Engineered CRISPR-Cas9 nucleases

Abstract

The present invention relates to engineered CRISPR-Cas9 nucleases. Engineered CRISPR-Cas9 nucleases with improved specificity and their use in genome engineering, epigenome engineering, genome targeting, and genome editing are disclosed.

Description

[0001] This application is a divisional application of Chinese patent application 201680063266.8. The application date of the original application 201680063266.8 is August 26, 2016, and its name is “Engineered CRISPR-Cas9 Nuclease”.

[0002] Priority declaration

[0003] This application claims priority under 35 USC §119(e) to the following U.S. patent application serial numbers: 62 / 211,553, filed August 28, 2015; 62 / 216,033, filed September 9, 2015; 62 / 258,280, filed November 20, 2015; 62 / 271,938, filed December 28, 2015; and 15 / 015,947, filed February 4, 2016. The entire contents of the above documents are incorporated herein by reference.

[0004] Sequence Listing

[0005] This application contains a sequence listing that has been submitted electronically in ASCII format and is incorporated herein by reference in its entirety. The ASCII copy created on August 26, 2016 is named SEQUENCE LISTING.txt and is 129,955 bytes in size.

[0006] Federally sponsored research or development

[0007] This invention was made with government support under Grant Nos. DP1 GM105378 and R01 GM088040 awarded by the National Institutes of Health. The U.S. Government has certain rights in this invention. Technical Field

[0008] The present invention relates, at least in part, to engineered clustered regularly interspaced short palindromic repeats (CRISPR) / CRISPR-associated protein 9 (Cas9) nucleases with altered and improved target specificity and their use in genome engineering, epigenome engineering, genome targeting, genome editing, and in vitro diagnostics. Background Art

[0009] CRISPR-Cas9 nucleases have enabled efficient genome editing in a wide variety of organisms and cell types (Sander & Joung, Nat Biotechnol 32, 347-355 (2014); Hsu et al., Cell 157, 1262-1278 (2014); Doudna & Charpentier, Science 346, 1258096 (2014); Barrangou & May, Expert Opin Biol Ther 15, 311-314 (2015)). Target site recognition by Cas9 is programmed by a chimeric single guide RNA (sgRNA) encoding a sequence complementary to the target protospacer (Jinek et al., Science 337, 816-821 (2012)) and requires recognition of a short adjacent PAM (Mojica et al., Microbiology 155, 733-740 (2009); Shah et al., RNA Biol 10, 891-899 (2013); Jiang et al., Nat Biotechnol 31, 233-239 (2013); Jinek et al., Science 337, 816-821 (2012); Sternberg et al., Nature 507, 62-67 (2014)). Summary of the invention

[0010] As described herein, the Cas9 protein can be engineered to show increased specificity by reducing the binding affinity of Cas9 to DNA in theory. Therefore, this article describes multiple Cas9 variants with increased specificity (i.e., inducing significantly less off-target effects at incompletely matched or mismatched DNA sites) compared to the wild-type protein, together with methods of using them.

[0011] In a first aspect, the present invention provides an isolated Streptococcus pyogenes Cas9 (SpCas9) protein having a mutation at one, two, three, four, five, six, or all seven of the following positions: L169A, Y450, N497, R661, Q695, Q926, and / or D1135E, for example, a sequence comprising at least 80% identical to the amino acid sequence of SEQ ID NO: 1, the sequence having a mutation at one, two, three, four, five, six, or seven of the following positions: L169, Y450, N497, R661, Q695, Q926, D1135E, and optionally one or more of a nuclear localization sequence, a cell penetrating peptide sequence, and / or an affinity tag. The mutation changes the amino acid to an amino acid different from a natural amino acid (e.g., 497 is any amino acid other than N). In a preferred embodiment, the mutation changes the amino acid to any amino acid different from a natural amino acid (arginine or lysine); in some embodiments, the amino acid is alanine.

[0012] In some embodiments, the variant SpCas9 protein comprises mutations at one, two, three, or all four of the following positions: N497, R661, Q695, and Q926, such as one, two, three, or all four of the following mutations: N497A, R661A, Q695A, and Q926A.

[0013] In some implementations, the variant SpCas9 protein comprises a mutation at Q695 and / or Q926, and optionally one, two, three, four or all five of L169, Y450, N497, R661 and D1135E, such as but not limited to: Y450A / Q695A, L169A / Q695A, Q695A / Q926A, Q695A / D1135E, Q926A / D1135E, Y450A / D1135E, L169A / Y450A / Q695A, L169A / Q695A / Q926A, Y450A / Q695A / Q926A, R661A / Q691 95A / Q926A, N497A / Q695A / Q926A, Y450A / Q695A / D1135E, Y450A / Q926A / D1135E, Q695A / Q926A / D1135E, L169A / Y450A / Q695A / Q926A, L169A / R661A / Q695A / Q926A, Y450A / R661A / Q695A / Q926A, N497A / Q695A / Q926A / D1135E, R661A / Q695A / Q926A / D1135E, and Y450A / Q695A / Q926A / D1135E.

[0014] In some embodiments, the variant SpCas9 protein comprises mutations at: N14; S15; S55; R63; R78; H160; K163; R165; L169; R403; N407; Y450; M495; N497; K510; Y515; W659; R661; M694; Q695; H698; A728; S730; K775; S777; R778; R780; K782; R783; K789; K797; Q805; N808; K810; R832; Q844; S845; K848; S851; K855; R859; K862; K890; Q920; Q926 ;K961;S964;K968;K974;R976;N980;H982;K1003;K1014;S1040;N1041;N1 044; K1047; K1059; R1060; K1107; E1108; S1109; K1113; R1114; S1116; K111 8;D1135;S1136;K1153;K1155;K1158;K1200;Q1221;H1241;Q1254;Q1256;K1289;K1296;K1297;R1298;K1300;H1311;K1325;K1334;T1337 and / or S1216.

[0015] In some embodiments, the variant SpCas9 protein further comprises one or more of the following mutations: N14A; S15A; S55A; R63A; R78A; R165A; R403A; N407A; N497A; Y450A; K510A; Y515A; R661A; Q695A; S730A; K775A; S777A; R778 A; R780A; K782A; R783A; K789A; K797A; Q805A; N808A; K810A; R832A; Q844A; S845A ; K848A; S851A; K855A; R859A; K862A; K890A; Q920A; Q926A; K961A; S964A; K968A; K 974A; R976A; N980A; H982A; K1003A; K1014A; S1040A; N1041A; N1044A; K1047A; K1 059A; R1060A; K1107A; E1108A; S1109A; K1113A; R1114A; S1116A; K1118A; D1135A; S1136A; K1153A; K1155A; K1158A; K1200A; Q1221A; H1241A; Q1254A; Q1256A; K1289A; K1296A; K1297A; R1298A; K1300A; H1311A; K1325A; K1334A; T1337A and / or S1216A. In some embodiments, the variant protein comprises HF1(N497A / R661A / Q695A / Q926A)+K810A, HF1+K848A, HF1+K855A, HF1+H982A, HF1+K848A / K1003A, HF1+K848A / R1060A, HF1+K855A / K1003A, HF1+K855A / R1060A, HF1+H982A / K1003A, HF1+H982A / R1060A, HF1+K1003A / R1060A, HF1+K810A / K1003A / R1060A, HF1+K848A / K1003A / R1060A. In some embodiments, the variant protein comprises HF1+K848A / K1003A, HF1+K848A / R1060A, HF1+K855A / K1003A, HF1+K855A / R1060A, HF1+K1003A / R1060A, HF1+K848A / K1003A / R1060A. In some embodiments, the variant protein comprises Q695A / Q926A / R780A, Q695A / Q926A / R976A, Q695A / Q926A / H982A, Q695A / Q926A / K855A,Q695A / Q926A / K848A / K1003A, Q695A / Q926A / K848A / K855A, Q695A / Q926A / K848A / H982A, Q695A / Q926A / K1003A / R1060A, Q695A / Q926A / K848A / R1060A, Q695A / Q926A / K855A / H982A, Q695A / Q926A / K855A / K10 03A, Q695A / Q926A / K855A / R1060A, Q695A / Q926A / H982A / K1003A, Q695A / Q926A / H982A / R1060A, Q695A / Q926A / K1003A / R1060A, Q695A / Q926A / K810A / K1003A / R1060A, Q695A / Q926A / K848A / K1003A / R1060A. In some embodiments, the variant comprises N497A / R661A / Q695A / Q926A / K810A, N497A / R661A / Q695A / Q926A / K848A, N497A / R661A / Q695A / Q926A / K855A, N497A / R661A / Q695A / Q926A / R780A, N497A / R661A / Q695A / Q926A / K968A , N497A / R661A / Q695A / Q926A / H982A, N497A / R661A / Q695A / Q926A / K1003A, N497A / R661A / Q695A / Q 926A / K1014A, N497A / R661A / Q695A / Q926A / K1047A, N497A / R661A / Q695A / Q926A / R1060A, N497A / R 661A / Q695A / Q926A / K810A / K968A, N497A / R661A / Q695A / Q926A / K810A / K848A, N497A / R661A / Q695 A / Q926A / K810A / K1003A, N497A / R661A / Q695A / Q926A / K810A / R1060A, N497A / R661A / Q695A / Q926A / K848A / K1003A, N497A / R661A / Q695A / Q926A / K848A / R1060A, N497A / R661A / Q695A / Q926A / K855A / K1003A, N497A / R661A / Q695A / Q926A / K855A / R1060A, N497A / R661A / Q695A / Q926A / K968A / K1003A,N497A / R661A / Q695A / Q926A / H982A / K1003A、N497A / R661A / Q695A / Q926A / H982A / R1060A、N497A / R661A / Q695A / Q926A / K1003A / R1060A、N497A / R661A / Q695A / Q926A / K810A / K1003A / R1060A、N497A / R661A / Q695A / Q926A / K848A / K1003A / R1060A、Q695A / Q926A / R780A、Q695A / Q926A / K810A、Q695A / Q926A / R832A、Q695A / Q926A / K848A、Q695A / Q926A / K855A、Q695A / Q926A / K968A、Q695A / Q926A / R976A、Q695A / Q926A / H982A、Q695A / Q926A / K1003A、Q695A / Q926A / K1014A、Q695A / Q926A / K1047A、Q695A / Q926A / R1060A、Q695A / Q926A / K848A / K968A、Q695A / Q926A / R976A、Q695A / Q926A / H982A、Q695A / Q926A / K855A、Q695A / Q926A / K848A / K1003A、Q695A / Q926A / K848A / K855A、Q695A / Q926A / K848A / H982A、Q695A / Q926A / K1003A / R1060A、Q695A / Q926A / R832A / R1060A、Q695A / Q926A / K968A / K1003A、Q695A / Q926A / K968A / R1060A、Q695A / Q926A / K848A / R1060A、Q695A / Q926A / K855A / H982A、Q695A / Q926A / K855A / K1003A、Q695A / Q926A / K855A / R1060A、Q695A / Q926A / H982A / K1003A、Q695A / Q926A / H982A / R1060A、Q695A / Q926A / K1003A / R1060A、Q695A / Q926A / K810A / K1003A / R1060A、Q695A / Q926A / K1003A / K1047A / R1060A、Q695A / Q926A / K968A / K1003A / R1060A、Q695A / Q926A / R832A / K1003A / R1060A、Or Q695A / Q926A / K848A / K1003A / R1060A.

[0016] Mutations in amino acids other than alanine are also encompassed and can be made and used in the methods and compositions of the invention.

[0017] In some embodiments, the variant SpCas9 protein comprises one or more of the following additional mutations: R63A, R66A, R69A, R70A, R71A, Y72A, R74A, R75A, K76A, N77A, R78A, R115A, H160A, K163A, R165A, L169A, R403A, T404A, F405A, N407A, R447A, N497A, I448A, Y450A, S46 A, S1216A, Q1221A, K1289A, R1298A, K1300A, K1325A, R1333A, K1334A, R1335A, and T1337A.

[0018] In some embodiments, the variant SpCas9 protein comprises multiple substitution mutations: N497 / R661 / Q695 / Q926 (quadruple variant mutant); Q695 / Q926 (double mutant); R661 / Q695 / Q926 and N497 / Q695 / Q926 (triple mutant). In some embodiments, additional substitution mutations at L169, Y450 and / or D1135 may be added to these double, triple, and quadruple mutants, or to single mutants carrying mutations at Q695 or Q926. In some embodiments, the mutant has alanine instead of a wild-type amino acid. In some embodiments, the mutant has any amino acid other than arginine or lysine (or a natural amino acid).

[0019] In some embodiments, the variant SpCas9 protein further comprises one or more mutations selected from the group consisting of: mutations at D10, E762, D839, H983, or D986; and mutations at H840 or N863 that reduce nuclease activity. In some embodiments, the mutations are: (i) D10A or D10N and (ii) H840A, H840N, or H840Y.

[0020] In some embodiments, the SpCas9 variant may also include one of the following mutation groups: D1135V / R1335Q / T1337R (VQR variant); D1135E / R1335Q / T1337R (EQR variant); D1135V / G1218R / R1335Q / T1337R (VRQR variant); or D1135V / G1218R / R1335E / T1337R (VRER variant).

[0021] Also provided herein is an isolated Staphylococcus aureus Cas9 (SaCas9) protein having a mutation at one, two, three, four, five, six, or more of the following positions: Y211, Y212, W229, Y230, R245, T392, N419, Y651, or R654, e.g., comprising a sequence at least 80% identical to the amino acid sequence of SEQ ID NO: 1, the sequence having a mutation at one, two, three, four, five, or six of the following positions: Y211, Y212, W229, Y230, R245, T392, N419, Y651, or R654, and optionally comprising one or more of a nuclear localization sequence, a cell penetrating peptide sequence, and / or an affinity tag. In some embodiments, SaCas9 variants described herein include an amino acid sequence of SEQ ID NO: 2 having mutations at one, two, three, four, five, six, or more of the following positions: Y211, Y212, W229, Y230, R245, T392, N419, Y651, and / or R654. In some embodiments, the variants include one or more of the following mutations: Y211A, Y212A, W229, Y230A, R245A, T392A, N419A, Y651, and / or R654A.

[0022] In some embodiments, the variant SaCas9 protein comprises a mutation at N419 and / or R654, and optionally one, two, three, four or more of the following additional mutations: Y211, Y212, W229, Y230, R245 and T392, preferably N419A / R654A, Y211A / R654A, Y211A / Y212A, Y211A / Y230A, Y211A / R245A, Y212A / Y230A, Y212A / R245A, Y230A / R245A, W229A / R654A, Y211A / Y212A / Y230A, Y21 1A / Y212A / R245A, Y211A / Y212A / Y651A, Y211A / Y230A / R245A, Y211A / Y230A / Y651A, Y211A / R2 45A / Y651A, Y211A / R245A / R654A, Y211A / R245A / N419A, Y211A / N419A / R654A, Y212A / Y230A / R245A, Y212A / Y230A / Y651A, Y212A / R245A / Y651A, Y230A / R245A / Y651A, R245A / N419A / R654 A. T392A / N419A / R654A, R245A / T392A / N419A / R654A, Y211A / R245A / N419A / R654A, W229A / R2 45A / N419A / R654A, Y211A / R245A / T392A / N419A / R654A, or Y211A / W229A / R245A / N419A / R654A.

[0023] In some embodiments, the variant SaCas9 protein comprises mutations at: Y211; Y212; W229; Y230; R245; T392; N419; L446; Q488; N492; Q495; R497; N498; R499; Q500; K518; K523; K525; H557; R561; K572; R634; Y651; R654; G655; N658; S662; N667; R686; K692; R694; H700; K751; D786; T787; Y789; T882; K88 6; N888; 889; L909; N985; N986; R991; R1015; N44; R45; R51; R55; R59; R60; R116; R165; N169; R208; R209; Y211; T238; Y239; K248; Y256; R314; N394; Q414; K57; R61; H111; K114; V164; R165; L788; S790; R792; N804; Y868; K870; K878; K879; K881; Y897; R901; and / or K906.

[0024] In some embodiments, the variant SaCas9 protein comprises one or more of the following mutations: Y211A; Y212A; W229A; Y230A; R245A; T392A; N419A; L446A; Q488A; N492A; Q495A; R497A; N498A; R499A; Q500A; K518A; K523A; K525A; H557A; R561A; K572A; R634A; Y651A; R654A; G655A; N658A; S662A; N667A; R686A; K692A; R694A; H700A; K751A; D786A; T787A; Y789A; T882A; K 886A; N888A; A889A; L909A; N985A; N986A; R991A; R1015A; N44A; R45A; R51A; R 55A; R59A; R60A; R116A; R165A; N169A; R208A; R209A; T238A; Y239A; K248A; Y2 56A; R314A; N394A; Q414A; K57A; R61A; H111A; K114A; V164A; R165A; L788A; S7 90A; R792A; N804A; Y868A; K870A; K878A; K879A; K881A; Y897A; R901A; K906A.

[0025] In some embodiments, the variant SaCas9 protein comprises one or more of the following additional mutations: Y211A, W229A, Y230A, R245A, T392A, N419A, L446A, Y651A, R654A, D786A, T787A, Y789A, T882A, K886A, N888A, A889A, L909A, N985A, N986A, R991A, R1015A, N44A, R45A, R51A, R55A, R59 A. R60A, R116A, R165A, N169A, R208A, R209A, T238A, Y239A, K248A, Y256A, R314A, N394A, Q414A, K57A, R61A, H11 1A, K114A, V164A, R165A, L788A, S790A, R792A, N804A, Y868A, K870A, K878A, K879A, K881A, Y897A, R901A, K906A.

[0026] In some embodiments, the variant SaCas9 protein comprises multiple substitution mutations: R245 / T392 / N419 / R654 and Y221 / R245 / N419 / R654 (quadruple variant mutants); N419 / R654, R245 / R654, Y221 / R654, and Y221 / N419 (double mutants); R245 / N419 / R654, Y211 / N419 / R654, and T392 / N419 / R654 (triple mutants). In some embodiments, the mutant comprises alanine instead of a wild-type amino acid.

[0027] In some embodiments, the variant SaCas9 protein further comprises one or more mutations selected from the group consisting of: a mutation at D10, E477, D556, H701, or D704; and a mutation at H557 or N580 that reduce nuclease activity. In some embodiments, the mutation is: (i) D10A or D10N, (ii) H557A, H557N, or H557Y, (iii) N580A, and / or (iv) D556A.

