proteases, such as trypsin, pepsin, chymotrypsin, Lys-C, Lys-N, Asp-N, Glu-C, Arg-C, and Tryp-N, of which there are hundreds to thousands of nucleases, glycosidases, such as PNGase F, and other enzymes or proteins, such as HRP conjugated enzymes or antibodies or proteins; chemical treatments, such as derivatization using reactive chemicals, such as isothiocyanates, such as FITC or NHS esters or isobaric labels or cysteine ​​labels, and many other reactions, or reduction and alkylation; or other treatments. These treatments are then provided with the necessary time, temperature, energy addition, whether from heat or sonication, etc., to complete the treatment. After the treatment is completed, the inner vial 101 is moved again to the upper parking position, such as Fig.10 and 11 As shown, the sample portion released from the matrix is ​​again pushed through the matrix 117 by pressure or centrifugation.

[0246] Such treatment can be continuous, each time may occur in a new outer vial, and each time a new fraction of the sample is released, which is retained or bound on, in or by the matrix. For example, in the case of a coagulant such as an organic solvent, the organic solvent is first added to the inner vial in the lower parking position, and then the sample (e.g., serum containing ammonium acetate) is added to the coagulant and the sample is passed through a matrix 117, which is suitable for capturing the biopolymers of the sample after the inner vial is lifted to the upper parking position, and the first fraction obtained will be small molecules. If the inner vial is then returned to the lower parking position in a new outer vial and an aqueous solution is applied, particularly with the help of heat and / or sonication, once the inner vial is again in the upper parking position, the nucleic acid can be dissolved and eluted. The inner vial is returned to the new outer vial in the lower parking position, and the retained and bound biopolymers can be treated with PNGase F to release polysaccharides. The inner vial is placed in the upper parking position again, and the polysaccharides are eluted. Placing the inner vial into a new outer vial can expose the protein to reduction using, for example, TCEP and alkylation using, for example, MMTS. After reduction and alkylation, the protein can be washed away from the reagents, most likely into a waste tube, and as a final step, a protease such as trypsin can be applied to process the protein bound or retained on or in the matrix or bound or retained by the matrix into peptides. This reaction can be accelerated by heat and sonication applied to the lower region 273 of the assembled inner and outer vials, provided by the close interface 276 between the inner and outer vials.

[0247] Figure 10-14 The embodiment shown in FIG. 1 requires rotation to engage the inverted U-shaped stop 153 with the corresponding support mechanism 174 of the outer vial. Those skilled in the art will appreciate that many such locking mechanisms are possible, including support posts that hold the inner vial, or that allow the inner vial to seal against the outer vial when placed in a recess (see FIG. 1 ). Fig.18 ); push-on bumps or buckles or ridges for supporting the inner vial at different vertical heights within the outer vial ( Figure 21-22 ), which may have radial breaks inside and outside the outer vial to allow the tabs or buckles or ridges to be rotated ( Fig.21 ) or thread ( Fig. 22 Alternatively, there are embodiments in which the locking mechanism allows or inhibits flow through the matrix by a side release design, in which the outer vial seals or does not seal the inner vial depending on the rotational position, and in which a snap-fit ​​locking mechanism can be considered to provide a seal ( Fig.19 ).

[0248] Notably, the Luer lock allows a tubular column such as an SPE tubular column such as C18 Sep-Paks to be reversibly connected directly to the inner vial. Such a tubular column can have any of the affinities listed for matrix 117 and makes the assembly particularly flexible and able to use currently existing sample preparation and chromatography products.

[0249] The above steps and methods and assemblies are easily parallelized by preparing arrays of single columns, such as Fig.15 and 16 Such an embodiment maintains exactly the same tight seal and interface mechanism (interface 276), D pin 145, matrix 117, sample collection area 195, and sample receiving space (122) of the inner vial and sample receiving space (222) of the outer vial. The difference lies in the mechanism for supporting the upper and lower parking positions. Fig.15 and 16 In the embodiment, two supports 326 and 331 are present on the side tongues supported by hinges 311, which allow the side tongues to be engaged or disengaged in the upper and lower parking positions by swinging outwards. Fig.15 In the lower parking position where the inner plate 303 is sealed with the outer plate 308, the support members (support tongues) 326 on both sides are maintained, and the support tongues press the inner plate 303 downward against the outer plate 308. Fig.16 In the example of the embodiment of the present invention, the supports (support tongues) 331 on both sides lift the inner space upward so that the contents of the inner plate in the sample holding space 122 can flow through the matrix 117 and enter the sample holding space 226 of the outer plate through the bottom opening 269 of the inner plate. There is no difference in the use or processing steps between the separate centrifugal columns and plates, with the only exception that the plates or other arrays must be supported in a slightly different manner. A person skilled in the art can envision a variety of mechanisms to support the inner plate in the sample holding space 226 of the outer plate, including, for example, clips or support rings or collars or tongues, which can be integrated into the inner plate or the outer plate, or both, or it can be a third part, or a column or support that is raised or folded to provide upper and lower parking positions.

[0250] The present application is further illustrated by the following examples which should not be construed as limiting.The contents of all references, patents and published patent applications, as well as the figures and tables cited throughout this application are incorporated herein by reference.

[0251] Example

[0252] This work outlines and demonstrates the concept of SiTrap, a simultaneous capture technology for detergent-free proteomics and metabolomics sample preparation, which can be extended to many other classes of molecules, such as DNA, RNA, and glycans, including those covalently linked to proteins. The SiTrap approach provides the opportunity to perform simple and robust multi-omics analysis on the same sample, which has a major impact on comparative biological inference in omics data, high-throughput omics analysis, and is critical when working with limited sample amounts in translational medicine research.

[0253] method

[0254] SiTrap Tips

[0255] SiTrap tips are made of cellulose or quartz depth filter material. 1.6 mm diameter plugs are inserted into pipette tips (D200, Gilson). SiTrap cellulose tips are used for cell and tissue analysis. For sample processing steps involving centrifugation (loading, washing, and elution), the tips are placed in 2.0 or 1.5 ml sample tubes with the help of a tube connector.

[0256] Sample processing

[0257] Cell pelleting

[0258] MDA-MB-231 cell pellets (1,000,000 cells per pellet) were lysed by probe sonication in 250 μl of lysis solution for SiTrap (30 mM ammonium acetate, 1.8% ammonium hydroxide (prepared by diluting a 28% ammonium hydroxide stock solution (Sigma)), 3% SDS in a 30 mM ammonium acetate solution, 3% P407 in a 30 mM ammonium acetate solution) and 3% SDS in 50 mM Tris-HCl pH 7.6 for SDS-based methods. The extracts were clarified by centrifugation at 11,000 g for 2 min at 18°C. Protein concentration was measured by Pierce BCA protein assay kit (Thermo). In each case, 30 μg of protein was processed in six replicates. For ammonium acetate (AA) extraction SiTrap treatment, four volumes of methanol containing 30 mM AA were added to the lysate, whereby anhydrous methanol from a 1 M ammonium acetate stock solution in water was supplemented to 30 mM AA. For ammonium hydroxide (AH) extraction of SiTrap, an equal volume of 1 M acetic acid was added to the lysate, followed by two volumes of methanol. The sample was loaded onto a SiTrap cellulose tip. The tip was inserted into a 2.0-ml sample tube and centrifuged at 2000 g to capture the protein. The captured protein was washed by adding 80 μl of a 50% methanol solution in 30 mM AA to the tip, followed by centrifugation at 2500 g for 30 seconds. The tip was removed and placed in a 1.5-ml sample tube. The captured protein was further denatured, reduced, and alkylated in situ by adding a 60 mM triethylammonium bicarbonate (TEAB), 10 mM tris(2-carboxyethyl)phosphine (TCEP), 25 mM chloroacetamide (CAA) solution to the tip, followed by heating at 80 ° C for 30 min (the reduction / alkylation solution should be prepared before the start of the experiment and vortexed thoroughly before use). After washing with 80 μl 20mM TEAB at 2500g for 30 seconds, the tip was removed and placed in a new 1.5-ml sample tube. 20 μl sequencing grade trypsin (Promega) in 100mM ammonium bicarbonate at a concentration of 0.07 μg / μl was added to the tip. The trypsin solution was pushed down using a syringe with the aforementioned custom tip connector until the solution meniscus was approximately 3 mm above the top of the cellulose plug. Trypsin digestion was completed by incubation at 47°C for 1 hour. Post-digestion elution was performed continuously with 70 μl 300mM ammonium bicarbonate and 70 μl 3% formic acid. Peptides were concentrated using C8 grade tips for downstream analysis by mass spectrometry. For SDS treatment, 30 μg of protein was treated with trypsin after SDS removal. Digestion, peptide elution and concentration were the same as SiTrap.

[0259] Those skilled in the art will recognize that the tip format is only one embodiment of many different physical formats, such as many different formats of plates or spin columns or tubular columns. Specifically and not exclusively, the present application can be embodied in 96-well or 384-well plates or many other formats, especially including tubular columns and units integrated with chromatographic media or chromatographic separation systems, and such embodiments can also be combined with sample collection and / or storage.

[0260] Kidney tissue

[0261] Frozen renal tissue from three matched clear cell renal carcinoma (G2pT3a, G2pT1b, G1pT2) / adjacent normal sample pairs were obtained from the Leeds Multidisciplinary Research Tissue Bank. Approximately 1 cm 2 Sections were cut at 10 μm thickness and placed in 1.5 ml sample tubes. 80 μl of 1.8% ammonium hydroxide was added to the tubes and the tissue was lysed by probe sonication. The tubes were centrifuged at 11,000 g for 2 minutes at 18 °C to remove debris. The supernatant was removed for further processing. SiTrap loading was normalized by protein concentration. 50 μg of protein was loaded into SiTrap cellulose tips as described above for ammonium hydroxide lysates. The collected protein-free flow-through fractions were dried using Speed-Vac for targeted metabolomics analysis. The captured protein fractions were then digested as described above and the resulting peptides were concentrated for proteomics analysis.

[0262] SiTrap serum processing method

[0263] SiTrap quartz tips were constructed as described in this document. Serum from healthy volunteers was obtained from the Leeds Multidisciplinary Research Tissue Bank. 0.5 μl of serum was directly solubilized with 25 μl of 5% SDS in 50 mM Tris-HCl pH 7.6 for protein solubilization and trypsin digestion in OQ STrap tips (a total of 6 replicates), or processed by SiTrap, diluted with 30 μl 20 mM TEAB buffer, and fractionated on SiTrap quartz tips to produce two fractions, "capture fraction" and "flow-through fraction" (3 replicates for each fraction, a total of 6 samples). The diluted TEAB serum was loaded into the SiTrap quartz tip and gently pushed through with the aid of a syringe with a tip connector to collect the "flow-through" fraction. The tip with the "capture" fraction was inserted into a 2.0-ml sample tube and washed continuously with 100 μl and 40 μl 20 mM TEAB using 2500 x g centrifugation. The captured proteins were reduced / alkylated and digested in the same manner as described for cell lysates in the methods. The "flow-through" fraction was diluted with six volumes of 30 mM ammonium acetate in methanol and then captured and digested in another SiTrap tip in the same manner as the "capture" fraction. The resulting peptides were analyzed by LC-MS / MS using a 100 min acquisition time as described in the methods. The acquired data were processed as described below.

[0264] Proteomics

[0265] Peptides were separated online by reversed-phase capillary liquid chromatography using an EASY-nLC 1000 system (Proxeon) connected to a custom-made 30-cm capillary emitter column (75 μm inner diameter, packed with 3 μm Reprosil-Pur 120C18 media, Dr. Maisch). The chromatographic system was interfaced to a linear quadrupole ion trap-orbitrap (LTQ-Orbitrap) Velos mass spectrometer (Thermo). The total acquisition time was 100 min for cell analysis and 140 min for tissue analysis; the main part of the chromatographic gradient was 3%-22% acetonitrile in 0.1% formic acid. Survey MS scans (scan range 305–1350 amu) were acquired in the orbitrap with a resolution set to 60,000. Up to 20 of the most intense ions from each scan were fragmented and analyzed in the linear trap. Data were processed using the MaxQuant 1.5.2.8 software package for the Uniprot human protein sequence database (October 2018) (www.maxquant.org) (Cox, J., Mann, M., MaxQuant enables high peptide identification rates, individualized ppb-range mass accuracy and proteome-wide protein quantification. Nature biotechnology 2008, 26, 1367-1372). Carbamidomethylation of cysteine ​​was set as a fixed modification, and oxidation of protein N-terminal acetylation and methionine was used as variable modifications. Up to three missed cuts and at least one unique peptide for valid protein identification were selected. The maximum protein and peptide false discovery rate was set to 0.01. Gene ontology (GO) feature analysis was performed using Panther 14.0 (www.pantherdb.org) (Thomas, PD, Campbell, MJ, Kejariwal, A., Mi, H. et al., PANTHER: a library of protein families and subfamilies indexed by function. Genome Res 2003, 13, 2129-2141).The Perseus software package 1.6.2.3 (https: / / maxquant.net / perseus / ) (Tyanova, S., Temu, T., Sinitcyn, P., Carlson, A. et al., The Perseus computational platform for comprehensive analysis of (prote)omics data. Nat Methods 2016, 13, 731-740.) was used for volcano plot significance analysis - the mean LFQ intensity of the proteins was log2 transformed and their differences were plotted against the corresponding p-values ​​of the t-test, with the significance cutoffs of FDR set to 0.05 and S0 set to 0.01. For data comparison, only proteins identified by at least two peptides and one unique peptide were used.