[0028] In some embodiments, the variant SaCas9 protein comprises one or more of the following mutations: E782K, K929R, N968K, or R1015H. In particular, E782K / N968K / R1015H (KKH variant); E782K / K929R / R1015H (KRH variant); or E782K / K929R / N968K / R1015H (KRKH variant).

[0029] In some embodiments, the variant Cas9 protein comprises mutations to one or more of the following regions to increase specificity:

[0030]

[0031]

[0032] Also provided herein is a fusion protein comprising an isolated variant Cas9 protein described herein fused to a heterologous functional domain using an optional intervening linker, wherein the linker does not interfere with the activity of the fusion protein. In some embodiments, the heterologous functional domain acts directly on DNA or protein, for example, on chromatin. In some embodiments, the heterologous functional domain is a transcriptional activation domain. In some embodiments, the transcriptional activation domain is from VP64 or NF-κB p65. In some embodiments, the heterologous functional domain is a transcriptional silencer or a transcriptional repression domain. In some embodiments, the transcriptional repression domain is a Kruppel-associated box (KRAB) domain, an ERF repressor domain (ERD) or an mSin3A interaction domain (SID). In some embodiments, the transcriptional silencer is a heterochromatin protein 1 (HP1), such as HP1α or HP1β. In some embodiments, the heterologous functional domain is an enzyme that modifies the methylation state of DNA. In some embodiments, the enzyme modifying the methylation state of DNA is all or dioxygenase domains of DNA methyltransferase (DNMT) or TET protein, such as a catalytic module comprising a cysteine-rich extension and a 2OGFeDO domain encoded by 7 highly conserved exons, such as a Tet1 catalytic domain comprising amino acids 1580-2052, a Tet2 comprising amino acids 1290-1905, and a Tet3 comprising amino acids 966-1678. In some embodiments, TET protein or TET source dioxygenase domain is from TET1. In some embodiments, a heterologous functional domain is an enzyme modifying a histone subunit. In some embodiments, the enzyme modifying a histone subunit is a histone acetyltransferase (HAT), a histone deacetylase (HDAC), a histone methyltransferase (HMT) or a histone demethylase. In some embodiments, a heterologous functional domain is a biological tether. In some embodiments, a biological tether is a MS2, Csy4 or λN protein. In some embodiments, a heterologous functional domain is a FokI.

[0033] Also provided herein are nucleic acids encoding variant Cas9 proteins described herein, isolated nucleic acids, and vectors comprising the isolated nucleic acids optionally operably linked to one or more regulatory domains for expressing variant Cas9 proteins described herein. Also provided herein are host cells, such as bacterial, yeast, insect, or mammalian host cells or transgenic animals (e.g., mice), comprising nucleic acids described herein, and optionally expressing variant Cas9 proteins described herein.

[0034] Also provided herein are isolated nucleic acids encoding Cas9 variants, together with vectors comprising the isolated nucleic acids, optionally operably linked to one or more regulatory domains, for expressing the variants, and host cells (e.g., mammalian host cells) comprising the nucleic acids and optionally expressing the variant proteins.

[0035] Also provided herein is a method of changing the genome or epigenome of a cell by expressing a variant Cas9 protein or fusion protein as described herein in a cell, and at least one guide RNA having a region complementary to a selected portion of the genome of a cell having an optimal nucleotide spacing at a genomic target site, or contacting the cell with the variant Cas9 protein or fusion protein and the guide RNA. These methods may include contacting the cell with a nucleic acid encoding a Cas9 protein and a guide RNA (e.g., in a single vector); contacting the cell with a nucleic acid encoding a Cas9 protein and a nucleic acid encoding a guide RNA (e.g., in a multiple vector); and in particular contacting the cell with a purified Cas9 protein and a complex of a synthesized or purified gRNA. In some embodiments, the cell stably expresses one or both of gRNA or variant protein / fusion protein, and other elements are transfected into or introduced into the cell. For example, the cell may stably express a variant protein or fusion protein as described herein, and these methods may include contacting the cell with a synthetic gRNA, a purified recombinantly produced gRNA, or a nucleic acid encoding a gRNA. In some embodiments, the variant protein or fusion protein comprises one or more of a nuclear localization sequence, a cell penetrating peptide sequence, and / or an affinity tag.

[0036] Also provided herein are methods for altering (e.g., selectively altering) an isolated dsDNA molecule in vitro by contacting the dsDNA with a purified variant protein variant or fusion protein as described herein, and a guide RNA having a region complementary to a selected portion of the dsDNA molecule.

[0037] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by those of ordinary skill in the art to which the invention belongs. Methods and materials for use in the present invention are described herein; other suitable methods and materials known in the art may also be used. These materials, methods, and examples are illustrative only and are not intended to be limiting. All publications, patent applications, patents, sequences, database entries, and other references mentioned herein are incorporated by reference in their entirety. In the event of a conflict, the present specification (including definitions) shall prevail.

[0038] Other features and advantages of the invention will be apparent from the following detailed description and drawings, and from the claims. BRIEF DESCRIPTION OF THE DRAWINGS

[0039] Figure 1A -E| Identification and characterization of SpCas9 variants carrying mutations in residues that form nonspecific DNA contacts. A, Schematic depicting wild-type SpCas9 recognition of target DNA:sgRNA duplexes based on PDB 4OOG and 4UN3 (adapted from reference sequences 31 and 32, respectively). B, Characterization of SpCas9 variants containing alanine substitutions at positions that form hydrogen bonds with the DNA backbone. Wild-type SpCas9 and variants were evaluated using a human cell EGFP disruption assay when programmed with a perfectly matched sgRNA or four other sgRNAs encoding mismatches with the target site. For n=3, error bars represent standard error of the mean (sem); average levels of background EGFP loss are indicated by red dashed lines (for this, panels and panels C). C and D, on-target activity of wild-type SpCas9 and SpCas9-HF1 across 24 sites was evaluated by EGFP disruption assay (panel C), and on-target activity of 13 endogenous sites was evaluated by T7E1 assay (panel D). Error bars represent standard error of the mean for n = 3. E, Ratio of on-target activity of SpCas9-HF1 to wild-type SpCas9 (from panels C and D).

[0040] Figure 2A-C | Genome-wide specificity of wild-type SpCas9 and SpCas9-HF1 with sgRNAs for standard target sites. A, Off-target sites of wild-type SpCas9 and SpCas9-HF1 with eight sgRNAs targeting endogenous human genes, as determined by GUIDE-seq. Read counts represent a measure of the frequency of cutting at a given site; mismatch positions within the spacer or PAM are highlighted in color. B, Summary of the total number of genome-wide off-target sites identified by GUIDE-seq for wild-type SpCas9 and SpCas9-HF1 from the eight sgRNAs used in panel A. C, Identification of off-target sites for wild-type SpCas9 and SpCas9-HF1 for eight sgRNAs, graded according to the total number of mismatches (within the protospacer and PAM) relative to the on-target site.

[0041] Figure 3A -C| Validation of improved SpCas9-HF1 specificity by targeted deep sequencing of off-target sites identified by GUIDE-seq. A, Average on-target percentage modification determined by deep sequencing for wild-type SpCas9 and SpCas9-HF1 with the six sgRNAs from Figure 2. Error bars represent standard error of the mean for n=3. B, Percentage of on-target sites of deep sequencing and off-target sites detected by GUIDE-seq containing indel mutations. Graphs of triplicate experiments are drawn for wild-type SpCas9, SpCas9-HF1, and control conditions. The solid circles below the x-axis represent multiple replicates for which no insertion or deletion mutations were observed. Off-target sites that could not be amplified by PCR are shown in red text with asterisks. Hypothesis testing using a one-sided Fisher's exact test with pooled read counts found significant differences (p < 0.05 after adjusting for multiple comparisons using the Benjamini-Hochberg method) for comparisons between SpCas9-HF1 and control conditions only for EMX1-1 off-target 1 and FANCF-3 off-target 1. Significant differences were also found between wild-type SpCas9 and SpCas9-HF1 at all off-target sites, and between wild-type SpCas9 and control conditions at all off-target sites (except RUNX1-1 off-target 2). C, GUIDE-seq read counts (from Figure 2A ) and the average percentage modification determined by deep sequencing.

[0042] Figure 4A-C | Genome-wide specificity of wild-type SpCas9 and SpCas9-HF1 with sgRNAs at non-standard repeat sites. A, GUIDE-seq specificity plots of wild-type SpCas9 and SpCas9-HF1 using two sgRNAs known to cut a large number of off-target sites (Fu et al., Nat Biotechnol [Nature Biotechnology] 31, 822-826 (2013); Tsai et al., Nat Biotechnol [Nature Biotechnology] 33, 187-197 (2015)). GUIDE-seq read counts represent a measure of the frequency of cutting at a given site; mismatch positions within spacers or PAMs are highlighted in color; red circles indicate sites that may have indicated bulges at the sgRNA-DNA interface (Lin et al., Nucleic Acids Res [Nucleic Acids Research] 42, 7473-7485 (2014)); blue circles indicate sites that may have alternative gap alignments relative to the displayed gap alignments (see Figure 8 ). B, Summary of the total number of off-target sites identified genome-wide by GUIDE-seq for wild-type SpCas9 and SpCas9-HF1 from the two sgRNAs used in panel A. C, Identification of off-target sites for VEGFA sites 2 and 3 using wild-type SpCas9 or SpCas9-HF1, ranked by the total number of mismatches (within the protospacer and PAM) relative to the on-target site. The off-target sites marked with red circles in panel A are not included in these counts; the sites marked with blue circles in panel A are counted using the number of mismatches in the non-gap alignment.

[0043] Figure 5A -D| Activity of SpCas9-HF1 derivatives carrying additional substitutions. A, Human cell EGFP disruption activity of wild-type SpCas9, SpCas9-HF1, and SpCas9-HF1 derivative variants with eight sgRNAs. SpCas9-HF1 has N497A, R661A, Q695, and Q926A mutations; HF2 = HF1 + D1135E; HF3 = HF1 + L169A; HF4 = HF1 + Y450A. For n = 3, error bars represent standard error of the mean; the average level of background EGFP loss is represented by a red dashed line. B, Summary of on-target activity when using SpCas9-HF variants compared to wild-type SpCas9 with the eight sgRNAs from panel a. The median and interquartile range are shown; intervals showing >70% of wild-type activity are highlighted in green. C, In cells from that are resistant to the action of SpCas9-HF1 Figure 2A and 4AAverage percent modification of SpCas9 and HF variants at FANCF site 2 and VEGFA site 3 on-target sites, along with off-target sites. Percent modification was determined by T7E1 assay; background indel percentage was subtracted for all experiments. Error bars represent standard error of the mean for n=3. D, Specificity ratios of wild-type SpCas9 and HF variants with FANCF site 2 or VEGFA site 3 sgRNAs, plotted as the ratio of on-target to off-target activity (from panel C).

[0044] Figure 5E -F| Genome-wide specificity of SpCas9-HF1, -HF2, and -HF4 with sgRNAs that have off-target sites resistant to the action of SpCas9-HF1. E, Average GUIDE-seq tag integration at expected on-target sites for the GUIDE-seq experiments in panel F. SpCas9-HF1 = N497A / R661A / Q695A / Q926A; HF2 = HF1+D1135E; HF4 = HF1+Y450A. Error bars represent standard error of the mean for n=3. F, Off-target sites identified by GUIDE-seq of SpCas9-HF1, -HF2, or -HF4 with FANCF site 2 or VEGFA site 3 sgRNAs. Read counts represent a measure of the frequency of cleavage at a given site; mismatch positions within the spacer or PAM are highlighted in color. Prior to comparison between SpCas9-HF variants, fold improvement in off-target discrimination was calculated by normalizing off-target read counts of SpCas9-HF variants to read counts at on-target sites.

[0045] Fig. 6A -B|Interaction of SpCas9 with sgRNA and target DNA. A, Schematic diagram illustrating the SpCas9:sgRNA complex with base pairing between sgRNA and target DNA. B, Schematic diagram of the structure of the SpCas9:sgRNA complex bound to target DNA from PDB:4UN3 (ref.32). The four residues that form hydrogen bond contacts with the target DNA backbone are highlighted in blue; the HNH domain is hidden for visualization purposes.

[0046] Fig. 7A -D | Comparison of on-target activity of wild-type and SpCas9-HF1 with different sgRNAs used in GUIDE-seq experiments. A and C, quantified by restriction fragment length polymorphism assay, targeting Figure 2A and 4A (respectively small Fig. 7A and 7C) shows the average GUIDE-seq tag integration at the expected target site for GUIDE-seq experiments. For n = 3, error bars represent the standard error of the mean. b and d, detection by T7E1 assay for Figure 2A and 4A (respectively small Figure 7B and 7D ) Shown are the average percentage modifications at expected on-target sites for GUIDE-seq experiments. Error bars represent standard error of the mean for n=3.

[0047] Figure 8 |Potential alternative alignments for VEGFA site 2 off-target sites. Ten VEGFA site 2 off-target sites identified by GUIDE-seq (left) that could potentially be identified as off-target sites containing single nucleotide gaps (Lin et al., Nucleic Acids Res 42, 7473-7485 (2014)) (right) were aligned using Geneious (Kearse et al., Bioinformatics 28, 1647-1649 (2012)) version 8.1.6.

[0048] Fig. 9 | Activity of wild-type SpCas9 and SpCas9-HF1 with truncated sgRNAs 14. EGFP disruption by wild-type SpCas9 and SpCas9-HF1 using full-length or truncated sgRNAs targeting four sites in EGFP. Error bars represent standard error of the mean (sem) for n=3; average levels of background EGFP loss in control experiments are indicated by red dashed lines.

[0049] Fig.10 | Wild-type SpCas9 and SpCas9-HF1 activity with sgRNAs carrying 5' mismatched guanine bases. EGFP disruption activity of wild-type SpCas9 and SpCas9-HF1 with sgRNAs targeting four different sites. For each target site, the sgRNA contained either a matching non-guanine 5'-base or an intentionally mismatched 5'-guanine.

[0050] Fig.11 | Titration of the amount of wild-type SpCas9 and SpCas9-HF1 expression plasmids. EGFP knockout activity in human cells transfected with different amounts of wild-type and SpCas9-HF1 expression plasmids. The amount of sgRNA-containing plasmids was fixed at 250 ng for all transfections. Two sgRNAs targeting separate sites were used; for n=3, error bars represent the standard error of the mean (sem); the average level of background EGFP loss in the negative control is represented by a red dashed line.

[0051] Fig. 12A -D|Altering the PAM recognition specificity of SpCas9-HF1. A, Comparison of the average percent modification of on-target endogenous human sites by SpCas9-VQR (ref. 15) and improved SpCas9-VRQR using eight sgRNAs, quantified using the T7E1 assay. Both variants were engineered to recognize the NGAN PAM. For n=2 or 3, error bars represent the standard error of the mean. B, On-target EGFP disruption activity of SpCas9-VQR and SpCas9-VRQR compared to SpCas9-HF1 counterparts using eight sgRNAs. For n=3, error bars represent the standard error of the mean (sem); the average level of background EGFP loss in the negative control is indicated by a red dashed line. C, Comparison of the average on-target percent modification by SpCas9-VQR and SpCas9-VRQR compared to SpCas9-HF1 variants at eight endogenous human gene sites, quantified using the T7E1 assay. Error bars represent standard error of the mean (sem) for n=3; ND, not detected. D, Summary of fold change in on-target activity when using SpCas9-VQR or SpCas9-VRQR compared to the corresponding SpCas9-HF1 variants (from panels B and C). Medians and interquartile ranges are shown; intervals showing >70% wild-type activity are highlighted in green.

[0052] Fig.13A -B| Activity of wild-type SpCas9, SpCas9-HF1, and wild-type SpCas9 derivatives carrying one or more alanine substitutions at positions that could potentially contact non-target DNA strands. A and B, nucleases were evaluated using an EGFP disruption assay using sgRNAs that perfectly matched sites in the EGFP gene, along with sgRNAs intentionally mismatched at positions 11 and 12 (panel A) or positions 9 and 10 (panel B). The positions of the mismatch are numbered with position 20 being the most distal position to the PAM; the red dashed line indicates the background level of EGFP disruption; HF1 = SpCas9 with N497A / R661A / Q695A / Q926A substitutions.

[0053] Fig.14A-B| Activity of wild-type SpCas9, SpCas9-HF1, and SpCas9-HF1 derivatives carrying one or more alanine substitutions at positions that could potentially contact non-target DNA strands. A and B, nucleases were evaluated using an EGFP disruption assay using sgRNAs that perfectly matched sites in the EGFP gene, along with sgRNAs intentionally mismatched at positions 11 and 12 (panel A) or positions 9 and 10 (panel B). The positions of the mismatch are numbered with position 20 being the most distal position to the PAM; the red dashed line indicates the background level of EGFP disruption; HF1 = SpCas9 with N497A / R661A / Q695A / Q926A substitutions.

[0054] Fig.15 | Activity of wild-type SpCas9, SpCas9-HF1, and SpCas9 (Q695A / Q926A) derivatives carrying one or more alanine substitutions at positions that could potentially contact non-target DNA strands. Nucleases were evaluated using an EGFP disruption assay with sgRNAs that perfectly matched sites in the EGFP gene, along with sgRNAs intentionally mismatched at positions 11 and 12. The positions of mismatches are numbered with position 20 being the most distal position to the PAM; the red dashed line indicates the background level of EGFP disruption; HF1 = SpCas9 with N497A / R661A / Q695A / Q926A substitutions; Dbl = SpCas9 with Q695A / Q926A substitutions.

[0055] Fig.16 | Activity of wild-type SpCas9, SpCas9-HF1, and eSpCas9-1.1 using matched sgRNAs and sgRNAs with single mismatches at each position in the spacer. Nucleases were assessed using an EGFP disruption assay with a sgRNA that perfectly matched the site in the EGFP gene ("matched"), along with sgRNAs intentionally mismatched at the indicated positions. The positions of the mismatch are numbered with position 20 being the most distal position to the PAM. SpCas9-HF1 = N497A / R661A / Q695A / Q926A, and eSP1.1 = K848A / K1003A / R1060A.

[0056] Fig.17A-B| Activity of wild-type SpCas9 and variants using matched sgRNAs and sgRNAs with single mismatches at different positions in the spacer. (A) The activity of SpCas9 nucleases containing combinations of alanine substitutions (for positions that could potentially contact the target or non-target DNA strands) was evaluated using the EGFP disruption assay using a sgRNA that perfectly matched the site in the EGFP gene ("matched"), along with sgRNAs intentionally mismatched at the indicated spacer positions. (B) A subset of these nucleases from (a) was tested using the remainder of all possible single mismatch sgRNAs for the matched on-target site. The positions of the mismatch are numbered with position 20 being the most distal position to the PAM. mm = mismatch, WT = wild type, Db = Q695A / Q926A, HF1 = N497A / R661A / Q695A / Q926A, 1.0 = K810A / K1003A / R1060A, and 1.1 = K848A / K1003A / R1060A.

[0057] Fig.18 | Activity of wild-type SpCas9 and variants using matched sgRNAs and sgRNAs with mismatches at different single positions in the spacer. The activity of SpCas9 nucleases containing combinations of alanine substitutions (for positions that could potentially contact the target or non-target DNA strands) was assessed using an EGFP disruption assay using a sgRNA that perfectly matched the site in the EGFP gene ("matched"), along with sgRNAs intentionally mismatched at the indicated positions. Db = Q695A / Q926A, HF1 = N497A / R661A / Q695A / Q926A.

[0058] Fig.19A -B| Activity of wild-type SpCas9 and variants using matched sgRNAs and sgRNAs with mismatches at different single positions in the spacer. (A) On-target activity of SpCas9 nucleases containing combinations of alanine substitutions (for positions that could potentially contact the target or non-target DNA strands) was evaluated using the EGFP disruption assay using two sgRNAs that fully matched sites in the EGFP gene. (B) A subset of these nucleases from (a) were tested using sgRNAs containing mismatches at positions 12, 14, 16, or 18 (of sgRNA "site 1") in their spacer sequences to determine if mismatches conferred by these substitutions were intolerant. Db = Q695A / Q926A, HF1 = N497A / R661A / Q695A / Q926A.

[0059] Fig. 20| Structural comparison of SpCas9 (top) and SaCas9 (bottom), illustrating the similarity between the positions of mutations in the quadruple mutant construct (shown as yellow spheres). Also shown as pink spheres are additional residues that contact the DNA backbone.

[0060] Fig.21A -B | Activity of wild-type SaCas9 and SaCas9 derivatives carrying one or more alanine substitutions. A and B, SaCas9 substitutions were directed to positions that could potentially contact the target DNA strand (panel A), or have been previously shown to affect PAM specificity (panel B). Nucleases were evaluated using an EGFP disruption assay with sgRNAs that perfectly matched sites in the EGFP gene, along with sgRNAs intentionally mismatched at positions 11 and 12. Mismatched positions are numbered with position 20 being the most distal position to the PAM; the red dashed line indicates the background level of EGFP disruption.

[0061] Fig.22A -B| Activity of wild-type (WT) SaCas9 and SaCas9 derivatives carrying one or more alanine substitutions at residues that could potentially contact the target DNA strand. A and B, nucleases were evaluated using an EGFP disruption assay using sgRNAs that perfectly matched sites in the EGFP gene ("matched"), along with sgRNAs intentionally mismatched at positions 19 and 20. The positions of the mismatch are numbered with position 20 being the most distal position to the PAM.

[0062] Fig.23 Activity of wild-type (WT) SaCas9 and triple combinations of SaCas9 variants carrying alanine substitutions at residues that could potentially contact the target DNA strand. Nucleases were evaluated using an EGFP disruption assay. Each of the four target sites was tested using four different sgRNAs (matched #1-4), with mismatched sgRNAs also known to be effectively used by wild-type SaCas9. The mismatched sgRNAs for each site are shown to the right of each matched sgRNA (e.g., the only mismatched sgRNAs for matched site 3 are mm 11 & 12). The mismatched positions are numbered with position 21 being the most distal position of the PAM; mm, mismatch.

[0063] Fig.24A-B| Activity of wild-type (WT) SaCas9 and SaCas9 derivatives carrying one or more alanine substitutions at residues that could potentially contact the target DNA strand. A and B, SaCas9 variants carrying double (A) or triple (B) combinatorial substitutions were evaluated against matched and single mismatched endogenous human gene target sites using the T7E1 assay. Matched "on-target" sites are named according to their gene target site sgRNA number, according to Kleinstiver et al., Nature Biotechnology 2015. Mismatched sgRNAs are numbered using the mismatch occurring at position 21 (the most distal position to the PAM); the mismatched sgRNA is derived from the matched on-target site listed to the left of the mismatched sgRNA. Specific implementation plan

[0064] A limitation of the CRISPR-Cas9 nuclease is its potential to induce unwanted "off-target" mutations at imperfectly matched target sites (see, e.g., Tsai et al., Nat Biotechnol. 2015), in some cases with frequencies comparable to those observed at the intended on-target site (Fu et al., Nat Biotechnol. 2013). Previous work with the CRISPR-Cas9 nuclease has suggested that reducing the number of sequence-specific interactions between the guide RNA (gRNA) and the spacer region of the target site can reduce the mutagenic effects at cleaved off-target sites in human cells (Fu et al., Nat Biotechnol. 2014).

[0065] This was previously achieved by truncating the gRNA by 2 or 3 nt at its 5' end, and it was hypothesized that the mechanism of increased specificity was a reduction in the interaction energy of the gRNA / Cas9 complex, such that it reached an equilibrium with just enough energy to cleave the on-target site, making it less likely to have enough energy to cleave off-target sites, where there would likely be an energetic penalty due to mismatches with the target DNA site (WO 2015 / 099850).

[0066] It was hypothesized that off-target effects of SpCas9 (at DNA sites that are imperfect matches or mismatches to the intended target site for the guide RNA) could be minimized by reducing nonspecific interactions with the target DNA site. The SpCas9-sgRNA complex cleaves a target site consisting of an NGG PAM sequence (recognized by SpCas9) (Deltcheva, E. et al., Nature 471, 602-607 (2011); Jinek, M. et al., Science 337, 816-821 (2012); Jiang, W. et al., Nat Biotechnol 31, 233-239 (2013); (Sternberg, SH et al., Nature 507, 62-67 (2014)) and an adjacent 20 bp protospacer sequence (which is complementary to the 5' end of the sgRNA) (Jinek, M. et al., Science 337, 816-821 (2012); Jinek, M. et al., Elife 2, e00471 (2013); Mali, P. et al., Science [Science] 339, 823-826 (2013); Cong, L. et al., Science [Science] 339, 819-823 (2013)). It has been previously theorized that the SpCas9-sgRNA complex may possess more energy than required to recognize its intended target DNA site, thereby enabling cleavage of mismatched off-target sites (Fu, Y., et al., Nat Biotechnol [Nature Biotechnology] 32, 279-284 (2014)). One might envision that this property could be advantageous for the intended role of Cas9 in adaptive bacterial immunity, conferring the ability to cleave foreign sequences that may mutate.This excess energy model is also supported by previous studies showing that off-target effects can be reduced (but not eliminated) by reducing SpCas9 concentration (Hsu, PD et al., Nat Biotechnol [Nature Biotechnology] 31, 827-832 (2013); Pattanayak, V. et al., Nat Biotechnol [Nature Biotechnology] 31, 839-843 (2013)), or by reducing the complementarity length of the sgRNA (Fu, Y., et al., Nat Biotechnol [Nature Biotechnology] 32, 279-284 (2014), although other explanations for this effect have also been proposed (Josephs, EA et al., Nucleic Acids Res [Nucleic Acids Research] 43, 8924-8941 (2015); (Sternberg, SH et al., Nature [Nature] 527, 110-113 (2015); (Kiani, S. et al., Nat Methods [Nature Methods] 12, 1051-1054 (2015)))). The structural data suggest that the SpCas9-sgRNA-target DNA complex can be stabilized by several SpCas9-mediated DNA contacts, including those mediated by four SpCas9 residues (N497, R661, Q69 5, Q926) form direct hydrogen bonds with the phosphate backbone of the target DNA strand (Nishimasu, H. et al., Cell 156, 935-949 (2014); Anders, C., et al., Nature 513, 569-573 (2014)) (Figure 1a and Figures 6a and 6b). The inventors of the present invention envision that disruption of one or more of these contacts may energetically balance the SpCas9-sgRNA complex just enough to retain robust on-target activity, but with reduced activity for cleaving mismatched off-target sites.

[0067] As described herein, the Cas9 protein can theoretically be engineered to show increased specificity by reducing the binding affinity of Cas9 to DNA. By using structural information, directed evolution based on bacterial selection, and combinatorial design, a single alanine substitution was introduced into different residues in SpCas9 that are expected to interact with phosphates on the DNA backbone, and several variants of the widely used Streptococcus pyogenes Cas9 (SpCas9) were engineered. The cell activity of the variants can be further tested using a robust Escherichia coli-based screening assay to evaluate the cell activity of these variants; in this bacterial system, cell survival depends on the cutting and subsequent destruction of a selection plasmid containing a gene for the toxic gyrase poison ccdB and a gRNA with a sequence of 23 base pairs targeted by SpCas9, and leads to the identification of residues associated with retained or lost activity. In addition, another SpCas9 variant that exhibits improved target properties in human cells is identified and characterized.

[0068] In addition, as the activity of single alanine substitution mutants of SpCas9 was assessed in a bacterial cell-based system, a survival percentage between 50%-100% generally indicated robust cleavage, while 0% survival indicated that the enzyme had been functionally impaired. Additional mutations of SpCas9 were then assayed in bacteria, including: R63A, R66A, R69A, R70A, R71A, Y72A, R74A, R75A, K76A, N77A, R78A, R115A, H160A, K163A, R165A, L169A, R403A, T404A, F405A, N407A, R447A, N497A, I448A, Y450A, S460A, M49 5A, K510A, Y515A, R661A, M694A, Q695A, H698A, Y1013A, V1015A, R1122A, K1123A, K1124A, K1158A, K1185A, K1200A, S1216A, Q1221A, K1289A, R1298A, K1300A, K1325A, R1333A, K1334A, R1335A, and T1337A. Except for 2 mutants (R69A and F405A) with <5% survival in bacteria, all of these additional single mutations appeared to have no effect on the on-target activity of SpCas9 (>70% survival in bacterial screening).

[0069] To further determine whether the variants of Cas9 identified in the bacterial screen can function effectively in human cells, different alanine-substituted Cas9 mutants were tested using an EGFP disruption assay based on human U2OS cells. In this assay, successful cleavage of the target site in the coding sequence of a single integrated, constitutively expressed EGFP gene leads to the induction of indel mutations and disruption of EGFP activity, which is quantitatively assessed by flow cytometry (see, e.g., Reyon et al., Nat Biotechnol. [Natural Biotechnology] 2012 May; 30(5): 460-5).

[0070] These experiments showed that the results obtained in the bacterial cell-based assay correlated well with nuclease activity in human cells, suggesting that these engineering strategies can be extended to Cas9 from other species and different cells. Therefore, these findings provide support for SpCas9 and SaCas9 variants, which are collectively referred to herein as "variants" or "these variants."

[0071] All of the variants described herein can be rapidly incorporated into existing and widely used vectors, for example by simple site-directed mutagenesis, and since they require only a small number of mutations, these variants should also work with other previously described improvements to the SpCas9 platform (e.g., truncated sgRNAs (Tsai et al., Nat Biotechnol [Nature Biotechnology] 33, 187-197 (2015); Fu et al., Nat Biotechnol [Nature Biotechnology] 32, 279-284 (2014)), nickase mutations (Mali et al., Nat Biotechnol [Nature Biotechnology] 31, 833-838 (2013); Ran et al., Cell [Cell] 154, 1380-1389 (2013)), FokI-dCas9 fusions (Guilinger et al., Nat Biotechnol [Nature Biotechnology] 32, 577-582 (2014); Tsai et al., Nat Biotechnol [Nature Biotechnology] 32, 577-582 (2014); Biotechnol [Nature Biotechnology] 32, 569-576 (2014); WO 2014144288); and engineered CRISPR-Cas9 nucleases with altered PAM specificity (Kleinstiver et al., Nature [Nature]. 2015 July, 23; 523(7561):481-5).

[0072] Therefore, provided herein are Cas9 variants, including SpCas9 variants. The SpCas9 wild-type sequence is as follows:

[0073]

[0074]

[0075] SpCas9 variants described herein may include an amino acid sequence of SEQ ID NO: 1 having a mutation (i.e., replacing a natural amino acid with a different amino acid, such as alanine, glycine, or serine) at one or more of the following positions: N497, R661, Q695, Q926 (or at positions analogous thereto). In some embodiments, the SpCas9 variant is at least 80%, such as at least 85%, 90% or 95% identical to the amino acid sequence of SEQ ID NO: 1, for example, differing at up to 5%, 10%, 15% or 20% of the residues of SEQ ID NO: 1 that are replaced, for example, having conservative mutations in addition to the mutations described herein. In preferred embodiments, the variant retains the desired activity of the parent, such as nuclease activity (except where the parent is a nickase or dead Cas9), and / or the ability to interact with guide RNA and target DNA.

[0076] To determine the percent identity of two nucleic acid sequences, the sequences are aligned for the purpose of optimal alignment (e.g., gaps are introduced in one or both of a first and a second amino acid or nucleic acid sequence for optimal alignment, and non-homologous sequences are ignored for comparison purposes). For comparison purposes, the length of the reference sequence aligned for comparison purposes is at least 80%, and in some embodiments at least 90% or 100% of the length of the reference sequence. The nucleotides at corresponding amino acid positions or nucleotide positions are then compared. When a position in the first sequence is occupied by the same nucleotide as the corresponding position in the second sequence, then the molecules are identical at that position (as used herein, nucleic acid "identity" is equivalent to nucleic acid "homology"). The percent identity between the two sequences is a function of the number of identical positions shared by the sequences, taking into account the number of gaps and the length of each gap, which need to be introduced for optimal alignment of the two sequences. The percent identity between two polypeptide or nucleic acid sequences is determined in various ways within the skill in the art, for example, using publicly available computer software such as Smith Waterman Alignment (Smith, TF and MS Waterman (1981) J Mol Biol 147:195-7); "BestFit" (Smith and Waterman, Advances in Applied Mathematics, 482-489 (1981)), such as that incorporated into GeneMatcher Plus TM, Schwarz and Dayhof (1979) Atlas of Protein Sequence and Structure, Dayhof, MO ed., pp. 353-358; BLAST program (Basic Local Alignment Search Tool; (Altschul, SF, W. Gish, et al. (1990) J Mol Biol [Journal of Molecular Biology] 215:403-10), BLAST-2, BLAST-P, BLAST-N, BLAST-X, WU-BLAST-2, ALIGN, ALIGN-2, CLUSTAL, or Megalign (DNASTAR) software. In addition, one skilled in the art can determine appropriate parameters for measuring the alignment, including any algorithm required to achieve maximum alignment over the length of the compared sequences. Typically, for proteins or nucleic acids, the comparison length can be any length, up to and including the full length (e.g., 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or 100%). For the purposes of the compositions and methods of the present invention, at least 80% of the full length of the sequence is aligned.

[0077] For purposes of the present invention, comparison of sequences and determination of percent identity between two sequences can be accomplished using the Blossum 62 scoring matrix with a gap penalty of 12, a gap extension penalty of 4, and a frameshift gap penalty of 5.

[0078] Conservative substitutions typically include substitutions within the following groups: glycine, alanine; valine, isoleucine, leucine; aspartic acid, glutamic acid, asparagine, glutamine; serine, threonine; lysine, arginine; and phenylalanine, tyrosine.

[0079] In some embodiments, the SpCas9 variant comprises one of the following groups of mutations: N497A / R661A / Q695 / Q926A (quadruple alanine mutant); Q695A / Q926A (double alanine mutant); R661A / Q695A / Q926A and N497A / Q695A / Q926A (triple alanine mutant). In some embodiments, additional substitution mutations at L169 and / or Y450 may be added to these double, triple, and quadruple mutants, or to single mutants carrying mutations at Q695 or Q926. In some embodiments, the mutant has an alanine instead of a wild-type amino acid. In some embodiments, the mutant has any amino acid other than arginine or lysine (or a natural amino acid).

[0080] In some embodiments, the SpCas9 variant further comprises one of the following mutations, which reduces or abolishes the nuclease activity of Cas9: D10, E762, D839, H983 or D986 and H840 or N863, such as D10A / D10N and H840A / H840N / H840Y, so that the nuclease portion of the protein is catalytically inactive; substitutions at these positions can be alanine (as in Nishimasu et al., Cell 156, 935-949 (2014)) or other residues, such as glutamine, asparagine, tyrosine, serine or aspartic acid, such as E762Q, H983N, H983Y, D986N, N863D, N863S, or N863H (see WO 2014 / 152432). In some embodiments, the variant comprises a mutation at D10A or H840A (which generates a single-stranded nickase) or a mutation at D10A and H840A (which eliminates nuclease activity; such mutants are referred to as dead Cas9 or dCas9).

[0081] The SpCas9 N497A / R661A / Q695A / R926A mutations have analogous residues in Staphylococcus aureus Cas9 (SaCas9); see Fig. 20 As we have observed for SpCas9, mutations in residues that contact the DNA or RNA backbone are expected to increase the specificity of SaCas9. Therefore, SaCas9 variants are also provided herein.

[0082] The wild-type sequence of SaCas9 is as follows:

[0083]

[0084]

[0085] The SaCas9 variants described herein include an amino acid sequence of SEQ ID NO:2 having mutations at one, two, three, four, five, or all six of the following positions: Y211, W229, R245, T392, N419, and / or R654, for example, comprising a sequence at least 80% identical to an amino acid sequence of SEQ ID NO:2 having mutations at one, two, three, four, five, or six of the following positions: Y211, W229, R245, T392, N419, and / or R654.

[0086] In some embodiments, the variant SaCas9 protein further comprises one or more of the following mutations: Y211A; W229A; Y230A; R245A; T392A; N419A; L446A; Y651A; R654A; D786A; T787A; Y789A; T882A; K886A; N888A; A889A; L909A; N985A; N986A; R991A; R1015A; N44A; R45A; R51A; R55A; R59A; R66 0A; R116A; R165A; N169A; R208A; R209A; Y211A; T238A; Y239A; K248A; Y256A; R314A; N394A; Q414A; K57A; R61A; H1 11A; K114A; V164A; R165A; L788A; S790A; R792A; N804A; Y868A; K870A; K878A; K879A; K881A; Y897A; R901A; K906A.