[0266] Metabolomics

[0267] Targeted metabolome analysis of acylcarnitines, free fatty acids, and bile acids by LC-MS

[0268] A solution of 10 μM palmitoyl-L-carnitine-(N-methyl-d3) (Sigma), 10 μM palmitic acid-d31 (Sigma) and 10 μM deoxycholic acid-d6 (Sigma) in LC-MS grade methanol was prepared as an internal standard spike solution (ISSS). The sample was reconstituted in 100 μl LC-MS grade water and 100 μl ISSS, vortexed and sonicated for 30 min, then transferred to an LC vial. Chromatography was performed using an ACQUITY UPLC system (Waters) equipped with a CORTECS T3 2.7 μm (2.1×30 mm) column, which was maintained at 60° C. The ACQUITY UPLC system was coupled to a Xevo TQ-XS mass spectrometer (Waters Corporation). The binary solvent system used was solvent A, which contained LC-MS grade water, 0.2 mM ammonium formate, and 0.01% formic acid; and solvent B, which contained analytical grade acetonitrile / isopropanol 1:1, 0.2 mM ammonium formate, and 0.01% formic acid. For all analyses, a 10 μl injection was used and the mobile phase was set to a flow rate of 1.3 ml / min. For the acylcarnitine analysis, the column mobile phase was held at 2% solvent B for 0.1 min and then increased from 2% to 98% solvent B over 1.2 min. The mobile phase was then held at 98% solvent B for 0.9 min. The mobile phase was then returned to 2% solvent B for 0.1 min to re-equilibrate the column. For the free fatty acid analysis, the column mobile phase was increased from 50% to 98% solvent B over 0.7 min. The mobile phase was then held at 98% solvent B for 0.5 min. The mobile phase was then returned to 50% solvent B for 0.1 min to re-equilibrate the column. For bile acid analysis, the column mobile phase was held at 20% solvent B for 0.1 min and then increased from 20% to 55% solvent B in 0.7 min. The mobile phase was increased to 98% solvent B and held for 0.9 min. The mobile phase was then returned to 20% solvent B for 0.1 min to re-equilibrate the column. Analysis was performed using multiple reaction monitoring (MRM). The transition and ionization conditions are given in Tables 1, 2, and 3. For acylcarnitine analysis, the Xevo TQ-XS was operated in positive electrospray ionization (ESI) mode. For free fatty acid and bile acid analysis, the Xevo TQ-XS was operated in negative ESI mode. A conical gas flow rate of 50 ml / h and a desolvation temperature of 650°C were used.

[0269] Metabolomics data analysis

[0270] Data were processed and peak integrated using the Waters Targetlynx application (Waters Corporation). The integrated acylcarnitine, free fatty acid, and bile acid peak areas were normalized to palmitoyl-L-carnitine-(N-methyl-d3), palmitic acid-d31, or deoxycholic acid-d6 internal standards, respectively.

[0271] Metaboanalyst version 4.0 was used for multivariate data analysis (Chong, J., Soufan, O., Li, C., Caraus, I. et al., MetaboAnalyst 4.0: toward more transparent and integrative metabolomics analysis. Nucleic Acids Res 2018, 46, W486-W494.). The data set was centered on the mean and analyzed using principal component analysis (PCA) and partial least squares discriminant analysis (PLS-DA). Metabolite changes that lead to clustering or regression trends within the pattern recognition model were identified by querying the corresponding loading graph. If the metabolites determined in the variable importance in the prediction / coefficient graph promote separation in the model with a 95% confidence limit, they are considered to have changed globally. These were verified using univariate volcano plots with a fold change cutoff of 1.2 and a P value cutoff of 0.05.

[0272] Table 1. Multiple reaction monitoring parameters for acylcarnitine species. Acylcarnitines are designated by the carbon length of the acyl chain and the degree of double bond unsaturation. Internal standard (IS).

[0273]

[0274] Table 2. MRM parameters for free fatty acid species. Free fatty acids are designated by carbon length of acyl chain and degree of double bond unsaturation. Internal standard (IS).

[0275]

[0276]

[0277] Table 3. Multiple reaction monitoring parameters for bile acid species. Internal standard (IS).

[0278]

[0279]

[0280] A SiTrap in tip form is prepared according to the disclosure of the present application, and a portion of the sample is added according to the present disclosure so that 50 μg of protein is captured in a capture matrix with a total volume of 150 μL of ammonium acetate and methanol; there will be more than 50 μg of total captured molecules because DNA, RNA and glycans and other molecules will be captured. The flow-through containing small molecules and lipids is retained and will be used for lipidomics and metabolomics analysis. Some lipids and small molecules can be retained. DNA and RNA are first eluted by adding 3x50 μL TE buffer commonly used in molecular biology; this fraction can be analyzed by transcriptomics, RNAseq and genomics techniques. The sample is then treated with 2 μg PNGase F in 50 μL phosphate buffer at 37C for at least one hour and until overnight. Glycans are centrifuged and recovered for glycomic analysis. As described below, the protein is reduced and alkylated. 2 μg of trypsin is added to 40 μL of 50 mM TEAB (pH 8.5), and the proteins are digested at 47°C for 1 hour; other incubation times and temperatures can be added. The capture matrix can be sonicated or ultrasonicated to accelerate digestion. The resulting peptides are used for proteomic analysis. Alternatively, proteins can be eluted by sonication in, for example, 40 μL of 60% formic acid, 8 M urea, or 6 M GuHCl for top-down proteomics; these reagents are best suited for sonication.

[0281] To address the needs of multi-omics analysis, where detergents or chaotropes or other solubilizing agents prevent downstream analysis of molecules not bound to the capture matrix, the systems, devices, processes and methods designed herein match the protein handling capabilities and simplicity of detergent-based methods, but use detergent-free compositions for lysis, allowing in situ reduction / alkylation of captured proteins after capture, thereby providing a contaminant-free flow-through fraction for complementary "omics" analysis. The process can be automated to make a sample processor.

[0282] Example 1

[0283] When using cell lysates and nonionic detergents such as octylglucoside and poloxamer 407, it was unexpected that cellulose or quartz depth filters could be used at near neutral pH ( Figure 1) captures proteins in their native state under conditions of . This is surprising and represents a major new advance that makes this method possible. The capture is robust. Those skilled in the art will recognize that there are many other surfactants and detergents. Unexpectedly, additional in situ denaturation, reduction, alkylation and washing steps are possible, followed by digestion in the device and capture matrix. Those skilled in the art will recognize that many reducing and alkylating agents can be used. The present application provides such optimal compositions and methods: they can lyse cells and samples and organisms without detergents, capture extracted proteins and other molecular classes such as DNA and glycans in situ, while separating and retaining metabolites and lipids and small molecules in the flow-through, and further allowing the retained molecules to be treated, for example, by enzymatic digestion, such as with proteases or nucleases or glycosidases. The present application shows that sonication of cell pellets at near neutral or alkaline pH values ​​can effectively release proteins into solution with extraction efficiencies similar to SDS ( Figure 2 ); This application shows that proteins can be captured by cellulose or quartz depth filter traps. Those skilled in the art will recognize that many other filter materials or porous materials can be used, as described above, as long as proteins are captured.