[0087] In some embodiments, the variant SaCas9 protein comprises one or more of the following additional mutations: Y211A, W229A, Y230A, R245A, T392A, N419A, L446A, Y651A, R654A, D786A, T787A, Y789A, T882A, K886A, N888A, A889A, L909A, N985A, N986A, R991A, R1015A, N44A, R45A, R51A, R55A, R59A, R 60A, R116A, R165A, N169A, R208A, R209A, Y211A, T238A, Y239A, K248A, Y256A, R314A, N394A, Q414A, K57A, R61A, H1 11A, K114A, V164A, R165A, L788A, S790A, R792A, N804A, Y868A, K870A, K878A, K879A, K881A, Y897A, R901A, K906A.

[0088] In some embodiments, the variant SaCas9 protein comprises multiple substitution mutations: R245 / T392 / N419 / R654 and Y221 / R245 / N419 / R654 (quadruple variant mutants); N419 / R654, R245 / R654, Y221 / R654, and Y221 / N419 (double mutants); R245 / N419 / R654, Y211 / N419 / R654, and T392 / N419 / R654 (triple mutants). In some embodiments, the mutant comprises alanine instead of a wild-type amino acid.

[0089] In some embodiments, the variant SaCas9 protein further comprises a mutation at E782K, K929R, N968K, and / or R1015H. For example, a KKH variant (E782K / N968K / R1015H), a KRH variant (E782K / K929R / R1015H), or a KRKH variant (E782K / K929R / N968K / R1015H)].

[0090] In some embodiments, the variant SaCas9 protein further comprises one or more mutations selected from the group consisting of: a mutation at D10, E477, D556, H701, or D704; and a mutation at H557 or N580 that reduces nuclease activity.

[0091] In some embodiments, the mutation is: (i) D10A or D10N, (ii) H557A, H557N, or H557Y, (iii) N580A, and / or (iv) D556A.

[0092] Also provided herein are isolated nucleic acids encoding Cas9 variants, vectors for expressing these variant proteins comprising the isolated nucleic acids, optionally operably linked to one or more regulatory domains, and host cells (e.g., mammalian host cells) comprising the nucleic acids and optionally expressing these variant proteins.

[0093] The variants described herein can be used to alter the genome of a cell; methods generally include expressing these variant proteins in the cell, along with a guide RNA having a region complementary to a selected portion of the cellular genome. Methods for selectively altering the genome of a cell are known in the art, see, e.g., US 8,993,233; US 20140186958; US 9,023,649; WO / 2014 / 099744; WO 2014 / 089290; WO 2014 / 144592; WO 144288; WO 2014 / 204578; WO2014 / 152432; WO 2115 / 099850; US 8,697,359; US 20160024529; US 20160024524; US 20160024523; US 20160024510; US 20160017366; US 20160017301; US 20150376652; US20150356239; US 20150315576; US 20150291965; US 20150252358; US 20150247150; US20150232883; US 20150232882; US 20150203872; US 20150191744; US 20150184139; US20150176064; US 20150167000; US 20150166969; US 20150159175; US 20150159174; US20150093473; US 20150079681; US ​​20150067922; US 20150056629; US 20150044772; US20150024500; US 20150024499; US 20150020223; US 20140356867; US 20140295557; US20140273235; US 20140273226; US 20140273037; US 20140189896; US 20140113376; US20140093941; US ​​20130330778; US 20130288251;US 20120088676; US 20110300538; US20110236530; US 20110217739; US 20110002889; US 20100076057; US 20110189776; US20110223638; US 20130130248; US 20150050699;US 20150071899; US 20150050699; US20150045546; US 20150031134; US 20150024500; US 20140377868; US 20140357530; US20140349400; US 20140335620; US 20140335063; US 20140315985; US 20140310830; US20140310828; US 20140309487; US 20140304853; US 20140298547; US 20140295556; US20140294773; US 20140287938; US 20140273234; US 20140273232; US 20140273231; US20140273230; US 20140271987; US 20140256046; US 20140248702; US 20140242702; US20140242700; US 20140242699; US 20140242664; US 20140234972; US 20140227787; US20140212869; US 20140201857; US 20140199767; US 20140189896; US 20140186958; US20140186919; US 20140186843; US 20140179770; US 20140179006; US 20140170753; WO / 2008 / 108989; WO / 2010 / 054108; WO / 2012 / 164565; WO / 2013 / 098244; WO / 2013 / 176772; US20150071899; Makarova et al., “Evolution and classification of the CRISPR-Cas system,” 9(6) Nature Reviews Microbiology, 467-477(1-23) (June 2011); Wiedenheft et al., “RNA-guided genetic silencing systems in bacteria and archaea,” 482 Nature, 331-338 (February 16, 2012);Gasiunas et al., “Cas9-crRNA ribonucleoprotein complex mediates specific DNA cleavage for adaptive immunity in bacteria,” 109(39) Proceedings of the National Academy of Sciences USA E2579-E2586 (September 4, 2012); Jinek et al., “A Programmable Dual-RNA-Guided DNA Endonuclease in Adaptive Bacterial Immunity,” 337 Science 816-821 (August 17, 2012); Carroll, “ACRISPR Approach to Gene Targeting[CRISPR Pathways for Gene Targeting]” 20(9) Molecular Therapy 1658-1660 (September 2012); U.S. Application No. 61 / 652,086 filed May 25, 2012; Al-Attar et al., Clustered Regularly Interspaced Short Palindromic Repeats (CRISPRs): The Hallmark of an Ingenious Antiviral Defense Mechanism in Prokaryotes, Biol Chem. (2011) 392, 4, 277-289; Hale et al., Essential Features and Rational Design of CRISPR RNAs That Function With the Cas RAMP Module Complex to Cleave RNAs, Molecular Cell, (2012) Vol. 45, No. 3, 292-302.

[0094] The variant proteins described herein can be used to replace any of the Cas9 proteins described in the above references, or in addition to any of the Cas9 proteins described in the above references, the variant proteins described herein can be used, or the variant proteins described herein can be used in combination with the mutations described herein. In addition, the variants described herein can be used in fusion proteins, replacing wild-type Cas9 or other Cas9 mutations known in the art (e.g., dCas9 or Cas9 nickases described above), such as fusion proteins with heterologous functional domains, as described in the following documents: US 8,993,233; US20140186958; US 9,023,649; WO / 2014 / 099744; WO 2014 / 089290; WO 2014 / 144592; WO144288; WO 2014 / 204578; WO 2014 / 152432; WO 2115 / 099850; US 8,697,359; US 2010 / 0076057; US 2011 / 0189776; US 2011 / 0223638; US 2013 / 0130248; WO / 2008 / 108989; WO / 2010 / 054108; WO / 2012 / 164565; WO / 2013 / 098244; WO / 2013 / 176772; US 20150050699; US20150071899 and WO 2014 / 124284.For example, variants preferably comprising one or more nuclease reducing, altering, or killing mutations can be fused to a transcriptional activation domain or other heterologous functional domain (e.g., a transcriptional repressor (e.g., KRAB, ERD, SID, etc., such as amino acids 473-530 of the repressor domain (ERD) of ets2 repressor factor (ERF), amino acids 1-97 of the KRAB domain of KOX1, or amino acids 1-36 of the Mad mSIN3 interaction domain (SID); see Beerli et al., PNAS USA [Proceedings of the National Academy of Sciences of the United States] 95: 14628-14633 (1998)) or silencers such as heterochromatin protein 1 (HP1, also known as swi6), for example, HP1α or HP1β; proteins or peptides known in the art that can recruit long noncoding RNAs (lncRNAs) fused to fixed RNA binding sequences (such as those bound by MS2 coat protein, endoribonuclease Csy4 or λN protein) can also be used; enzymes that modify the methylation state of DNA (such as DNA methyltransferases (DNMTs) or TET proteins)); or enzymes that modify histone subunits (such as histone acetyltransferases (HATs), histone deacetylases (HDACs), histone methyltransferases (e.g., for methylation of lysine or arginine residues) or histone demethylases (e.g., for demethylation of lysine or arginine residues)). Multiple sequences of such domains are known in the art, such as domains that catalyze the hydroxylation of methylated cytosine in DNA. Exemplary proteins include the ten-eleven translocation (TET) 1-3 family, which are enzymes that convert 5-methylcytosine (5-mC) to 5-hydroxymethylcytosine (5-hmC) in DNA.

[0095] The sequences of human TET1-3 are known in the art and are shown in the table below:

[0096]

[0097] * Variant (1) represents the longer transcript and encodes the longer isoform (a). Variant (2) differs in the 5'UTR and in the 3'UTR as well as the coding sequence compared to variant 1. The resulting isoform (b) is shorter and has a different C-terminus compared to isoform a.

[0098] In some embodiments, all or a portion of the full-length sequence of a catalytic domain may be included, such as a catalytic module comprising a cysteine-rich extension and a 2OGFeDO domain encoded by seven highly conserved exons, such as a Tet1 catalytic domain comprising amino acids 1580-2052, Tet2 comprising amino acids 1290-1905, and Tet3 comprising amino acids 966-1678. See, e.g., Iyer et al., Cell Cycle. 2009 Jun 1; 8(11): 1698-710, Figure 1. Electronic publication June 27, 2009, for an alignment of key catalytic residues in all three Tet proteins, and supplementary material for the full-length sequences (available at the ftp site ftp.ncbi.nih.gov / pub / aravind / DONS / supplementary_material_DONS.html) (see, e.g., seq 2c); in some embodiments, the sequence includes amino acids 1418-2136 of Tet1 or the corresponding region in Tet2 / 3.

[0099] Other catalytic modules may be derived from proteins identified by Iyer et al., 2009.

[0100] In some embodiments, the heterologous functional domain is a biological tether and comprises all or part of an MS2 coat protein, an endoribonuclease Csy4 or a λN protein (e.g., a DNA binding domain). These proteins can be used to recruit RNA molecules comprising a specific stem-loop structure to a position specified by a dCas9 gRNA targeting sequence. For example, a dCas9 variant fused to an MS2 coat protein, an endoribonuclease Csy4 or λN can be used to recruit long noncoding RNAs (lncRNAs) such as XIST or HOTAIR; see, for example, Keryer-Bibens et al., Biol. Cell [Biological Cell] 100: 125-138 (2008), which is connected to a Csy4, MS2 or λN binding sequence. Alternatively, a Csy4, MS2 or λN protein binding sequence can be connected to another protein, for example, as described above by Keryer-Bibens et al., and the methods and compositions described herein can be used to target the protein to a dCas9 variant binding site. In some embodiments, Csy4 is catalytically inactive. In some embodiments, the Cas9 variant (preferably a dCas9 variant) is fused to FokI as described in the following documents: US 8,993,233; US 20140186958; US 9,023,649; WO / 2014 / 099744; WO 2014 / 089290; WO 2014 / 144592; WO 144288; WO 2014 / 204578; WO 2014 / 152432; WO 2115 / 099850; US 8,697,359; US 2010 / 0076057; US 2011 / 0189776; US 2011 / 0223638; US 2013 / 0130248; WO / 2008 / 108989; WO / 2010 / 054108; WO / 2012 / 164565; WO / 2013 / 098244; WO / 2013 / 176772; US 20150050699; US 20150071899 and WO2014 / 204578.

[0101] In some embodiments, the fusion protein includes a joint between a dCas9 variant and a heterologous functional domain. The joint that can be used for these fusion proteins (or between the fusion proteins in the connected structure) can include any sequence that does not interfere with the function of the fusion protein. In a preferred embodiment, the joint is short, such as 2-20 amino acids, and is typically flexible (i.e., comprising amino acids with a high degree of freedom, such as glycine, alanine, and serine). In some embodiments, the joint includes one or more units composed of GGGS (SEQ ID NO: 3) or GGGGS (SEQ ID NO: 4), such as two, three, four, or more repetitions of GGGS (SEQ ID NO: 5) or GGGGS (SEQ ID NO: 6) units. Other joint sequences can also be used.

[0102] In some embodiments, the variant protein includes a cell penetrating peptide that facilitates delivery to the intracellular space, such as a TAT peptide derived from HIV, a transmembrane peptide, a transit peptide, or a cell penetrating peptide derived from hCT, see, e.g., Caron et al., (2001) Mol Ther. 3(3):310-8; Langel, Cell-Penetrating Peptides: Processes and Applications (CRC Press, Boca Raton FL 2002); El-Andaloussi et al., (2005), Curr Pharm Des. 11(28):3597-611; and Deshayes et al., (2005) Cell Mol Life Sci. 62(16):1839-49.

[0103] Cell penetrating peptides (CPPs) are short peptides that assist a wide range of biomolecules to move across the cell membrane into the cytoplasm or other organelles, such as mitochondria and the nucleus. Examples of molecules that can be delivered by CPPs include therapeutic drugs, plasmid DNA, oligonucleotides, siRNA, peptide nucleic acids (PNA), proteins, peptides, nanoparticles, and liposomes. CPPs are generally 30 amino acids or less, naturally derived or non-naturally occurring proteins or chimeric sequences, and contain high relative abundance of positively charged amino acids, such as lysine or arginine, or an alternating pattern of polar and non-polar amino acids. CPPs commonly used in the art include Tat (Frankel et al., (1988) Cell. 55: 1189-1193, Vives et al., (1997) J. Biol. Chem. 272: 16010-16017), transmembrane peptides (Derossi et al., (1994) J. Biol. Chem. 269: 10444-10450), polyarginine peptide sequences (Wende et al., (1997) J. Biol. Chem. 273: 10444-10450), r et al., (2000) Proc. Natl. Acad. Sci. USA [Proceedings of the National Academy of Sciences of the United States of America] 97:13003-13008, Futaki et al., (2001) J. Biol. Chem. [Journal of Biological Chemistry] 276:5836-5840), and transportans (Pooga et al., (1998) Nat. Biotechnol. [Nature Biotechnology] 16:857-861).

[0104] CPPs can be linked to their cargo by covalent or non-covalent strategies. Methods for covalently linking CPPs and their cargo are known in the art, such as chemical cross-linking (Stetsenko et al., (2000) J. Org. Chem. [Journal of Biological Chemistry] 65: 4900-4909, Gait et al., (2003) Cell. Mol. Life. Sci. [Cell and Molecular Life Science] 60: 844-853) or cloning fusion proteins (Nagahara et al., (1998) Nat. Med. [Natural Medicine] 4: 1449-1453). Non-covalent linkages between cargo and short amphiphilic CPPs containing polar and non-polar domains are established by electrical and hydrophobic interactions.

[0105] CPPs have been used in the art to potentially deliver therapeutic biomolecules to cells. Examples include cyclosporine linked to polyarginine for immunosuppression (Rothbard et al., (2000) Nature Medicine 6(11):1253-1257), siRNA against cyclin B1 linked to a CPP called MPG for inhibiting tumorigenesis (Crombez et al., (2007) Biochem Soc. Trans. 35:44-46), tumor suppressor p53 peptide linked to CPP to reduce cancer cell growth (Takenobu et al., (2002) Mol. Cancer Ther. 1(12):1043-1049, Snyder et al., (2004) PLoS One Biol. [Public Library of Science Biology] 2:E36), and dominant-negative forms of Ras or phosphoinositide 3-kinase (PI3K) fused to Tat for the treatment of asthma (Myou et al., (2003) J. Immunol. [Journal of Immunology] 171:4399-4405).

[0106] CPPs have been used in the art to transport contrast agents into cells for imaging and biosensing applications. For example, green fluorescent protein (GFP) attached to Tat has been used to label cancer cells (Shokolenko et al., (2005) DNA Repair 4(4):511-518). Tat conjugated to quantum dots has been used to successfully cross the blood-brain barrier to visualize the rat brain (Santra et al., (2005) Chem. Commun. 3144-3146). CPPs have also been used in conjunction with magnetic resonance imaging techniques for cell imaging (Liu et al., (2006) Biochem. and Biophys. Res. Comm. 347(1):133-140). See also Ramsey and Flynn, Pharmacol Ther. 2015 Jul 22. pii:S0163-7258(15)00141-2.

[0107] Alternatively, or in addition, the variant protein may include a nuclear localization sequence, such as the SV40 large T antigen NLS (PKKKRRV (SEQ ID NO: 7)) and the nucleoplasmin NLS (KRPAATKKAGQAKKKK (SEQ ID NO: 8)). Other NLSs are known in the art; see, for example, Cokol et al., EMBO Rep. 2000 November 15; 1(5):411-415; Freitas and Cunha, Curr Genomics. 2009 December; 10(8):550-557.

[0108] In some embodiments, the variant includes a portion with high affinity for a ligand, such as GST, FLAG or a hexahistidine sequence. Such affinity tags can assist in purifying the recombinant variant protein.

[0109] For methods in which variant proteins are delivered to cells, the proteins can be produced using any method known in the art, such as by in vitro translation, or in a suitable host cell, from expression of a nucleic acid encoding the variant protein; a variety of methods for producing proteins are known in the art. For example, the protein can be produced in yeast, E. coli, insect cell lines, plants, transgenic animals, or cultured mammalian cells and then purified; see, e.g., Palomares et al., "Production of Recombinant Proteins: Challenges and Solutions," Methods Mol Biol. 2004; 267: 15-52. In addition, the variant protein can be linked to a moiety that assists in transfer into the cell, such as a lipid nanoparticle, optionally using a linker that is cleaved once the protein enters the cell. See, e.g., LaFountaine et al., Int J Pharm. 2015 Aug 13; 494(1): 180-194.

[0110] Expression system

[0111] In order to use the Cas9 variants described herein, it may be desirable to express them from nucleic acids encoding them. This can be done in a variety of ways. For example, nucleic acids encoding Cas9 variants can be cloned into intermediate vectors for transformation into prokaryotic or eukaryotic cells for replication and / or expression. Intermediate vectors are typically prokaryotic vectors, such as plasmids, or shuttle vectors, or insect vectors, for storage or manipulation of nucleic acids encoding Cas9 variants or for production of Cas9 variants. Nucleic acids encoding Cas9 variants can also be cloned into expression vectors for administration to plant cells, animal cells, preferably mammalian cells or human cells, fungal cells, bacterial cells, or protozoan cells.

[0112] In order to obtain expression, the sequence encoding the Cas9 variant is typically subcloned into an expression vector comprising a promoter for directing transcription. Suitable bacterial and eukaryotic promoters are well known in the art, and are described, for example, in Sambrook et al., Molecular Cloning, A Laboratory Manual [Molecular Cloning Laboratory Guide] (3rd Edition, 2001); Kriegler, Gene Transfer and Expression: A Laboratory Manual [Gene Transfer and Expression: Laboratory Manual] (1990); and Current Protocols in Molecular Biology [Molecular Biology Modern Methods] (Ausubel et al., 2010). Bacterial expression systems for expressing engineered proteins are available, such as in Escherichia coli, Bacillus species, and Salmonella (Palva et al., 1983, Gene [Gene] 22: 229-235). Kits for such expression systems are commercially available. Eukaryotic expression systems for mammalian cells, yeast, and insect cells are well known in the art and are also commercially available.