[0284] To outline SiTrap cell processing, cells are first sonicated in excess 30 mM ammonium acetate (AA) or 1.8% ammonium hydroxide (AH) followed by centrifugation to remove debris. Lysis with AH and analysis of UV absorbance at 280 nm in a micro-volume spectrophotometer provides a rough direct estimate of protein concentration in cell lysates. 10 . If AA extraction was used, four volumes of methanol containing 30 mM AA were added to the lysate. The sample was loaded into a SiTrap tip containing a depth filtration compartment, where the proteins were immediately captured. If AH extraction was used, an equal volume of 1 M acetic acid was first added to the lysate to bring the pH close to neutral, and then two volumes of methanol were added before loading into the SiTrap tip. The resulting flow-through was collected for additional “omics” processing. The captured proteins were denatured, reduced, and alkylated in situ by heating at 80 °C in a solution of 60 mM triethylammonium bicarbonate (TEAB), 10 mM tris(2-carboxyethyl)phosphine (TCEP), 25 mM chloroacetamide (CAA). After washing, trypsin was added and the sample was incubated at 47 °C for one hour to digest the proteins. The peptides were eluted and then purified using C8 or C 18 Stage tip concentration for mass spectrometry (MS) analysis ( Figure 3 A). It is noteworthy that DNA is also co-captured and other enzymes such as glycosidases can be used to extend the application to other molecular classes.

[0285] To test the proteomic performance of the new SiTrap method, it was compared with SDS-based sample preparation. MDA-MB-231 cells were extracted using AA or AH by cell lysis and probe sonication on ice, followed by SiTrap trypsin treatment in cellulose SiTrap tips ( Figure 4 ) or cell lysis and probe sonication with SDS followed by digestion. In each case, 30 μg of protein was processed in six replicates. Both samples were trypsin digested at 47°C for one hour. This test identified 1293 (±12SD) proteins, and an average of 1278 (±44SD) proteins were identified using SDS with at least two peptides identified using AA or AH SiTrap cleavage, respectively. This is comparable to the average number of 1230 (±27SD) proteins identified for SDS cleavage ( Figure 3 B). The distribution of proteins in the major GO cellular component categories was very similar in all cases ( Figure 3 C), and most proteins were identified by all three methods, indicating that there was no bias ( Figure 3 D).

[0286] Example 2

[0287] Comparative proof-of-principle proteomic / metabolomics analysis studies using clear cell renal carcinoma and corresponding adjacent non-cancerous tissue sections explored the ability of the SiTrap method and device to provide a simultaneous multi-omics analysis platform. Those skilled in the art will recognize that this is merely an exemplary embodiment and not limiting. Tissue sections (three normal / tumor pairs) were lysed by sonication with AH, the lysates were loaded into SiTrap cellulose tips, the flow-through fractions were collected for targeted metabolomics analysis, and the captured proteins were digested for proteomics analysis. Proteomics analysis generated a proteomic data set of 2655 proteins. Targeted metabolomics screening included 62 species of three metabolite categories-26 free fatty acids, 20 acylcarnitines, and 16 bile acids. These 59 metabolites were observed and quantified-25 free fatty acids, 19 acylcarnitines, and 15 bile acids. Metabolomic analysis showed that short-chain acylcarnitines (C5, C5:1, and C3) and polyunsaturated free fatty acids (C20:5, C20:4, and C22:6) were reduced in tumor samples. Figure 5 A. Figure 6 A). Enzymes that play a key role in acylcarnitine metabolism, namely carnitine O-acetyltransferase (CRAT), carnitine O-palmitoyltransferase 2 (CPT2), and carnitine O-palmitoyltransferase 1 (CPT1A), were identified and quantified, and found to be significantly decreased in tumor samples, consistent with the metabolomics results ( Figure 5 B. Figure 6B). In agreement with the metabolomics results, tumor samples were significantly reduced in other enzymes related to polyunsaturated fatty acid metabolism: acyl-CoA thioesterase 1 (ACOT1), which releases C20:4, C20:5, and C22:6 from CoA equivalents, and long-chain fatty acid CoA ligase (ACSL1), which activates long-chain fatty acids to form acyl-CoA. Figure 5 B).

[0288] Example 3

[0289] When processing serum samples, it was observed that at alkaline pH, such as when diluted in 20 mM TEAB, serum albumin was not captured by the depth filter. However, many other serum proteins were captured ( Figure 7 ). This simple serum fractionation produces two fractions – a captured fraction, free of albumin, which can be processed directly by SiTrap tips. The alternative flow-through “albumin” fraction can then be diluted with six volumes of 30 mM ammonium acetate in methanol and then captured and digested in another SiTrap unit. To test this approach, 0.5 μl of human serum from healthy volunteers was either digested directly by the STrap technique (a total of 6 replicates) or diluted with 20 mM TEAB buffer and processed by fractionation using SiTrap quartz tips. SiTrap treatment produces two fractions, capture and flow-through (3 replicates each for a total of 6 samples). MS results from trypsin digests of 6 samples from each method were combined. SiTrap fractionation resulted in approximately 30% increase in protein identifications compared to the direct method ( Figure 7 B, C). This example demonstrates the fractionation of serum into two or more fractions.

[0290] Example 4

[0291] SiTrap sample processing is also suitable for FFPE samples due to their ubiquity in pathology, stability at room temperature, and the sheer number of FFPE samples. These samples, while representing a rich resource, are difficult to work with due to their formalin-crosslinked nature and being embedded in wax. Surprisingly, SiTrap worked well. Human kidney FFPE tissue was dewaxed by standard xylene / ethanol treatment and then lysed in 30mM ammonium acetate by probe sonication. Approximately 50μg of the resulting protein lysate was processed by either SiTrap or SDS methods. For SiTrap – 4 volumes of methanol in 30mM ammonium acetate were added to the lysate and proteins were then captured in SiTrap cellulose tips, which were further washed with 60% methanol in 30mM ammonium acetate and the flow-through was collected (FT1). A solution of 10mM TCEP / 30mM chloroacetamide / 60mM TEAB was then added and the tips were heated at 95C for 1 hour. The tips were then washed with 20mM TEAB and the flow-through was collected (FT2). The captured proteins were digested by two consecutive digestions of 1.25 μg trypsin (Promega) (trypsin concentration 0.07 μg / μl) in 100 mM ammonium bicarbonate at 48°C for 1 hour. The digestion products were eluted continuously with 50% acetonitrile in 500 mM ammonium bicarbonate and 0.2% formic acid. The remaining material was eluted with 2X Laemmli buffer. For SDS treatment, the lysate was mixed with an equal volume of 5% SDS in Tris-HCl pH7.6, DTT was added to a final concentration of 20 mM, and the sample was heated at 95°C for 1 hour. Chloroacetamide was added to a final concentration of 120 mM, followed by incubation for 30 min. SDS was cleared from the sample by standard protocols, and the flow-through (FT) was collected. Similar to SiTrap, the proteins were digested by two consecutive digestions of 1.25 μg trypsin (Promega) (trypsin concentration 0.07 μg / μl) at 48°C for 1 hour. The digestion products were eluted sequentially with 50% acetonitrile in 500 mM ammonium bicarbonate and 0.2% formic acid. The remaining material was eluted with 2X Laemmli buffer. This example demonstrates the application of SiTrap technology in FFPE tissues ( Figure 8 ).