[0113] The promoter used to direct the expression of nucleic acid depends on the specific application. For example, typically, a strong constitutive promoter is used for the expression and purification of fusion proteins. In contrast, when Cas9 variants are administered in vivo for gene regulation, a constitutive promoter or an inducible promoter can be used, depending on the specific use of the Cas9 variant. In addition, a preferred promoter for administering Cas9 variants can be a weak promoter, such as HSV TK, or a promoter with similar activity. The promoter may also include elements that respond to transcriptional activation, such as hypoxia response elements, Gal4 response elements, lac repressor response elements, and small molecule control systems, such as the tetracycline regulation system and the RU-486 system (see, e.g., Gossen & Bujard, 1992, Proc. Natl. Acad. Sci. USA, 89:5547; Oligino et al., 1998, Gene Ther., 5:491-496; Wang et al., 1997, Gene Ther., 4:432-441; Neering et al., 1996, Blood, 88:1147-55; and Rendahl et al., 1998, Nat. Biotechnol., 16:757-761).

[0114] In addition to the promoter, the expression vector typically comprises a transcription unit or expression cassette, which contains all the additional elements required for expressing the nucleic acid in a host cell (prokaryotic or eukaryotic). Thus, a typical expression cassette comprises a promoter effectively connected to, for example, a nucleic acid sequence encoding a Cas9 variant, and any signals required for, for example, efficient polyadenylation of the transcript, transcription termination, ribosome binding site, or translation termination. Additional elements of the cassette may include, for example, enhancers, and intrinsic signals for heterologous splicing.

[0115] A specific expression vector for transporting genetic information into cells is selected with respect to the intended use of the Cas9 variant, e.g., expression in plants, animals, bacteria, fungi, protozoa, etc. Standard bacterial expression vectors include plasmids, such as pBR322-based plasmids, pSKF, pET23D, and commercially available tag fusion expression systems, such as GST and LacZ.

[0116] Expression vectors containing regulatory elements from eukaryotic viruses are commonly used for eukaryotic expression vectors, such as SV40 vectors, papillomavirus vectors, and vectors derived from Epstein-Barr virus. Other exemplary eukaryotic vectors include pMSG, pAV009 / A+, pMTO10 / A+, pMAMneo-5, baculovirus pDSVE, and any other vectors that allow expression of proteins under the direction of the following promoters: SV40 early promoter, SV40 late promoter, metallothionein promoter, murine mammary tumor virus promoter, Rous sarcoma virus promoter, polyhedrin promoter, or other promoters shown to be effective for expression in eukaryotic cells.

[0117] Vectors for expressing Cas9 variants can include an RNA Pol III promoter to drive the expression of the guide RNA, such as the H1, U6, or 7SK promoters. These human promoters allow the expression of Cas9 variants in mammalian cells after plasmid transfection.

[0118] Some expression systems have markers for selection of stably transfected cell lines, such as thymidine kinase, hygromycin B phosphotransferase, and dihydrofolate reductase. High-yield expression systems are also suitable, such as using baculovirus vectors in insect cells with the gRNA coding sequence under the guidance of the polyhedrin promoter or other strong baculovirus promoters.

[0119] Elements typically included in expression vectors also include a replicon that functions in E. coli, genes encoding antibiotic resistance to allow selection of bacteria harboring the recombinant plasmid, and unique restriction sites in nonessential regions of the plasmid to allow insertion of recombinant sequences.

[0120] Standard transfection methods are used to generate bacterial, mammalian, yeast or insect cell lines that express large amounts of proteins, which are then purified using standard techniques (see, e.g., Colley et al., 1989, J. Biol. Chem., 264: 17619-22; Guide to Protein Purification, Methods in Enzymology, Vol. 182 (Deutscher ed., 1990). Transformation of eukaryotic and prokaryotic cells is performed according to standard techniques (see, e.g., Morrison, 1977, J. Bacteriol. 132: 349-351; Clark-Curtiss & Curtiss, Methods in Enzymology 101: 347-362 (Wu et al. ed., 1983).

[0121] Any known procedure for introducing exogenous nucleotide sequences into host cells can be used. These include the use of calcium phosphate transfection, polybrene, protoplast fusion, electroporation, nuclear transfection, liposomes, microinjection, naked DNA, plasmid vectors, viral vectors, both episomal and integrative, and any other well-known methods for introducing cloned genomic DNA, cDNA, synthetic DNA or other exogenous gene materials into host cells (see, e.g., Sambrook et al., supra). It is only necessary to use a specific genetic engineering program that can successfully introduce at least one gene into a host cell that can express a Cas9 variant.

[0122] The method of the present invention can also include modifying the gDNA by introducing the purified Cas9 protein into the cell together with the gRNA as a ribonucleoprotein (RNP) complex, together with the introduction of the gRNA plus the mRNA encoding Cas9. The gRNA can be a synthetic gRNA or a nucleic acid encoding a guide RNA (e.g., in an expression vector).

[0123] The present invention also includes vectors and cells comprising the vectors.

[0124] Example

[0125] The present invention is further illustrated in the following examples, which are not intended to limit the scope of the invention described in the claims.

[0126] method

[0127] Bacteria-based positive selection assay for evolving SpCas9 variants

[0128] Transform competent E. coli BW25141 (γDE3) containing a positive selection plasmid (with an embedded target site) with the Cas9 / sgRNA encoding plasmid 23 After 60 min recovery in SOB medium, transformants were plated on LB plates containing chloramphenicol (non-selective) or chloramphenicol + 10 mM arabinose (selective).

[0129] To identify additional positions that may be critical for genome-wide target specificity, we adapted a bacterial selection system (hereafter referred to as positive selection) previously used to study the properties of homing endonucleases (Chen & Zhao, Nucleic Acids Res [Nucleic Acids Research] 33, e154 (2005); Doyon et al., J Am Chem Soc [American Chemical Society Journal] 128, 2477-2484 (2006)).

[0130] In this adjustment of the system, Cas9-mediated cleavage of a positive selection plasmid encoding an inducible toxic gene enables cell survival, which is attributed to the subsequent degradation and loss of the linearized plasmid. After determining that SpCas9 can work in a positive selection system, the ability of wild-type and variants to cut a selection plasmid containing a target site selected from a known human genome was tested. These variants were introduced into bacteria with a positive selection plasmid containing the target site and plated on a selective medium. The cutting of the positive selection plasmid was estimated by calculating the survival frequency: colonies on a selective plate / colonies on a non-selective plate (see Figures 1, 5-6).

[0131] A subset of plasmids used in this study (sequences shown below)

[0132]

[0133] Human cell culture and transfection

[0134] Incubate the cells with EGFP-PEST reporter gene constitutively expressed at 37°C and 5% CO2. 15 U2OS.EGFP cells with a single integrated copy of were cultured in advanced DMEM medium (Life Technologies) supplemented with 10% FBS, 2mM GlutaMax (Life Technologies), penicillin / streptomycin, and 400μg / ml of G418. Cells were co-transfected with 750ng of Cas9 plasmid and 250ng of sgRNA plasmid (unless otherwise noted) using the DN-100 program of the Lonza 4D-nucleofector according to the manufacturer's protocol. Cas9 plasmid transfected with an empty U6 promoter plasmid was used as a negative control for all human cell experiments. (See Figures 2, 7-10).

[0135] EGFP disruption assay in human cells

[0136] As previously mentioned 16 EGFP destruction experiments were performed. Transfected cells were analyzed for EGFP expression approximately 52 hours after transfection using a Fortessa flow cytometer (BD Biosciences). Background EGFP loss was gated at approximately 2.5% for all experiments (see Figures 2, 7).

[0137] T7E1 assay, targeted deep sequencing, and GUIDE-seq to quantify nuclease-induced mutation rates

[0138] The T7E1 assay was performed as previously described for human cells (Kleinstiver, BP et al., Nature 523, 481-485 (2015)). For U2OS.EGFP human cells, genomic DNA was extracted from transfected cells approximately 72 hours after transfection using the Agencourt DNA Advance Genomic DNA Isolation Kit (Beckman Coulter Genomics). Approximately 200 ng of purified PCR product was denatured, annealed, and digested with T7E1 (New England Biolabs). The mutagenesis frequency was quantified using a Qiaxcel capillary electrophoresis instrument (Qiagen) as previously described for human cells (Kleinstiver et al., Nature 523, 481-485 (2015); Reyon et al., Nat Biotechnol 30, 460-465 (2012)).

[0139] GUIDE-seq experiments were performed as previously described (Tsai et al., Nat Biotechnol [Nature Biotechnology] 33, 187-197 (2015)). In brief, phosphorylated phosphorothioate-modified double-stranded oligodeoxynucleotides (dsODNs) were transfected into U2OS cells with Cas9 nuclease along with Cas9 and sgRNA expression plasmids as described above. dsODN-specific amplification, high-throughput sequencing, and mapping were performed to identify genomic intervals containing DSB activity. For wild-type and double or quadruple mutant variant experiments, off-target read counts were normalized to on-target read counts to correct for differences in sequencing depth between samples. The normalized ratios of wild-type and variant SpCas9 were then compared to calculate the fold change in activity at off-target sites. To determine whether the wild-type and SpCas9 variant samples of GUIDE-seq have similar oligonucleotide tag integration rates at the expected target sites, restriction fragment length polymorphism (RFLP) assays were performed by amplifying the expected target loci from 100ng genomic DNA (isolated as described above) with Phusion Hot-Start Flex. Approximately 150ng of PCR product was digested with 20U NdeI (New England Biolabs) for 3 hours at 37°C before cleaning with the Agencourt Ampure XP kit. The RFLP results were quantified using a Qiaxcel capillary electrophoresis instrument (Qiagen) to roughly estimate the oligonucleotide tag integration rate. As described above, T7E1 assays were performed for similar purposes.

[0140] Example 1

[0141] A potential solution to address the targeting specificity of CRISPR-Cas9 RNA-guided gene editing would be to engineer Cas9 variants with novel mutations.

[0142] Based on these earlier results, it was hypothesized (without wishing to be bound by theory) that the specificity of the CRISPR-Cas9 nuclease could be significantly reduced by reducing the non-specific binding affinity of Cas9 to DNA (mediated by binding to phosphate groups on DNA or hydrophobic bases that interact with DNA stacking). This approach would have the advantage of not reducing the length of the target site recognized by the gRNA / Cas9 complex as in the previously described truncated gRNA approach. It was inferred that the non-specific binding affinity of Cas9 to DNA could be reduced by mutating the amino acid residues that contact the phosphate groups on the target DNA.

[0143] Similar approaches have been used to generate variants of non-Cas9 nucleases such as TALENs (see, e.g., Guilinger et al., Nat. Methods. 11:429 (2014)).

[0144] In an initial test of this hypothesis, the present inventors attempted to engineer reduced affinity variants of the widely used Streptococcus pyogenes Cas9 (SpCas9) by introducing single alanine substitutions into different residues in SpCas9 that might be expected to interact with phosphates on the DNA backbone. The activity of these variants was assessed using an E. coli-based screening assay (Kleinstiver et al., Nature [Nature]. July 23, 2015; 523(7561): 481-5). In this bacterial system, cell survival depends on the cleavage (and subsequent destruction) of a selection plasmid containing a gene for the toxic gyrase poison ccdB and a gRNA to a 23-base pair sequence targeted by SpCas9. The results of the residues that retained or lost activity identified in this experiment are (Table 1).

[0145] Table 1: Activities of single alanine substitution mutants of Cas9

[0146] As evaluated in the bacterial cell-based system shown in Figure 1 .

[0147] mutation % Survival mutation % Survival mutation % Survival R63A 84.2 Q926A 53.3 K1158A 46.5 R66A 0 K1107A 47.4 K1185A 19.3 R70A 0 E1108A 40.0 K1200A 24.5 R74A 0 S1109A 96.6 S1216A 100.4 R78A 56.4 K1113A 51.8 Q1221A 98.8 R165A 68.9 R1114A 47.3 K1289A 55.2 R403A 85.2 S1116A 73.8 R1298A 28.6 N407A 97.2 K1118A 48.7 K1300A 59.8 N497A 72.6 D1135A 67.2 K1325A 52.3 K510A 79.0 S1136A 69.2 R1333A 0 Y515A 34.1 K1151A 0 K1334A 87.5 R661A 75.0 K1153A 76.6 R1335A 0 Q695A 69.8 K1155A 44.6 T1337A 64.6

[0148] Survival percentages between 50%-100% generally indicate robust cleavage, while 0% survival indicates that the enzyme has been functionally compromised. Additional mutations assayed in bacteria (but not shown in the table above) include: R69A, R71A, Y72A, R75A, K76A, N77A, R115A, H160A, K163A, L169A, T404A, F405A, R447A, I448A, Y450A, S460A, M495A, M694A, H698A, Y1013A, V1015A, R1122A, K1123A, and K1124A. Except for R69A and F405A (with <5% survival in bacteria), all of these additional single mutations appear to have no effect on the on-target activity of SpCas9 (>70% survival in bacterial screening).

[0149] 15 different SpCas9 variants carrying all possible single, double, triple, and quadruple combinations of N497A, R661A, Q695A, and Q926A mutations were constructed to test whether contacts made by these residues might be ineffective for on-target activity ( FIG. 1 b ). For these experiments, a previously described human cell-based assay was used, in which cleavage and induction of insertion or deletion mutations (indels) by nonhomologous end joining (NHEJ)-mediated repair within a single integrated EGFP reporter gene resulted in loss of cellular fluorescence (Reyon, D. et al., Nat Biotechnol. 30, 460-465, 2012). When paired with wild-type SpCas9, all 15 SpCas9 variants possessed comparable EGFP destruction activity to wild-type SpCas9 using an EGFP-targeted sgRNA previously shown to effectively disrupt EGFP expression in human cells (Fu, Y. et al., Nat Biotechnol [Nature Biotechnology] 31, 822-826 (2013)). Therefore, substitution of one or all of these residues does not reduce the on-target cleavage efficiency of SpCas9 with this EGFP-targeted sgRNA.

[0150] Next, experiments were performed to assess the relative activity of all 15 SpCas9 variants at mismatched target sites. To do this, the EGFP disruption assay was repeated using derivatives of the EGFP-targeted sgRNAs used in previous experiments that contained substituted base pairs at positions 13 and 14, 15 and 16, 17 and 18, and 18 and 19 (numbered as follows, starting with 1 for the base closest to the PAM and ending with 20 for the base farthest from the PAM; Figure 1b). These analyses revealed that one of the triple mutants (R661A / Q695A / Q926A) and the quadruple mutant (N497A / R661A / Q695A / Q926A) showed levels of EGFP disruption equivalent to the background using all four mismatched sgRNAs (Figure 1b, with color bars). Notably, among the 15 variants, those with the lowest activity with mismatched sgRNAs all contained Q695A and Q926A mutations. Based on these results and similar data from experiments using sgRNAs for another EGFP target site, the quadruple mutant (N497A / R661A / Q695A / Q926A) was selected for additional analysis and designated SpCas9-HF1 (for high-fidelity variant #1).

[0151] On-target activity of SpCas9-HF1

[0152] To determine how robustly SpCas9-HF1 could function at a larger number of on-target sites, direct comparisons were made between this variant and wild-type SpCas9 using additional sgRNAs. In total, 37 different sgRNAs were tested: 24 targeted to EGFP (assayed with the EGFP disruption assay) and 13 targeted to endogenous human gene targets (assayed using the T7 endonuclease I (T7EI) mismatch assay). 20 of the 24 sgRNAs tested with the EGFP disruption assay (Figure 1c) and 12 of the 13 sgRNAs tested on endogenous human gene sites (Figure 1d) showed activity of SpCas9-HF1 that was at least 70% of the activity between wild-type SpCas9 and the same sgRNA (Figure 1e). In fact, SpCas9-HF1 showed highly comparable activity (90-140%) with the vast majority of sgRNAs compared to wild-type SpCas9 (Figure 1e). Three of the 37 sgRNAs tested showed essentially no activity with SpCas9-HF1, and examination of these target sites did not suggest any obvious differences in the characteristics of these sequences compared to those where high activity was observed (Table 3). Overall, SpCas9-HF1 possessed comparable activity (greater than 70% of wild-type SpCas9 activity) for 86% (32 / 37) of the sgRNAs tested.

[0153] Table 3: List of sgRNA targets

[0154] Streptococcus pyogenes sgRNA

[0155]

[0156]

[0157]

[0158]

[0159]

[0160]

[0161]

[0162] *1, NGA EMX1 site 4, from Kleinstiver et al., Nature 2015

[0163] *2, NGA FANCF site 1, from Kleinstiver et al., Nature 2015

[0164] *3, NGA FANCF site 3, from Kleinstiver et al., Nature 2015

[0165] *4, NGA FANCF site 4, from Kleinstiver et al., Nature 2015

[0166] *5, NGA RUNX1 site 1, from Kleinstiver et al., Nature 2015

[0167] *6, NGA RUNX1 site 3, from Kleinstiver et al., Nature 2015

[0168] *7, NGA VEGFA site 1, from Kleinstiver et al., Nature 2015

[0169] *8, NGA ZNF629 locus, from Kleinstiver et al., Nature 2015

[0170] Genome-wide specificity of SpCas9-HF1

[0171] To test whether SpCas9-HF1 exhibits reduced off-target effects in human cells, a genome-wide unbiased identification of double-strand breaks achieved by sequencing (GUIDE-seq) was used. GUIDE-seq uses the integration of short double-stranded oligodeoxynucleotide (dsODN) tags that enter double-strand breaks to achieve amplification and sequencing of adjacent genomic sequences, where the number of tag integrations at any given site provides a quantitative measure of cutting efficiency (Tsai, SQ et al., Nat Biotechnol [Natural Biotechnology] 33, 187-197 (2015)). Eight different sgRNAs targeting different sites in endogenous human EMX1, FANCF, RUNX1, and ZSCAN2 genes were used to compare the atlas of off-target effects induced by wild-type SpCas9 and SpCas9-HF1 using GUIDE-seq. The sequences targeted by these sgRNAs are unique and have a variable number of predicted mismatch sites in the reference human genome (Table 2). For eight sgRNAs, assessment of on-target dsODN tag integration (determined by restriction fragment length polymorphism (RFLP)) and indel formation (determined by T7EI) revealed comparable on-target activity with wild-type SpCas9 and SpCas9-HF1 (Figures 7a and 7b, respectively). GUIDE-seq experiments showed that seven of the eight sgRNAs induced cleavage at multiple genome-wide off-target sites (ranging from 2 to 25 per sgRNA) using wild-type SpCas9, while the eighth sgRNA (for FANCF site 4) did not generate any detectable off-target sites (Figures 2a and 2b). However, six of the seven sgRNAs that induced indels with wild-type SpCas9 showed a striking complete absence of GUIDE-seq detectable off-target events with SpCas9-HF1 (Figures 2a and 2b); and the remaining seventh sgRNA (for FANCF site 2) induced only a single detectable genome-wide off-target cleavage event at a site containing a mismatch within the protospacer seed sequence (Figure 2a). In summary, the off-target sites that were not detected when using SpCas9-HF1 contained one to six mismatches in the protospacer and / or PAM sequence (Figure 2c). When tested with SpCas9-HF1, the eighth sgRNA (for FANCF site 4) did not produce detectable off-target cleavage events as with wild-type SpCas9 (Figure 2a).