[0292] Example 5

[0293] An exemplary embodiment of the present application includes capturing proteins and small molecules as described herein from a one-volume sample, wherein the sample is sonicated in a 30 mM ammonium acetate extraction solvent to physically disrupt the sample, mixed with four volumes of methanol containing 30 mM ammonium acetate, thereby supplementing anhydrous methanol from a 1 M ammonium acetate stock aqueous solution to 30 mM ammonium acetate. The mixture is then applied to a cellulose depth filter used as a capture matrix, and the flow-through containing small molecules, specifically cells, and not limited to metabolites and lipids is retained for metabolomics and lipidomics analysis. The protein is then reduced and alkylated in situ by heating at 80° C. in 60 mM triethylammonium bicarbonate (TEAB), 10 mM tris(2-carboxyethyl)phosphine (TCEP), 25 mM chloroacetamide (CAA), and the depth filter material is washed with 50% methanol in 30 mM ammonium acetate or 20 mM TEAB, and centrifuged at 2500 g for 30 seconds. 1.4ug trypsin (Promega) was added to 20uL 100mM ammonium bicarbonate and the captured proteins were digested into peptides by incubation at 47C for 1 hour. Post-digestion elution was performed sequentially with 70μl 300mM ammonium bicarbonate and 70μl 3% formic acid. Peptides were concentrated using C8 Stage tips for downstream analysis by mass spectrometry; this C8 treatment can be integrated below the capture matrix. This example demonstrates the multi-omics nature of SiTrap.

[0294] Example 6

[0295] Unless otherwise indicated, some experiments were analyzed on an Agilent 6546QTOF using the following peptide analysis settings: 300–1700 m / z, acquired in AutoMS2 positive mode using a dual AJS ESI source, 325°C gas temperature at 13 L / min, 275°C shield gas temperature. MSMS used a 5000MS absolute precursor threshold and 0.01% relative threshold to obtain a moderate isolation width, a target of 50,000 counts per spectrum, and active exclusion enabled; VCap was set to 3500 and the fragmentor was set to 175V. The Agilent 1290 Infinity LC system was used on a 2.1 mm x 150 mm C18 column running at 0.3 mL / min with a gradient between buffer A (0.1% formic acid in water) and buffer B (100% LCMS grade acetonitrile), holding at 5% B for 2 minutes, then ramping to 40% B over 50 minutes, holding at 90% B for 5 minutes, and then gradually decreasing to 5% B. The column was a 2.1 x 150 mm Agilent AdvanceBio Peptide Assay Column. Figure 2 .7 μm column (Catalog #653750-902) maintained at 60°C.

[0296] Unless otherwise specified, metabolites were analyzed on an Agilent 6546QTOF using the following peptide analysis settings: Data were acquired at 300–1700 m / z in AutoMS2 positive mode using a dual AJS ESI source, 350°C gas temperature at 5 L / min and 350°C shield gas temperature at 10 L / min. MSMS used a 5000MS absolute precursor threshold and 0.01% relative threshold to obtain a medium separation width, a target of 50,000 counts per spectrum, active exclusion disabled, and an isotope model set to common organic molecules; VCap set to 3500 and fragmentor set to 175 V. An Agilent 1290 Infinity LC system was used, running at 0.8 mL / min on a 2.1 mm x 50 mm Agilent EclipsePlus C18 column (RRHD 1.8 μm) with a gradient between buffer A (water with 0.1% formic acid) and buffer B (100% LCMS grade acetonitrile) (see table below for gradient). The column was kept at 40°C. The gradient was as follows:

[0297]

[0298]

[0299] Fig.10 The SiTrap columns for the 14-well are made of TPX plastic using plastic injection molding. Using a pneumatic punch and press system, the inner column is loaded with a porous matrix made of quartz, glass fiber, polymer, cellulose, or cellulose with a filler such as diatomaceous earth. In some experiments, the matrix is ​​provided with functional groups by derivatization. In other experiments, the matrix is ​​layered on a chromatographic medium such as C18 or SCX. In other experiments, the inner vial receives a bottom and top frit for containing the chromatographic medium.

[0300] Example 7

[0301] Detection of SARS-CoV-2 using the disclosed methods and disclosed physical embodiments

[0302] The following examples demonstrate the use of this system to detect SARS-CoV-2 nucleocapsid protein, one of the more abundant proteins in the SARS-CoV-2 virus. Due to the BSL level of the laboratory where the experiment was performed, infectious viruses were not directly analyzed. Instead, nucleocapsid proteins were recombinantly prepared and spiked into sputum. Those skilled in the art will recognize that this embodiment is not restrictive, is applicable to live viruses and infectious viruses within the range of detection sensitivity, and is used to demonstrate the applicability of the method to diagnosis. Those skilled in the art will also recognize that this embodiment can be extended to other viruses and pathogens with different gene sequences and therefore different protein sequences by only changing the detection parameters. The steps of this embodiment are repeated in other embodiments.

[0303] Human embryonic kidney HEK293 cells (approximately 1.5E6 cells / well, 6-well plate) were transfected with plasmid pCI-SARS-CoV-2-nucleoprotein (2ug plasmid per well) using Lipofectamine 2000. The ORF of SARS-CoV-2 nucleoprotein was PCR amplified from a synthetic DNA clone. The nucleoprotein ORF sequence contained in the pCI-SARS-CoV-2-nucleoprotein plasmid is as follows:

[0304] ATGTCTGATAATGGACCCCAAAATCAGCGAAATGCACCCCG

[0305] CATTACGTTTGGTGGACCCTCAGATTCAACTGGCAGTAACCAGA

[0306] ATGGAGAACGCAGTGGGGCGCGATCAAAACAACGTCGGCCCC

[0307] AAGGTTTACCCAATAATACTGCGTCTTGGTTCACCGCTCTCACT

[0308] CAACATGGCAAGGAAGACCTTAAATTCCCTCGAGGACAAGGCG

[0309] TTCCAATTAACACCAATAGCAGTCCAGATGACCAAATTGGCTAC

[0310] TACCGAAGAGCTACCAGACGAATTCGTGGTGGTGACGGTAAAA

[0311] TGAAAGATCTCAGTCCAAGATGGTATTTCTACTACCTAGGAACT

[0312] GGGCCAGAAGCTGGACTTCCCTATGGTGCTAACAAAGACGGCA

[0313] TCATATGGGTTGCAACTGAGGGAGCCTTGAATACACCAAAAGAT

[0314] CACATTGGCACCCGCAATCCTGCTAACAATGCTGCAATCGTGCT

[0315] ACAACTTCCTCAAGGAACAACATTGCCAAAAGGCTTCTACGCA

[0316] GAAGGGAGCAGAGGCGGCAGTCAAGCCTCTTCTCGTTCCTCAT

[0317] CACGTAGTCGCAACAGTTCAAGAAATTCAACTCCAGGCAGCAG

[0318] TAGGGGAACTTCTCCTGCTAGAATGGCTGGCAATGGCGGTGATG

[0319] CTGCTCTTGCTTTGCTGCTGCTTGACAGATTGAACCAGCTTGAG

[0320] AGCAAAATGTCTGGTAAAGGCCAACAACAACAAGGCCAAACT

[0321] GTCACTAAGAAATCTGCTGCTGAGGCTTCTAAGAAGCCTCGGC

[0322] AAAAACGTACTGCCACTAAAGCATACAATGTAACACAAGCTTTC

[0323] GGCAGACGTGGTCCAGAACAAACCCAAGGAAATTTTGGGGAC

[0324] CAGGAACTAATCAGACAAGGAACTGATTACAAACATTGGCCGC

[0325] AAATTGCACAATTTGCCCCCAGCGCTTCAGCGTTCTTCGGAATG

[0326] TCGCGCATTGGCATGGAAGTCACACCTTCGGGAACGTGGTTGA

[0327] CCTACACAGGTGCCATCAAATTGGATGACAAAGATCCAAATTTC

[0328] AAAGATCAAGTCATTTTGCTGAATAAGCATATTGACGCATACAA

[0329] AACATTCCCACCAACAGAGCCTAAAAAGGACAAAAAGAAGAA

[0330] GGCTGATGAAACTCAAGCCTTACCGCAGAGACAGAAGAAACA

[0331] GCAAACTGTGACTCTTCTTCCTGCTGCAGATTTGGATGATTTCTC

[0332] CAAACAATTGCAACAATCCATGAGCAGTGCTGACTCAACTCAG

[0333] GCCTAA

[0334] The amino acid sequence of the expressed nuclear protein is as follows:

[0335] MSDNGPQNQRNAPRITFGGPSDSTGSNQNGERSGARSKQRRPQGLPNNTASWFTALTQHGKEDLKFPRGQGVPINTNSSPDDQIGYYRRATRRIRGGDGKMKDLSPRWYFYYLGTGPEAGLPYGANKDGIIWVATEGALNTPKDHIGTRNPANNAAIVLQLPQGTTLPKGFYAEGSRGGSQASSRSSSRSRNSSRNSTPGSSRGTSPARMAGNGGDAALALLLLDRLNQLESKMSGKGQQQQGQTVTKKSAAEASKKPRQKRTATKAYNVTQAFGRRGPEQTQGNFGDQELIRQGTDYKHWPQIAQFAPSASAFFGMSRIGMEVTPSGTWLTYTGAIKLDDKDPNFKDQVILLNKHIDAYKTFPPTEPKKDKKKKADETQALPQRQKKQQTVTLLPAADLDDFSKQLQQSMSSADSTQA

[0336] One well was transfected with 1ug pCI-SARS-CoV-2-nucleocapsid protein + 1ug plasmid pTM2-GFP. One well was transfected with 2ug plasmid pTM2-GFP. 40 hours after transfection, the cells were washed with PBS, scraped into PBS, collected by centrifugation at 300xg for 2 minutes, and stored at -80C. 40 hours after transfection, the cells were washed with PBS, scraped into PBS, and collected by centrifugation at 300xg for 2 minutes. There was no difference between co-transfection with GFP and nucleocapsid protein and GFP alone, indicating that the expression of nucleocapsid protein does not affect the growth of HEK293 cells.

[0337] The cell pellet was treated as follows: 1.8% ammonium hydroxide was added to the cells at a ratio of approximately 1:20 v / v. The samples were sonicated in an ultrasonic water bath or on a Covaris sonicator. The samples were treated as suspensions and sonicated and vortexed before any sample removal. The protein concentration was determined by BCA and set to approximately 2 mg / mL by diluting with 1.8% ammonium hydroxide. Sputum was obtained and ammonium hydroxide was added from a 32% stock solution to a final concentration of 1.8%; the sputum concentration was approximately 3 mg / mL. The sputum samples were similarly sonicated, and 1 uL of the nucleocapsid protein solution was added to 99 uL of the sputum solution, so that the total protein load in 100 uL was approximately 300 ug; multiple replicate mixtures were prepared. 100 uL of 1M acetic acid and 2 or 4 volumes of methanol were added to the samples and added to different SiTrap tubes loaded with a cellulose matrix in their lower parking position.

[0338] The SiTrap assembly was raised to its upper parking position and the sample was pushed through the matrix by centrifugation at 4,000 g for 5 min, and the flow-through containing metabolites and small molecules was retained in the outer vial. The SiTrap inner vial was placed in a fresh outer vial tube in the lower parking position. At this point, five replicates were placed at room temperature for 4 days and another five replicates were kept at -80C. At the end of the 4 days, all samples were allowed to return to room temperature. The protein was reduced and alkylated at 80C with 10mM TCEP and 25mM chloroacetamide in 50mM tris buffer at pH 8 in the lower parking position for 10 min. The reducing and alkylating agents were removed by centrifugation in the upper solution, the protein was washed with 75% MeOH, and the wash and flow-through were discarded. The inner vial was placed in the lower parking position of the outer vial. Four samples, two stored at room temperature and two stored at -80C, were digested by sonication to accelerate digestion. Because ultrasonic treatment is continuous, first add 30ug trypsin to each of four samples, then immediately place sample in Covaris M220, and hang by temporary wire rack made of straightened paper clip wire and fix in place with laboratory tape.Each sample accepts 20 minutes ultrasonic treatment, is set to peak power 50, duty factor 20 and 300 bursts / cycle.Sample is placed on ice to limit the activity of trypsin.Other two samples accept 30ug trypsin, and four samples accept 30ug trypsin, then incubate 1 hour at 47C.Two samples are incubated overnight at 37C with 15ug trypsin.Use Worthington trypsin to digest in 50mM TEAB.