[0172] To confirm the GUIDE-seq findings, targeted amplicon sequencing was used to more directly measure the frequency of NHEJ-mediated indel mutations induced by wild-type SpCas9 and SpCas9-HF1. For these experiments, human cells were transfected with sgRNA- and Cas9-encoding plasmids only (i.e., no GUIDE-seq tags). Next-generation sequencing was then used to examine 36 of the 40 off-target sites that had been identified with wild-type SpCas9 for the six sgRNAs in the GUIDE-seq experiment (four of the 40 sites could not be examined because they could not be specifically amplified from genomic DNA). These deep sequencing experiments showed that: (1) wild-type SpCas9 and SpCas9-HF1 induced comparable frequencies of indels at each of the six sgRNA target sites (Figures 3a and 3b); (2) as expected, wild-type SpCas9 showed statistically significant evidence of indel mutations at 35 of the 36 off-target sites (Figure 3b), with frequencies that correlated well with GUIDE-seq read counts for these same sites (Figure 3c); and (3) at 34 of the 36 off-target sites, the frequency of indels induced by SpCas9-HF1 was indistinguishable from the background level of indels observed in samples from control transfections (Figure 3b). For the two off-target sites that appeared to have statistically significant mutation frequencies using SpCas9-HF1 relative to the negative control, the average frequencies of indels were 0.049% and 0.037%, at which level it was difficult to determine whether these were due to sequencing / PCR errors or true nuclease-induced indels. Based on these results, it was concluded that SpCas9-HF1 can completely or nearly completely reduce off-target mutations that occur across a range of different frequencies using wild-type SpCas9 to undetectable levels.

[0173] Next, the ability of SpCas9-HF1 to reduce genome-wide off-target effects of sgRNAs targeting atypical homopolymeric or repetitive sequences was evaluated. Although many people now try to avoid on-target sites with these characteristics due to their relative lack of orthogonality to the genome, it is still desirable to explore whether SpCas9-HF1 may reduce off-target indels (even for these challenging targets). Therefore, previously characterized sgRNAs (Fu, Y. et al., Nat Biotechnol [Natural Biotechnology] 31, Tsai, SQ et al., Nat Biotechnol [Natural Biotechnology] 33, 187-197 (2015)) were used, which target homopolymeric sequences rich in cytosine or sequences containing multiple TG repeats (VEGFA site 2 and VEGFA site 3, respectively) in the human VEGFA gene (Table 2). In control experiments, using both wild-type SpCas9 and SpCas9-HF1, each of these sgRNAs induced comparable levels of GUIDE-seq ds ODN tag incorporation (Figure 7c) and indel mutations (Figure 7d), demonstrating that SpCas9-HF1 was not impaired in on-target activity with either of these sgRNAs. Importantly, GUIDE-seq experiments revealed that SpCas9-HF1 was highly effective in reducing off-target sites for these sgRNAs, with 123 / 144 sites not detected for VEGFA site 2 and 31 / 32 sites not detected for VEGFA site 3 (Figures 4a and 4b). Examination of these off-target sites that were not detected with SpCas9-HF1 showed that each of them possessed a range of total mismatches within its protospacer and PAM sequence: 2 to 7 mismatches for VEGFA site 2 sgRNA and 1 to 4 mismatches for VEGFA site 3 sgRNA ( FIG. 4 c ); moreover, nine of these off-target sites for VEGFA site 2 may have potential bulge bases at the sgRNA-DNA interface (Lin, Y. et al., Nucleic Acids Res 42, 7473-7485 (2014)) ( FIG. 4 a and Figure 8 ). Sites not detected with SpCas9-HF1 had 2 to 6 mismatches for sgRNA targeting VEGFA site 2 and 2 mismatches in a single site for sgRNA targeting VEGFA site 3 (Figure 4c), where three off-target sites for sgRNA targeting VEGFA site 2 again had potential bulges ( Figure 8 Taken together, these results demonstrate that SpCas9-HF1 can be highly effective in reducing off-target effects of sgRNAs targeting simple repeat sequences and can also have a substantial impact on sgRNAs targeting homopolymeric sequences.

[0174] Table 2 | Summary of potential mismatch sites in the reference human genome for the ten sgRNAs examined by GUIDE-seq

[0175]

[0176] * Determined using Cas-OFFinder (Bae et al., Bioinformatics 30, 1473-1475 (2014))

[0177] Table 4: Oligonucleotides used in the study

[0178]

[0179]

[0180]

[0181]

[0182]

[0183]

[0184] Refining the specificity of SpCas9-HF1

[0185] Previously described methods, such as truncated gRNAs (Fu, Y. et al., Nat Biotechnol [Nature Biotechnology] 32, 279-284 (2014)) and the SpCas9-D1135E variant (Kleinstiver, BP et al., Nature [Nature] 523, 481-485 (2015)) can partially reduce SpCas9 off-target effects, and the present inventors wondered whether these could be combined with SpCas9-HF1 to further improve its genome-wide specificity. Testing SpCas9-HF1 with mismatched full-length and truncated sgRNAs targeting four sites in a human cell-based EGFP disruption assay revealed that shortening the sgRNA complementarity length substantially impaired on-target activity ( Fig. 9). In contrast, SpCas9-HF1 with an additional D1135E mutation (a variant referred to herein as SpCas9-HF2) retained 70% or more of the activity of wild-type SpCas9 with six of eight sgRNAs tested using a human cell-based EGFP disruption assay (Figures 5a and 5b). SpCas9-HF3 and SpCas9-HF4 variants containing L169A or Y450A mutations, respectively, were also generated, where the side chains mediate hydrophobic nonspecific interactions with the target DNA at its PAM-proximal end (Nishimasu, H. et al., Cell 156, 935-949 (2014); Jiang, F. et al., Science 348, 1477-1481 (2015)). SpCas9-HF3 and SpCas9-HF4 retained 70% or more of the activity observed with wild-type SpCas9 with the same six of the eight EGFP-targeting sgRNAs ( FIGS. 5 a and 5 b ).

[0186] To determine whether SpCas9-HF2, -HF3, and -HF4 can reduce the indel frequency at two off-target sites resistant to SpCas9-HF1 (for FANCF site 2 and VEGFA site 3 sgRNAs), further experiments were performed. For the FANCF site 2 off-target, which carries a single mismatch in the seed sequence of the protospacer, SpCas9-HF4 reduced the indel mutation frequency to near background levels as judged by the T7EI assay, while also beneficially increasing the on-target activity (Figure 5c), resulting in the greatest increase in specificity among the three variants (Figure 5d). For the VEGFA site 3 off-target site, which carries two protospacer mismatches (one in the seed sequence and one at the most distal nucleotide of the PAM sequence), SpCas9-HF2 showed the greatest reduction in indel formation while showing only a modest effect on on-target mutation efficiency (Figure 5c), resulting in the greatest increase in specificity among the three variants tested (Figure 5d). Together, these results demonstrate that the potential for off-target effects that are resistant to SpCas9-HF1 is reduced by introducing additional mutations at other residues that mediate nonspecific DNA contacts or can alter PAM recognition.

[0187] To recapitulate the T7E1 assay findings above showing that SpCas9-HF4 and SpCas9-HF2 have improved discrimination of off-targets for FANCF site 2 and VEGFA site 3 sgRNAs relative to SpCas9-HF1, respectively, GUIDE-seq was used to examine the genome-wide specificity of these variants. Using the RFLP assay, it was determined that SpCas9-HF4 and SpCas9-HF2 had similar on-target activity as SpCas9-HF1 as determined by GUIDE-seq tag integration rates ( Figure 5E When analyzing GUIDE-seq data, no new off-target sites were identified for SpCas9-HF2 or SpCas9-HF4 ( Fig. 5F Compared to SpCas9-HF1, off-target activity at all sites was either undetectable or substantially reduced by GUIDE-seq. Relative to SpCas9-HF1, SpCas9-HF4 had nearly 26-fold better specificity against the single FANCF site 2 off-target site (which remained recalcitrant to the improved specificity of SpCas9-HF1). Fig. 5F ). For the high-frequency VEGFA site 3 off-target, SpCas9-HF2 had a nearly 4-fold improved specificity relative to SpCas9-HF1, while also significantly reducing (>38-fold) or eliminating GUIDE-seq detectable events at other low-frequency off-target sites. Notably, the genomic locations of 3 of these low-frequency sites identified for SpCas9-HF1 are adjacent to previously characterized background U2OS cell breakpoint hotspots. In summary, these results suggest that the SpCas9-HF2 and SpCas9-HF4 variants can improve the genome-wide specificity of SpCas9-HF1.

[0188] SpCas9-HF1 robustly and consistently reduced off-target mutations when using sgRNAs designed for standard non-repetitive target sequences. The two off-target sites that were most resistant to SpCas9-HF1 had only one and two mismatches in the protospacer. In summary, these observations suggest that off-target mutations may be minimized to undetectable levels by using SpCas9-HF1 and targeting non-repetitive sequences that do not have closely related sites carrying one or two mismatches elsewhere in the genome (which can be achieved using existing publicly available software programs) (Bae, S. et al., Bioinformatics 30, 1473-1475 (2014)). One parameter that users should take into account is that SpCas9-HF1 may not be compatible with common practice (using a G at the 5' end of a gRNA that mismatches the protospacer sequence). Testing of four sgRNAs carrying a 5'G mismatch with their target site showed that three of the four had reduced activity with SpCas9-HF1 compared to wild-type SpCas9 ( Fig.10 ), which may reflect the ability of SpCas9-HF1 to better discriminate partially mismatched sites.

[0189] Further biochemical work may confirm or elucidate the precise mechanism by which SpCas9-HF1 achieves its high genome-wide specificity. The four introduced mutations did not appear to alter the stability or steady-state expression level of SpCas9 in cells, as titration experiments with decreasing concentrations of the expression plasmid suggested that wild-type SpCas9 and SpCas9-HF1 behaved comparably to their decreasing concentrations ( Fig.11 ). Alternatively, the simplest mechanical explanation is that these mutations reduce the energetics of the interaction between Cas9-sgRNA and target DNA, where the energy of the complex is just enough to retain the on-target activity, and it is sufficiently reduced so that off-target site cleavage is ineffective or absent. This mechanism is consistent with the nonspecific interactions observed between the mutated residues and the target DNA phosphate backbone in the structural data (Nishimasu, H. et al., Cell [Cell] 156, 935-949 (2014), Anders, C et al., Nature [Natural] 513, 569-573 (2014)). A somewhat similar mechanism has been proposed to explain the increased specificity of the class transcription activator effector nuclease carrying substitutions at positively charged residues (Guilinger, JP et al., Nat Methods [Natural Methods] 11, 429-435 (2014)).

[0190] It is possible that SpCas9-HF1 may also be combined with other mutations that have been shown to alter Cas9 function. For example, a SpCas9 mutant carrying three amino acid substitutions (D1135V / R1335Q / T1337R, also known as SpCas9-VQR variant) recognizes sites with NGAN PAM (with the following relative efficiency, NGAG>NGAT=NGAA>NGAC) (Kleinstiver, BP et al., Nature [Natural] 523, 481-485 (2015)), and a recently identified quadruple SpCas9 mutant (D1135V / G1218R / R1335Q / T1337R, known as SpCas9-VRQR variant) has improved activity relative to VQR for sites with NGAH (H=A, C, or T) PAM (Figure 12a). Four mutations (N497A / R661A / Q695A / Q926A) from SpCas9-HF1 were introduced into SpCas9-VQR and SpCas9-VRQR, generating SpCas9-VQR-HF1 and SpCas9-VRQR-HF1, respectively. The two HF versions of these nucleases showed comparable (i.e., 70% or more) on-target activity with their non-HF counterparts with five of the eight sgRNAs targeting the EGFP reporter gene and seven of the eight sgRNAs targeting endogenous human gene sites (Figures 12b-12d).

[0191] More broadly, these results illustrate a general strategy for engineering additional high-fidelity variants of CRISPR-associated nucleases. Addition of additional mutations at nonspecific DNA contact residues further reduced the very small number of residual off-target sites that SpCas9-HF1 had. Thus, variants such as SpCas9-HF2, SpCas9-HF3, SpCas9-HF4, etc. can be utilized in a customized manner, depending on the nature of the off-target sequences. Furthermore, the success of engineering high-fidelity variants of SpCas9 suggests that the approach of mutating nonspecific DNA contacts can be extended to other naturally occurring and engineered Cas9 orthologs (Ran, FA et al., Nature 520, 186-191 (2015), Esvelt, KM et al., Nat Methods 10, 1116-1121 (2013); Hou, Z. et al.; Proc Natl Acad Sci USA (2013); Fonfara, I. et al.; Nucleic Acids Res 42, 2577-2590 (2014); Kleinstiver, BP et al.; Nat Methods 10, 1116-1121 (2013); Biotechnol [Nature Biotechnology] (2015)), along with newer CRISPR-associated nucleases that are being discovered and characterized with increasing frequency (Zetsche, B. et al., Cell [Cell] 163, 759-771 (2015); Shmakov, S et al., Molecular Cell [Molecular Cell] 60, 385-397).

[0192] Example 2

[0193] Described herein are SpCas9 variants with alanine substitutions in residues contacting target DNA strands, including N497A, Q695A, R661A, and Q926A. In addition to these residues, the present inventors sought to determine whether it was possible to further improve the specificity of these variants, such as the SpCas9-HF1 variant (N497A / R661A / Q695A / Q926A), by adding substitutions in the following positively charged SpCas9 residues that appear to contact non-target DNA strands: R780, K810, R832, ​​K848, K855, K968, R976, H982, K1003, K1014, K1047, and / or R1060 (see Slaymaker et al., Science [Science]. 2016 Jan 1; 351(6268): 84-8).

[0194] Wild-type SpCas9 derivatives and combinations thereof carrying single alanine substitutions at these positions were tested for activity using an EGFP disruption assay, initially with an sgRNA designed to be a perfect match to a site in the EGFP gene (in order to assess on-target activity), and the same sgRNA carrying intentional mismatches at positions 11 and 12 (where position 1 is the base proximal to the PAM) (in order to assess activity at the mismatch site, as would be found at off-target sites). Fig.13A ). (Note that derivatives carrying the triple substitutions K810A / K1003A / R1060A or K848A / K1003A / R1060A are identical to recently described variants termed eSpCas9(1.0) and eSpCas9(1.1), respectively; see ref. 1). As expected, wild-type SpCas9 has robust on-target and mismatched target activity. As a control, we also tested SpCas9-HF1 in this experiment and found that, as expected, it maintained on-target activity while reducing mismatched target activity ( Fig.13A All wild-type SpCas9 derivatives carrying one or more alanine substitutions at positions that could potentially contact non-target DNA strands showed comparable on-target activity to wild-type SpCas9 ( Fig.13A Interestingly, some of these derivatives also showed reduced cleavage of the mismatched 11 / 12 sgRNA relative to activity observed with wild-type SpCas9, suggesting that a subset of substitutions in these derivatives conferred enhanced specificity for this mismatched site relative to wild-type SpCas9 ( Fig.13A ). However, none of these single or combined substitutions were sufficient to completely abolish the activity observed with the 11 / 12 mismatched sgRNA. When we tested wild-type SpCas9, SpCas9-HF1, and these same wild-type SpCas9 derivatives using additional sgRNAs carrying mismatches at positions 9 and 10 ( Fig. 13B ), only minimal changes in mismatched target activity were observed for most derivatives. This again demonstrates that single, double, or even triple substitutions at these potential non-target strand contact residues (equivalent to the eSpCas9 (1.0) and (1.1) variants described previously) are insufficient to abolish activity at imperfectly matched DNA sites. In summary, these data demonstrate that wild-type SpCas9 variants retain on-target activity with matched sgRNAs, and that the substitutions contained in these derivatives are not sufficient by themselves (in the context of wild-type SpCas9) to abolish nuclease activity against two different mismatched DNA sites ( Fig.13A and 13B ).

[0195] In view of these results, it was hypothesized that SpCas9-HF1 derivatives carrying one or more additional amino acid substitutions at residues that may contact non-target DNA strands may further improve specificity relative to the parental SpCas9-HF1 protein. Therefore, different SpCas9-HF1 derivatives carrying combinations of single, double, or triple alanine substitutions were tested in a human cell-based EGFP disruption assay using a fully matched sgRNA (to test on-target activity) and the same sgRNA carrying mismatches at positions 11 and 12 (to assess activity at mismatched target sites, as would be found for off-target sites). These sgRNAs were used Fig.13A This experiment revealed that most of the SpCas9-HF1 derivative variants we tested showed comparable on-target activity to that observed with both wild-type SpCas9 and SpCas9-HF1 ( Fig.14A ). With 11 / 12 mismatched sgRNAs, some of the SpCas9-HF1 derivatives tested (e.g., SpCas9-HF1+R832A and SpCas9-HF1+K1014A) did not show appreciable changes in cleavage with mismatched sgRNAs. Importantly, however, most SpCas9-HF1 derivatives had substantially lower activity with 11 / 12 mismatched sgRNAs than observed with SpCas9-HF1, eSpCas9(1.0), or eSpCas9(1.1), suggesting that certain combinations of these new variants have reduced mismatched target activity and thus improved specificity ( Fig.14A Of the 16 SpCas9-HF1 derivatives that reduced mismatched target activity with 11 / 12 mismatched sgRNAs to near background levels, 9 appeared to have only minimal effects on on-target activity (assessed using fully matched sgRNAs; Fig.14A In the EGFP disruption assay, sgRNAs with intentional mismatches at positions 9 and 10 were used ( Fig. 14B ), additional testing of a subset of these SpCas9-HF1 derivatives also revealed that, compared with SpCas9-HF1 ( FIG. 14 b ), eSpCas9 (1.1) ( Fig.13A ), or with the same substitutions added to the wild-type SpCas9 nuclease ( Fig. 13B ) These variants with this mismatched sgRNA possessed lower activity than that observed with sgRNA 9 / 10. Importantly, in this assay with sgRNA 9 / 10 mismatches, five variants showed background levels of off-target activity.