[0339] All samples were obtained at Agilent Analyses were performed in targeted MS mode on a 6546 instrument, with targeted MSMS performed on the following m / z with a +2 charge for expected tryptic peptides of SARS-CoV-2 proteins: 375.180466, 403.193573, 443.706317, 458.742368, 471.784567, 563.78563, 564.785827, 573.751461, 601.809833, 741.330469, 835.948346, 842.948869, 894.929196, 912.411368, 931.48073, 1013.021708, 1030.578571, 1091.013989, 1118. 541465, 1134.044029, 1162.598357, 573.751461, 912.411368, 1162.598357, 1091.013989, 1134.044029, 842.948869, 1030.578571, 443.706317, 375.180466 , 403.193573, 835.948346, 601.809833, 563.78563, 894.929196, 1118.541465, 1013.021708, 471.784567, 458.742368, 564.785827, 931.48073, 741.330469. The data files were then exported and loaded into the scaffold using its internal deconvolution and data search algorithms. In the included list, the following peptides were detected: ITFGGPSDSTGSNQNGER at 912.411368, WYFYYLGTGPEAGLPYGANK at 1134.044029, DGIIWVATEGALNTPK at 842.948869, NPANNAAIVLQLPQGTTLPK at 1030.578571, MAGNG GDAALALLLLDR at 835.948346, AYNVTQAFGR at 563.78563, GPEQTQGNFGDQELIR at 894.929196, IGMEVTPSGTWLTY TGAIK at 1013.021708, ADETQALPQR at 564.785827, QQT VTLLPAADLDDFSK at 931.48073, and QLQQSMSSADSTQA at 741.330469; the observed fragment ions are listed in the table below, and a representative trace is shown in Figure 23-24 middle.

[0340]

[0341] There were no significant differences in the ability to detect SARS-CoV-2 proteins between 2 and 4X methanol additions, between storage for four days at room temperature and storage at room temperature, or between digestion accelerated by sonication at 37C overnight, 47C for 1 hour, or 20 min at room temperature. These results demonstrate that the SiTrap method is suitable for the detection of viruses and pathogens; the inner and outer vial assemblies are compatible with sonication, which accelerates enzymatic processing, and importantly, once combined, the samples are stable without drying out in the presence of oxygen at room temperature for at least four days.

[0342] Example 8

[0343] Accelerated serum processing

[0344] 100ug serum in 50uL was denatured and dissolved in 1.8% ammonium hydroxide, mixed with 50uL1M acetic acid and provided with 2 volumes of methanol. The solution was applied to the inner vial and outer vial assembly in the upper parking position and recovered after centrifugation at 4,000g for 5min. The flow-through fraction was analyzed by MSMS in metabolite analysis mode. As described for nucleocapsid protein, serum was reduced, alkylated and digested by sonication in Covaris M220. The small molecule fraction was analyzed by searching all METLIN and metabolite databases by Agilent MassHunter Qualitative Analysis 10.0 version. 231 compounds were detected in metabolite mode. Peptides from digestion were analyzed and searched for human UniProt database using SpectrumMill. 344 proteomes were detected, including 1207 proteins in total. In some experimental repetitions, the flow-through fraction was dried and exposed to a 4:2:1 v / v / v mixture of 2-propanol / methanol / chloroform containing 7.5 mm ammonium acetate to produce a lipid fraction. Then 0.1% formic acid and 5% acetonitrile and 95% water were added to the outer vial and sonicated. In other experimental repetitions, 100 uL chloroform was added to the neutralized sample, followed by 300 uL water and 400 μL methanol and mixed. The inner vial was placed in a new vial and the solution was centrifuged. The mixture was phase separated, with the upper layer containing more hydrophilic parts and the lower layer containing more hydrophobic parts, such as lipids. These methods generate separate lipidomics and metabolomics fractions for higher ID rates. This sample demonstrates that the SiTrap method and assembly can quickly generate samples for metabolomics, lipidomics, and proteomics analysis. Many metabolites are hydrophilic and the use of additional chromatography such as HILIC will provide additional identification and the solvents described herein are not limiting but may be selected to match the solubility properties of the analyte or the class of analytes of interest. In particular, phase partitioning solvent combinations are of particular use because their relative hydrophobicity can be varied and thus adjusted to the specific needs of the analysis or handling or processing.

[0345] Example 9

[0346] Capture of cells and tissue processing

[0347] In the assembly in the lower parking position, about 10uL red blood cells (RBC) or about 10mg mouse liver is directly added to 50uL 1.8% ammonium hydroxide. The assembly is ultrasonically treated for 5-10 minutes on M220 to lyse cells or tissues. RBC seems to be completely dissolved, and the liver seems to be completely decomposed. Then 50uL of 1M acetic acid is added, followed by 250uL of HPLC-grade methanol. The inner vial is moved to the upper parking position, and the small molecule fraction is recovered by centrifugation. In other experimental variations, chloroform is also provided to the treated RBC or mouse liver to produce phase separation fractions for lipidomics (bottom layer) and metabolomics (top layer). The liver sample inner vial is placed in a clean new outer vial, 50uL TE is added and incubated for 30min. The fraction containing surviving RNA and DNA sheared by ultrasonic treatment is eluted in the upper parking position, the matrix is ​​washed with 100uL TE, and the sample is placed in a new outer vial. SDS-PAGE analysis showed very little protein. The inner vial was placed in a new outer vial and 10uL PNGase F at 500 units / mL was added to 50mM sodium phosphate, pH 8.6, in a total volume of 50uL. The sample was treated at 37C for 5 hours and the fraction containing glycans was eluted by moving the inner vial to the upper parking position and centrifuging. SDS-PAGE analysis showed no protein in this fraction and it was positive for glycans by periodic acid and alcian blue testing. Finally, in a new outer vial, the sample was reduced, digested and alkylated as described above, but incubated overnight at 37C. After further elution of the peptides with 50mM TEAB and 50% ACN, no material was observed on the column, indicating that the procedure was sufficient to completely process the tissue. In the event that the tissue is contaminated with blood, a properly designed assembly has a pore size large enough to allow RBCs to pass through, which provides a mechanism for manual or automated cleaning of the system.

[0348] Example 10

[0349] FFPE

[0350] 1 mm formalin-fixed paraffin-embedded mouse liver cores stored at room temperature were punched and homogenized in trap hydroxide, along with trap cells and tissues, on the M220 for 10 min, followed by overnight incubation in 1.8% ammonium to rehydrate the samples. The methanol and chloroform extraction protocol used for serum was followed to yield a paraffin-free upper layer that was used for additional metabolomic analysis. Protein treatment with trypsin was performed as with serum, yielding peptides that were immediately available for MSMS.