[0196] Next, we tested whether these alanine substitutions of the non-target strand could be combined with SpCas9 variants containing only the Q695A and Q926A substitutions from our SpCas9-HF1 variants (herein the "two-fold" variants). Because many of the HF1 derivatives tested above showed observable (and undesirable) reductions in on-target activity, we hypothesized that the only two most important substitutions from SpCas9-HF1 (Q695A and Q926A; see Figure 1B ) combined with one or more non-target strands of contact substitutions can rescue on-target activity, but still maintain the increase in specificity observed when these substitutions are added to the SpCas9-HF1 variant. Fig.13A Different SpCas9(Q695A / Q926A) derivatives carrying combinations of single, double, or triple alanine substitutions at potential non-target DNA strand interaction positions were tested in a human cell-based EGFP disruption assay using the same fully matched sgRNA targeting EGFP above (to test on-target activity) and the same sgRNA carrying mismatches at positions 11 and 12 (to assess activity at mismatched target sites, as would be found for off-target sites). This experiment revealed that most of the tested SpCas9(Q695A / Q926A) derivative variants showed on-target activities comparable to those observed with both wild-type SpCas9 and SpCas9-HF1 ( Fig.15 Importantly, many SpCas9-HF1 derivatives had substantially lower activity with 11 / 12 mismatched sgRNAs compared to that observed with SpCas9-HF1, eSpCas9(1.0), or eSpCas9(1.1), suggesting that certain combinations of these novel variants have reduced mismatched target activity and, therefore, improved specificity ( Fig.15 Of the 13 SpCas9(Q695A / Q926A) derivatives that reduced the mismatched target activity with 11 / 12 mismatched sgRNAs to near background levels, only 1 appeared to have a substantial effect on on-target activity (assessed using a fully matched sgRNA; Fig.15 ).

[0197] Overall, these data demonstrate that adding one, two, or three alanine substitutions to SpCas9-HF1 or SpCas9(Q695A / Q926A) at positions that are likely to contact non-target DNA strands can result in new variants with improved ability to reject mismatched off-target sites relative to their parental clones or the recently described eSpCas9(1.0) or (1.1). Importantly, these same substitutions do not appear to provide any substantial specificity benefit in the context of wild-type SpCas9.

[0198] To better define and compare the tolerance of SpCas9-HF1 and eSpCas9-1.1 to mismatches at the sgRNA-target DNA complementary interface, their activities were examined using sgRNAs containing single mismatches at all possible positions in the spacer complementary region. When compared to wild-type SpCas9, both SpCas9-HF1 and eSPCas9-1.1 variants had similar activities against most single-mismatched sgRNAs, with a few exceptions where SpCas9-HF1 performance exceeded that of eSpCas9-1.1 ( Fig.16 ).

[0199] Next, we tested the single nucleotide mismatch tolerance of variants containing combinations of amino acid substitutions from a double mutant with additional alanine substitutions in residues contacting target DNA or potentially contacting non-target DNA (Db = Q695A / Q926A), SpCas9-HF1 (N497A / R661A / Q695A / Q926A), eSpCas9-1.0 (1.0 = K810A / K1003A / R1060A), or eSpCas9-1.1 (1.1 = K848A / K1003A / R1060A) ( Fig.17A -B). On-target activity was assessed using fully matched sgRNAs, while single nucleotide mismatch tolerance was assessed using sgRNAs carrying such mismatches at positions 4, 8, 12, or 16 in the spacer sequence ( Fig.17A ). Multiple such variants maintained on-target activity with substantial reductions in activity observed with mismatched sgRNAs. Three of these variants (Q695A / K848A / Q926A / K1003A / R1060A, N497A / R661A / Q695A / K855A / Q926A / R1060A, and N497A / R661A / Q695A / Q926A / H982A / R1060A) were further tested with the remaining single-mismatched sgRNAs (containing mismatches at positions 1-3, 5-7, 9-11, 13-15, and 17-20). These variants demonstrated more robust intolerance to single nucleotide substitutions in sgRNAs compared to eSpCas9-1.1, demonstrating the improved specificity profiles of these new variants ( Fig. 17B Additional variant nucleases containing alternative combinations of amino acid substitutions were tested using sgRNAs containing mismatches at positions 5, 7, and 9 in the spacer (since earlier variants appeared to tolerate mismatches at these positions, these specific mismatched sgRNAs were used). Fig.18 Several such nucleases have improved specificity for mismatch sites with only a minor reduction in on-target activity ( Fig.18 ).

[0200] To further determine whether additional combinations of mutations could convey improvements in specificity, a greatly expanded set of nuclease variants with two additional matched sgRNAs were tested to examine on-target activity in terms of EGFP disruption activity ( Fig.19A ). Several of these variants maintained robust on-target activity, suggesting that they could be used to generate further improvements in specificity ( Fig.19B Multiple such variants were tested with sgRNAs containing single substitutions at positions 12, 14, 16, or 18 to determine whether improvements in specificity that exhibited greater intolerance to single nucleotide mismatches at these positions could be observed and found ( Fig.19B ).

[0201] Example 3

[0202] Using Staphylococcus aureus Cas9 (SaCas9), we performed experiments with a similar strategy as we had done with SpCas9 to introduce alanine substitutions into residues known to contact the target DNA strand ( Fig. 20 and Fig.21A ), residues that can contact non-target DNA (experiments in progress), and residues that we have previously shown to affect PAM specificity ( Fig.21B ), improving the specificity of SaCas9. The residues that can contact the target DNA backbone include: Y211, Y212, W229, Y230, R245, T392, N419, L446, Y651, and R654; the residues that can contact the non-target DNA include: Q848, N492, Q495, R497, N498, R499, Q500, K518, K523, K525, H557, R561, K572, R634, R654, G655, N658, S662, N668, R686, K692, R694, H700, K751; and PAM contact residues include: E782, D786, T787, Y789, T882, K886, N888, A889, L909, K929, N985, N986, R991, and R1015. In a preliminary experiment, the target DNA contact residues or PAM contact residues (respectively) Fig.21AIn A and B), single alanine substitutions (or some combination thereof) had variable effects on on-target EGFP destruction activity (using perfectly matched sgRNAs) and failed to eliminate off-target cleavage (when using sgRNAs mismatched at positions 11 and 12). Interestingly, SpCas9 mutations in HF1 were unable to completely eliminate off-target activity with similarly mismatched target / sgRNA pairs, suggesting that variants containing combinations of target / non-target strand substitutions are necessary to improve specificity at such sites (as we observed with SpCas9).

[0203] To further evaluate strategies for mutating potential target DNA contacts to improve SaCas9 specificity, single, double, triple, and quadruple combinations of mutations were examined for their potential to tolerate mismatches at positions 19 and 20 in the sgRNA ( Fig.22A and B). These combinations revealed that alanine substitutions at Y230 and R245 can increase specificity when combined with other substitutions, as judged by the ability to better reject mismatch sites.

[0204] Next, the on-target gene disruption activities of two of these triple alanine substitution variants (Y211A / Y230A / R245A and Y212A / Y230A / R245A) were examined at four on-target sites in EGFP (matching sites #1-4; Fig.23 ). For matching sites 1 and 2, these variants maintained robust on-target activity, but showed approximately 60%-70% loss of on-target activity with matching sites 3 and 4. As judged by using sgRNAs carrying double mismatches at different positions in the spacer of target sites 1-4, two of these triple alanine substitution variants significantly improved specificity relative to wild-type SaCas9 ( Fig.23 ).

[0205] Using an sgRNA containing a single mismatch at position 21 (the most PAM-distal position expected to be challenging to reject mismatches), SaCas9 variants carrying double and triple combinations of these alanine substitutions were tested against six endogenous sites ( Fig.24A and B) improvements in on-target activity and specificity of the evaluation. In some cases, the variants maintained the on-target activity of the matched sgRNA while eliminating the "off-target" activity of the mismatched sgRNA at position 21 ( Fig.24A and B). In other cases, minimal to complete loss of activity was observed with the matched sgRNA.

[0206] References

[0207] 1.Sander,J.D.&Joung,J.K.CRISPR-Cas systems for editing,regulating andtargeting genomes.Nat Biotechnol 32,347-355(2014).

[0208] 2.Hsu,P.D.,Lander,E.S.&Zhang,F.Development and applications ofCRISPR-Cas9 for genome engineering.Cell 157,1262-1278(2014).

[0209] 3.Doudna,J.A.&Charpentier,E.Genome editing.The new frontier of genomeengineering with CRISPR-Cas9.Science 346,1258096(2014).

[0210] 4.Barrangou,R.&May,A.P.Unraveling the potential of CRISPR-Cas9 forgene therapy.Expert Opin Biol Ther 15,311-314(2015).

[0211] 5.Jinek,M.et al.A programmable dual-RNA-guided DNA endonuclease inadaptive bacterial immunity.Science 337,816-821(2012).

[0212] 6.Sternberg,S.H.,Redding,S.,Jinek,M.,Greene,E.C.&Doudna,J.A.DNAinterrogation by the CRISPR RNA-guided endonuclease Cas9.Nature 507,62-67(2014).

[0213] 7.Hsu,P.D.et al.DNA targeting specificity of RNA-guided Cas9nucleases.Nat Biotechnol 31,827-832(2013).

[0214] 8.Tsai,S.Q.et al.GUIDE-seq enables genome-wide profiling of off-target cleavage by CRISPR-Cas nucleases.Nat Biotechnol 33,187-197(2015).

[0215] 9.Hou,Z.et al.Efficient genome engineering in human pluripotent stemcells using Cas9 from Neisseria meningitidis.Proc Natl Acad Sci U S A(2013).

[0216] 10.Fonfara,I.et al.Phylogeny of Cas9 determines functionalexchangeability of dual-RNA and Cas9 among orthologous type II CRISPR-Cassystems.Nucleic Acids Res 42,2577-2590(2014).

[0217] 11.Esvelt,K.M.et al.Orthogonal Cas9 proteins for RNA-guided generegulation and editing.Nat Methods 10,1116-1121(2013).

[0218] 12.Cong,L.et al.Multiplex genome engineering using CRISPR / Cassystems.Science 339,819-823(2013).

[0219] 13.Horvath,P.et al.Diversity,activity,and evolution of CRISPR loci inStreptococcus thermophilus.J Bacteriol 190,1401-1412(2008).

[0220] 14.Anders,C.,Niewoehner,O.,Duerst,A.&Jinek,M.Structural basis of PAM-dependent target DNA recognition by the Cas9 endonuclease.Nature 513,569-573(2014).

[0221] 15.Reyon,D.et al.FLASH assembly of TALENs for high-throughput genomeediting.Nat Biotechnol 30,460-465(2012).

[0222] 16.Fu,Y.et al.High-frequency off-target mutagenesis induced byCRISPR-Cas nucleases in human cells.Nat Biotechnol 31,822-826(2013).

[0223] 17.Chen,Z.&Zhao,H.A highly sensitive selection method for directedevolution of homing endonucleases.Nucleic Acids Res 33,e154(2005).

[0224] 18.Doyon,J.B.,Pattanayak,V.,Meyer,C.B.&Liu,D.R.Directed evolution andsubstrate specificity profile of homing endonuclease I-SceI.J Am Chem Soc128,2477-2484(2006).

[0225] 19.Jiang,W.,Bikard,D.,Cox,D.,Zhang,F.&Marraffini,L.A.RNA-guidedediting of bacterial genomes using CRISPR-Cas systems.Nat Biotechnol 31,233-239(2013).

[0226] 20.Mali,P.et al.RNA-guided human genome engineering via Cas9.Science339,823-826(2013).

[0227] 21.Hwang,W.Y.et al.Efficient genome editing in zebrafish using aCRISPR-Cas system.Nat Biotechnol 31,227-229(2013).

[0228] 22.Chylinski,K.,Le Rhun,A.&Charpentier,E.The tracrRNA and Cas9families of type II CRISPR-Cas immunity systems.RNA Biol 10,726-737(2013).

[0229] 23.Kleinstiver,B.P.,Fernandes,A.D.,Gloor,G.B.&Edgell,D.R.A unifiedgenetic,computational and experimental framework identifies functionallyrelevant residues of the homing endonuclease I-BmoI.Nucleic Acids Res 38,2411-2427(2010).

[0230] 24. Gagnon, JA et al. Efficient mutagenesis by Cas9 protein-mediated oligonucleotide insertion and large-scale assessment of single-guideRNAs. PLoS One 9, e98186 (2014).

[0231] sequence

[0232] SEQ ID NO:271-JDS246:CMV-T7-human SpCas9-NLS-3xFLAG

[0233] Human codon-optimized S. pyogenes Cas9 is shown in regular font, NLS The 3xFLAG tag is in bold:

[0234]

[0235]

[0236]

[0237]

[0238] SEQ ID NO:272-VP12:CMV-T7-human SpCas9-HF1 (N497A, R661A, Q695A, Q926A)-NLS-3xFLAG

[0239] Human codon-optimized S. pyogenes Cas9 is shown in regular font, modified codons are shown in lowercase, NLS The 3xFLAG tag is in bold:

[0240]

[0241]

[0242]

[0243]

[0244] SEQ ID NO:273-MSP2135:CMV-T7-human SpCas9-HF2 (N497A, R661A, Q695A, Q926A, D1135E)-NLS-3xFLAG

[0245] Human codon-optimized S. pyogenes Cas9 is shown in regular font, modified codons are shown in lowercase, NLS The 3xFLAG tag is in bold:

[0246]

[0247]

[0248]

[0249]

[0250] SEQ ID NO:274-MSP2133:CMV-T7-human SpCas9-HF4(Y450A, N497A, R661A, Q695A, Q926A)-NLS-3xFLAG

[0251] Human codon-optimized S. pyogenes Cas9 is shown in regular font, modified codons are shown in lowercase, NLS The 3xFLAG tag is in bold:

[0252]

[0253]

[0254]

[0255]

[0256] SEQ ID NO:275-MSP469:CMV-T7-human SpCas9-VQR(D1135V, R1335Q, T1337R)-NLS-3xFLAG

[0257] Human codon-optimized S. pyogenes Cas9 is shown in regular font, modified codons are shown in lowercase, NLS The 3xFLAG tag is in bold:

[0258]

[0259]

[0260]

[0261]

[0262] SEQ ID NO: 276-MSP2440: CMV-T7-human SpCas9-VQR-HF1(N497A, R661A, Q695A, Q926A, D1135V, R1335Q, T1337R)-NLS-3xFLAG

[0263] Human codon-optimized S. pyogenes Cas9 is shown in regular font, modified codons are shown in lowercase, NLS The 3xFLAG tag is in bold:

[0264]

[0265]

[0266]

[0267]

[0268] SEQ ID NO:277-BPK2797:CMV-T7-human SpCas9-VRQR(D1135V, G1218R, R1335Q, T1337R)-NLS-3xFLAG

[0269] Human codon-optimized S. pyogenes Cas9 is shown in regular font, modified codons are shown in lowercase, NLS The 3xFLAG tag is in bold:

[0270]

[0271]

[0272]

[0273]

[0274] SEQ ID NO: 278-MSP2443: CMV-T7-human SpCas9-VRQR-HF1(N497A, R661A, Q695A, Q926A, D1135V, G1218R, R1335Q, T1337R)-NLS-3xFLAG

[0275] Human codon-optimized S. pyogenes Cas9 is shown in regular font, modified codons are shown in lowercase, NLS The 3xFLAG tag is in bold:

[0276]

[0277]

[0278]

[0279]

[0280] SEQ ID NO:279-BPK1520:U6-BsmBI cassette-Sp-sgRNA

[0281] The U6 promoter is shown in regular font, the BsmBI site is shown in italics, the S. pyogenes sgRNA is shown in lowercase, and the U6 terminator is shown in

[0282]