[0351] Embodiment 11

[0352] RNA capture visualization

[0353] The ability of the SiTrap system to capture and release RNA was visualized by RNA. Yeast tRNA (Roche 10109495001) was labeled with fluorescein isothiocyanate (FITC, Sigma catalog number 46951) every tenth amine; the resulting labeled RNA was precipitated with ethanol, and the sample was washed until the supernatant was colorless, indicating the removal of non-covalently bound FITC. The labeled RNA was resuspended in a final volume of 50uL in the presence or absence of 5% SDS (see Fig.25 As expected, FITC-labeled tRNA luminesces under UV light ( Fig.25 A), which can be visualized immediately. Importantly, the SiTrap spin column is located here in a different pocket than the assemblies provided herein, but is identical in its binding matrix and does not emit light ( Fig.25 B). Add 5uL of 10M ammonium acetate and 350uL of 90% methanol to each sample ( Fig.25 ) and 100 mM TEAB or pure ethanol ( Fig.25 The samples were mixed and immediately passed through the SiTrap column. All conditions captured RNA ( Fig.25 C). Wash the column with 350uL of the indicated organic solution. Pure ethanol is more effective in retaining RNA on the column ( Fig.25 D). RNA was eluted with 50 mM TEAB and ethanol-bound RNA was quantitatively released ( Fig.25 E, Conditions 3 and 4; note the lack of luminescence in the SiTrap-bound matrix). This experiment demonstrates reversible capture and release of RNA for downstream processing.

[0354] Example 12

[0355] Multi-fraction analysis using combined matrices

[0356] The assemblies had the same binding matrix, below which was a layer of SCX or C18 flexible capture media (Affinisep). Samples were processed as described for serum. For SCX SiTrap, the samples were diluted 10X with 2:1 methanol / water to achieve better binding and maintain the initial flow-through. The SCX matrix was then eluted with 250mM ammonium acetate in a new outer vial. Subsequently, the proteins were digested the same as the serum using a 1-hour 47C digestion in a new outer vial. The 250mM ammonium acetate was removed from the 50mM flow-through and provided to the inner vial in the parking position. After a brief sonication, the inner vial was placed in the upper parking position to recover the bound peptides. The SCX fractions generated in this way are highly complementary, with relatively few IDs shared between the flow-through and elution fractions of metabolites or peptides. For C18, the same protocol was repeated with the following changes: the sample was not diluted initially, and 75% ACN was used instead of ammonium acetate for elution. The peptide fraction C18 flow-through had very few samples, as did the metabolite flow-through. These results were expected, however, because the C18 chromatography was used after the SiTrap treatment. Therefore, the C18 served as a clean-up step. Alternatively, an elution "cut" of 20% ACN was applied. These had a high number of peptides and metabolites and lipids.

[0357] Although various embodiments have been described above, it should be understood that these disclosures are intended to be illustrative rather than restrictive. Therefore, the breadth and scope of the subject compositions and methods should not be limited by any of the above-described exemplary embodiments, but should be limited only in accordance with the following claims and their equivalents.

[0358] The purpose of the above description is to teach those skilled in the art how to practice the invention, and it is not intended to detail all those obvious modifications and variations that will become apparent to those skilled in the art after reading this specification. However, it is intended that all such obvious modifications and variations are included within the scope of the present invention, and the scope of the present invention is defined by the following claims. The claims are intended to cover any order of components and steps that are effective to meet their intended objectives, unless the context clearly indicates otherwise.

Claims

1. A two-part assembly for sequential through-matrix processing of a sample comprising a fraction of one or more biological targets of interest, the assembly comprising: (a) an outer vial, wherein the outer vial is configured to receive an inner vial within the outer vial; (b) an inner vial, wherein the inner vial comprises an inner chamber and a matrix, and (c) a docking system configured such that the inner vial is configured to be positioned within the outer vial in a first state and a second state, wherein The first state is a lower parked position within the outer vial for preventing the sample from being released through the matrix via the side, and The second state is an upper parked position within the outer vial for allowing the sample to pass through the matrix via side release.

2. The assembly of claim 1, wherein the inner vial additionally comprises a cap and the outer vial comprises a cap.

3. The assembly of claim 1 wherein the inner vial includes a vent.

4. A two-part assembly for sequential through-matrix processing of a sample comprising a fraction of one or more biological targets of interest, the assembly comprising: (a) an outer vial, wherein the outer vial is configured to receive an inner vial within the outer vial, the outer vial comprising a pin; (b) an inner vial, wherein the inner vial comprises an inner chamber and a matrix, and (c) a docking system configured such that the inner vial is configured to be positioned within the outer vial in a first state and a second state, wherein The first state is a lower parked position within the outer vial, the pin of the outer vial being configured to seal the inner vial for preventing the sample from passing through the matrix, and The second state is an upper parked position within the outer vial for allowing the sample to pass through the matrix.

5. The assembly of claim 4, wherein the inner vial includes an opening on an end of the inner vial that is located below the matrix when the inner vial has been received within the outer vial.

6. A method of using the two-part assembly of claim 1 or claim 4 to prepare a sample containing one or more fractions of a biological target of interest, the method comprising: (a) exposing the sample to an extraction solvent, wherein the extraction solvent is neutral or neutralized and contains no detergent and no chaotropic agent; (b) physically disrupting said sample combined with said extraction solvent; combining said sample and said extraction solvent with a molecular coagulant, wherein said molecular coagulant promotes binding of molecules to a matrix, and wherein said molecular coagulant is a mildly chaotropic coagulant; (c) contacting the sample combined with the molecular coagulant with the matrix, the matrix being a capture matrix adapted to capture molecules in the presence of the molecular coagulant, the capture matrix contained within the inner vial; (d) positioning the inner vial within the outer vial in an upper parked position, wherein uncondensed and unbound molecules flow from the inner vial into the outer vial; (e) collecting uncondensed and unbound molecules into the outer vial, wherein the identity of the uncondensed molecules depends on the selection of the molecular condensing agent; (f) moving the inner vial to a lower parking position wherein the outer vial seals the inner vial; (g) treating the condensed capture molecules bound to the matrix in the inner vial, wherein the treating of the condensed capture molecules changes the physical state of the condensed capture molecules, and wherein the treating occurs without any prior exposure of the sample to a strong chaotropic agent; (h) after processing the condensed capture molecules bound to the matrix, moving the inner vial to an upper parking position in the outer vial; and (i) eluting one class or species of congealed capture molecules from the matrix into the outer vial using an elution solvent selected to match the solubility of the congealed capture molecules.

7. The method of claim 6, wherein the inner vial additionally comprises a cap and the outer vial comprises a cap.

8. The method of claim 6, wherein the inner vial includes a vent.

9. The method of claim 6, wherein the substrate is a depth filter.

10. The method of claim 6, wherein the biological target of interest is one or more selected from the group consisting of: protein, DNA, RNA, lipid, and glycan.

11. The method of claim 6, wherein the treatment is performed by one or more selected from the group consisting of: proteases, nucleases, and glycosidases.

12. The method of claim 6, wherein the molecular coagulant is one or more selected from the group consisting of an organic solvent, an aqueous solvent, and a biphasic organic solution.

13. The method of claim 6, further comprising the steps of: (b) adding two volumes of methanol to the sample first extracted by sonication with the extraction solvent; Neutralize by adding an equal volume of 1 M acetic acid; and Two volumes of methanol were added as a molecular coagulant.

Images