[0283] Other Implementations

[0284] It should be understood that although the invention has been described in conjunction with the detailed description, the foregoing description is intended to illustrate rather than limit the scope of the invention, which is defined by the scope of the appended claims. Other aspects, advantages and modifications are within the scope of the following claims. Sequence Listing <110> THE GENERAL HOSPITAL CORPORATION <120> Engineered CRISPR-Cas9 nucleases <130> 3050-1809922D1 <150> US 15 / 015,947 <151> 2016-02-04 <150> US 62 / 258,280 <151> 2015-11-20 <150> US 62 / 216,033 <151> 2015-09-09 <150> US 62 / 211,553 <151> 2015-08-28 <150> US 62 / 271,938 <151> 2015-12-28 <160> 279 <170> SIPOSequenceListing 1.0 <210> 1 <211> 1368 <212> PRT <213> Streptococcus pyogenes <400> 1 Met Asp Lys Lys Tyr Ser Ile Gly Leu Asp Ile Gly Thr Asn Ser Val 1 5 10 15 Gly Trp Ala Val Ile Thr Asp Glu Tyr Lys Val Pro Ser Lys Lys Phe 20 25 30 Lys Val Leu Gly Asn Thr Asp Arg His Ser Ile Lys Lys Asn Leu Ile 35 40 45 Gly Ala Leu Leu Phe Asp Ser Gly Glu Thr Ala Glu Ala Thr Arg Leu 50 55 60 Lys Arg Thr Ala Arg Arg Arg Tyr Thr Arg Arg Lys Asn Arg Ile Cys 65 70 75 80 Tyr Leu Gln Glu Ile Phe Ser Asn Glu Met Ala Lys Val Asp Asp Ser 85 90 95 Phe Phe His Arg Leu Glu Glu Ser Phe Leu Val Glu Glu Asp Lys Lys 100 105 110 His Glu Arg His Pro Ile Phe Gly Asn Ile Val Asp Glu Val Ala Tyr 115 120 125 His Glu Lys Tyr Pro Thr Ile Tyr His Leu Arg Lys Lys Leu Val Asp 130 135 140 Ser Thr Asp Lys Ala Asp Leu Arg Leu Ile Tyr Leu Ala Leu Ala His 145 150 155 160 Met Ile Lys Phe Arg Gly His Phe Leu Ile Glu Gly Asp Leu Asn Pro 165 170 175 Asp Asn Ser Asp Val Asp Lys Leu Phe Ile Gln Leu Val Gln Thr Tyr 180 185 190 Asn Gln Leu Phe Glu Glu Asn Pro Ile Asn Ala Ser Gly Val Asp Ala 195 200 205 Lys Ala Ile Leu Ser Ala Arg Leu Ser Lys Ser Arg Arg Leu Glu Asn 210 215 220 Leu Ile Ala Gln Leu Pro Gly Glu Lys Lys Asn Gly Leu Phe Gly Asn 225 230 235 240 Leu Ile Ala Leu Ser Leu Gly Leu Thr Pro Asn Phe Lys Ser Asn Phe 245 250 255 Asp Leu Ala Glu Asp Ala Lys Leu Gln Leu Ser Lys Asp Thr Tyr Asp 260 265 270 Asp Asp Leu Asp Asn Leu Leu Ala Gln Ile Gly Asp Gln Tyr Ala Asp 275 280 285 Leu Phe Leu Ala Ala Lys Asn Leu Ser Asp Ala Ile Leu Leu Ser Asp 290 295 300 Ile Leu Arg Val Asn Thr Glu Ile Thr Lys Ala Pro Leu Ser Ala Ser 305 310 315 320 Met Ile Lys Arg Tyr Asp Glu His His Gln Asp Leu Thr Leu Leu Lys 325 330 335 Ala Leu Val Arg Gln Gln Leu Pro Glu Lys Tyr Lys Glu Ile Phe Phe 340 345 350 Asp Gln Ser Lys Asn Gly Tyr Ala Gly Tyr Ile Asp Gly Gly Ala Ser 355 360 365 Gln Glu Glu Phe Tyr Lys Phe Ile Lys Pro Ile Leu Glu Lys Met Asp 370 375 380 Gly Thr Glu Glu Leu Leu Val Lys Leu Asn Arg Glu Asp Leu Leu Arg 385 390 395 400 Lys Gln Arg Thr Phe Asp Asn Gly Ser Ile Pro His Gln Ile His Leu 405 410 415 Gly Glu Leu His Ala Ile Leu Arg Arg Gln Glu Asp Phe Tyr Pro Phe 420 425 430 Leu Lys Asp Asn Arg Glu Lys Ile Glu Lys Ile Leu Thr Phe Arg Ile 435 440 445 Pro Tyr Tyr Val Gly Pro Leu Ala Arg Gly Asn Ser Arg Phe Ala Trp 450 455 460 Met Thr Arg Lys Ser Glu Glu Thr Ile Thr Pro Trp Asn Phe Glu Glu 465 470 475 480 Val Val Asp Lys Gly Ala Ser Ala Gln Ser Phe Ile Glu Arg Met Thr 485 490 495 Asn Phe Asp Lys Asn Leu Pro Asn Glu Lys Val Leu Pro Lys His Ser 500 505 510 Leu Leu Tyr Glu Tyr Phe Thr Val Tyr Asn Glu Leu Thr Lys Val Lys 515 520 525 Tyr Val Thr Glu Gly Met Arg Lys Pro Ala Phe Leu Ser Gly Glu Gln 530 535 540 Lys Lys Ala Ile Val Asp Leu Leu Phe Lys Thr Asn Arg Lys Val Thr 545 550 555 560 Val Lys Gln Leu Lys Glu Asp Tyr Phe Lys Lys Ile Glu Cys Phe Asp 565 570 575 Ser Val Glu Ile Ser Gly Val Glu Asp Arg Phe Asn Ala Ser Leu Gly 580 585 590 Thr Tyr His Asp Leu Leu Lys Ile Ile Lys Asp Lys Asp Phe Leu Asp 595 600 605 Asn Glu Glu Asn Glu Asp Ile Leu Glu Asp Ile Val Leu Thr Leu Thr 610 615 620 Leu Phe Glu Asp Arg Glu Met Ile Glu Glu Arg Leu Lys Thr Tyr Ala 625 630 635 640 His Leu Phe Asp Asp Lys Val Met Lys Gln Leu Lys Arg Arg Arg Tyr 645 650 655 Thr Gly Trp Gly Arg Leu Ser Arg Lys Leu Ile Asn Gly Ile Arg Asp 660 665 670 Lys Gln Ser Gly Lys Thr Ile Leu Asp Phe Leu Lys Ser Asp Gly Phe 675 680 685 Ala Asn Arg Asn Phe Met Gln Leu Ile His Asp Asp Ser Leu Thr Phe 690 695 700 Lys Glu Asp Ile Gln Lys Ala Gln Val Ser Gly Gln Gly Asp Ser Leu 705 710 715 720 His Glu His Ile Ala Asn Leu Ala Gly Ser Pro Ala Ile Lys Lys Gly 725 730 735 Ile Leu Gln Thr Val Lys Val Val Asp Glu Leu Val Lys Val Met Gly 740 745 750 Arg His Lys Pro Glu Asn Ile Val Ile Glu Met Ala Arg Glu Asn Gln 755 760 765 Thr Thr Gln Lys Gly Gln Lys Asn Ser Arg Glu Arg Met Lys Arg Ile 770 775 780 Glu Glu Gly Ile Lys Glu Leu Gly Ser Gln Ile Leu Lys Glu His Pro 785 790 795 800 Val Glu Asn Thr Gln Leu Gln Asn Glu Lys Leu Tyr Leu Tyr Tyr Leu 805 810 815 Gln Asn Gly Arg Asp Met Tyr Val Asp Gln Glu Leu Asp Ile Asn Arg 820 825 830 Leu Ser Asp Tyr Asp Val Asp His Ile Val Pro Gln Ser Phe Leu Lys 835 840 845 Asp Asp Ser Ile Asp Asn Lys Val Leu Thr Arg Ser Asp Lys Asn Arg 850 855 860 Gly Lys Ser Asp Asn Val Pro Ser Glu Glu Val Val Lys Lys Met Lys 865 870 875 880 Asn Tyr Trp Arg Gln Leu Leu Asn Ala Lys Leu Ile Thr Gln Arg Lys 885 890 895 Phe Asp Asn Leu Thr Lys Ala Glu Arg Gly Gly Leu Ser Glu Leu Asp 900 905 910 Lys Ala Gly Phe Ile Lys Arg Gln Leu Val Glu Thr Arg Gln Ile Thr 915 920 925 Lys His Val Ala Gln Ile Leu Asp Ser Arg Met Asn Thr Lys Tyr Asp 930,935,940 Glu Asn Asp Lys Leu Ile Arg Glu Val Lys Val Ile Thr Lys Ser 945 950 955 960 Lys Leu Val Ser Asp Phe Arg Lys Asp Phe Gln Phe Tyr Lys Val Arg 965,970,975 Glu Ile Asn Asn Tyr His Ala His Asp Ala Tyr Leu Asn Ala Val 980,985,990 Val Gly Thr Ala Leu Ile Lys Tyr Pro Lys Leu Glu Ser Glu Phe 995 1000 1005 Val Tyr Gly Asp Tyr Lys Val Tyr Asp Val Arg Lys Met Ile Ala Lys 1010 1015 1020 Ser Glu Gln Glu Ile Gly Lys Ala Thr Ala Lys Tyr Phe Phe Tyr Ser 1025 1030 1035 1040 Asn With Asn Phe Phe Lys Thr Glu With Thr Leu Ala Asn Glu 1045 1050 1055 Arg Lys Arg Pro Leu Ile Glu Thr Asn Gly Glu Thr Gly Glu Ile 1060 1065 1070 Val Trp Asp Lys Gly Arg Asp Phe Ala Thr Val Arg Lys Val Leu Ser 1075 1080 1085 Met Pro Gln Val Asn Ile Val Lys Lys Thr Glu Val Gln Thr Gly Gly 1090 1095 1100 Phe Ser Lys Glu Ser Ile Leu Pro Lys Arg Asn Ser Asp Lys Leu Ile 1105 1110 1115 1120 Ala Arg Lys Lys Asp Trp Asp Pro Lys Lys Tyr Gly Gly Phe Asp Ser 1125 1130 1135 Pro Thr Val Ala Tyr Ser Val Leu Val Val Ala Lys Val Glu Lys Gly 1140 1145 1150 Lys Ser Lys Lys Leu Lys Ser Val Lys Glu Leu Leu Gly Ile Thr Ile 1155 1160 1165 Met Glu Arg Ser Ser Phe Glu Lys Asn Pro Ile Asp Phe Leu Glu Ala 1170 1175 1180 Lys Gly Tyr Lys Glu Val Lys Lys Asp Leu Ile Ile Lys Leu Pro Lys 1185 1190 1195 1200 Tyr Ser Leu Phe Glu Leu Glu Asn Gly Arg Lys Arg Met Leu Ala Ser 1205 1210 1215 Ala Gly Glu Leu Gln Lys Gly Asn Glu Leu Ala Leu Pro Ser Lys Tyr 1220 1225 1230 Val Asn Phe Leu Tyr Leu Ala Ser His Tyr Glu Lys Leu Lys Gly Ser 1235 1240 1245 Pro Glu Asp Asn Glu Gln Lys Gln Leu Phe Val Glu Gln His Lys His 1250 1255 1260 Tyr Leu Asp Glu Ile Ile Glu Gln Ile Ser Glu Phe Ser Lys Arg Val 1265 1270 1275 1280 Ile Leu Ala Asp Ala Asn Leu Asp Lys Val Leu Ser Ala Tyr Asn Lys 1285 1290 1295 His Arg Asp Lys Pro Ile Arg Glu Gln Ala Glu Asn Ile Ile His Leu 1300 1305 1310 Phe Thr Leu Thr Asn Leu Gly Ala Pro Ala Ala Phe Lys Tyr Phe Asp 1315 1320 1325 Thr Thr Ile Asp Arg Lys Arg Tyr Thr Ser Thr Lys Glu Val Leu Asp 1330 1335 1340 Ala Thr Leu Ile His Gln Ser Ile Thr Gly Leu Tyr Glu Thr Arg Ile 1345 1350 1355 1360 Asp Leu Ser Gln Leu Gly Gly Asp 1365 <210> 2 <211> 1053 <212> PRT <213> Staphylococcus aureus <400> 2 Met Lys Arg Asn Tyr Ile Leu Gly Leu Asp Ile Gly Ile Thr Ser Val 1 5 10 15 Gly Tyr Gly Ile Ile Asp Tyr Glu Thr Arg Asp Val Ile Asp Ala Gly 20 25 30 Val Arg Leu Phe Lys Glu Ala Asn Val Glu Asn Asn Glu Gly Arg Arg 35 40 45 Ser Lys Arg Gly Ala Arg Arg Leu Lys Arg Arg Arg Arg His Arg Ile 50 55 60 Gln Arg Val Lys Lys Leu Leu Phe Asp Tyr Asn Leu Leu Thr Asp His 65 70 75 80 Ser Glu Leu Ser Gly Ile Asn Pro Tyr Glu Ala Arg Val Lys Gly Leu 85 90 95 Ser Gln Lys Leu Ser Glu Glu Glu Phe Ser Ala Ala Leu Leu His Leu 100 105 110 Ala Lys Arg Arg Gly Val His Asn Val Asn Glu Val Glu Glu Asp Thr 115 120 125 Gly Asn Glu Leu Ser Thr Lys Glu Gln Ile Ser Arg Asn Ser Lys Ala 130 135 140 Leu Glu Glu Lys Tyr Val Ala Glu Leu Gln Leu Glu Arg Leu Lys Lys 145 150 155 160 Asp Gly Glu Val Arg Gly Ser Ile Asn Arg Phe Lys Thr Ser Asp Tyr 165 170 175 Val Lys Glu Ala Lys Gln Leu Leu Lys Val Gln Lys Ala Tyr His Gln 180 185 190 Leu Asp Gln Ser Phe Ile Asp Thr Tyr Ile Asp Leu Leu Glu Thr Arg 195 200 205 Arg Thr Tyr Tyr Glu Gly Pro Gly Glu Gly Ser Pro Phe Gly Trp Lys 210 215 220 Asp Ile Lys Glu Trp Tyr Glu Met Leu Met Gly His Cys Thr Tyr Phe 225 230 235 240 Pro Glu Glu Leu Arg Ser Val Lys Tyr Ala Tyr Asn Ala Asp Leu Tyr 245 250 255 Asn Ala Leu Asn Asp Leu Asn Asn Leu Val Ile Thr Arg Asp Glu Asn 260 265 270 Glu Lys Leu Glu Tyr Tyr Glu Lys Phe Gln Ile Ile Glu Asn Val Phe 275 280 285 Lys Gln Lys Lys Lys Pro Thr Leu Lys Gln Ile Ala Lys Glu Ile Leu 290 295 300 Val Asn Glu Glu Asp Ile Lys Gly Tyr Arg Val Thr Ser Thr Gly Lys 305 310 315 320 Pro Glu Phe Thr Asn Leu Lys Val Tyr His Asp Ile Lys Asp Ile Thr 325 330 335 Ala Arg Lys Glu Ile Ile Glu Asn Ala Glu Leu Leu Asp Gln Ile Ala 340 345 350 Lys Ile Leu Thr Ile Tyr Gln Ser Ser Glu Asp Ile Gln Glu Glu Leu 355 360 365 Thr Asn Leu Asn Ser Glu Leu Thr Gln Glu Glu Ile Glu Gln Ile Ser 370 375 380 Asn Leu Lys Gly Tyr Thr Gly Thr His Asn Leu Ser Leu Lys Ala Ile 385 390 395 400 Asn Leu Ile Leu Asp Glu Leu Trp His Thr Asn Asp Asn Gln Ile Ala 405 410 415 Ile Phe Asn Arg Leu Lys Leu Val Pro Lys Lys Val Asp Leu Ser Gln 420 425 430 Gln Lys Glu Ile Pro Thr Thr Leu Val Asp Asp Phe Ile Leu Ser Pro 435 440 445 Val Val Lys Arg Ser Phe Ile Gln Ser Ile Lys Val Ile Asn Ala Ile 450 455 460 Ile Lys Lys Tyr Gly Leu Pro Asn Asp Ile Ile Ile Glu Leu Ala Arg 465 470 475 480 Glu Lys Asn Ser Lys Asp Ala Gln Lys Met Ile Asn Glu Met Gln Lys 485 490 495 Arg Asn Arg Gln Thr Asn Glu Arg Ile Glu Glu Ile Ile Arg Thr Thr 500 505 510 Gly Lys Glu Asn Ala Lys Tyr Leu Ile Glu Lys Ile Lys Leu His Asp 515 520 525 Met Gln Glu Gly Lys Cys Leu Tyr Ser Leu Glu Ala Ile Pro Leu Glu 530 535 540 Asp Leu Leu Asn Asn Pro Phe Asn Tyr Glu Val Asp His Ile Ile Pro 545 550 555 560 Arg Ser Val Ser Phe Asp Asn Ser Phe Asn Asn Lys Val Leu Val Lys 565 570 575 Gln Glu Glu Asn Ser Lys Lys Gly Asn Arg Thr Pro Phe Gln Tyr Leu 580 585 590 Ser Ser Ser Asp Ser Lys Ile Ser Tyr Glu Thr Phe Lys Lys His Ile 595 600 605 Leu Asn Leu Ala Lys Gly Lys Gly Arg Ile Ser Lys Thr Lys Lys Glu 610 615 620 Tyr Leu Leu Glu Glu Arg Asp With Asn Arg Phe Serving Val Gln Lys Asp 625 630 635 640 Phe Ile Asn Arg Asn Leu Val Asp Thr Arg Tyr Ala Thr Arg Gly Leu 645,650,655 Met Asn Leu Leu Arg Ser Tyr Phe Arg Val Asn Asn Leu Asp Val Lys 660,665,670 Val Lys Ser Ile Asn Gly Gly Phe Thr Ser Phe Leu Arg Arg Lys Trp 675,680,685 Lys Phe Lys Lys Glu Arg Asn Lys Gly Tyr Lys His Ala Glu Asp 690,695,700 Only Leu Ile On Asn Only Asp Phe Ile Phe Lys Glu Trp Lys Lys 705 710 715 720 Leu Asp Lys Ala Lys Lys Val Met Glu Asn Gln Met Phe Glu Glu Lys 725 730 735 Gln Ala Glu Ser Met Pro Glue Ile Glu Thr Glu Gln Glu Tyr Lys Glu 740,745,750 Ile Phe Ile Thr Pro His Gln Ile Lys His Ile Lys Asp Phe Lys Asp 755,760,765 Tyr Lys Tyr Ser His Arg Val Asp Lys Pro Asn Arg Glu Leu Ile 770 775 780 Asn Asp Thr Leu Tyr Ser Thr Arg Lys Asp Asp Lys Gly Asn Thr Leu 785 790 795 800 Ile Val Asn Asn Leu Asn Gly Leu Tyr Asp Lys Asp Asn Asp Lys Leu 805 810 815 Lys Lys Leu Ile Asn Lys Ser Pro Glu Lys Leu Leu Met Tyr His His 820 825 830 Asp Pro Gln Thr Tyr Gln Lys Leu Lys Leu Ile Met Glu Gln Tyr Gly 835 840 845 Asp Glu Lys Asn Pro Leu Tyr Lys Tyr Tyr Glu Glu Thr Gly Asn Tyr 850 855 860 Leu Thr Lys Tyr Ser Lys Lys Asp Asn Gly Pro Val Ile Lys Lys Ile 865 870 875 880 Lys Tyr Tyr Gly Asn Lys Leu Asn Ala His Leu Asp Ile Thr Asp Asp 885 890 895 Tyr Pro Asn Ser Arg Asn Lys Val Val Lys Leu Ser Leu Lys Pro Tyr 900 905 910 Arg Phe Asp Val Tyr Leu Asp Asn Gly Val Tyr Lys Phe Val Thr Val 915 920 925 Lys Asn Leu Asp Val Ile Lys Lys Glu Asn Tyr Tyr Glu Val Asn Ser 930 935 940 Lys Cys Tyr Glu Glu Ala Lys Lys Leu Lys Lys Ile Ser Asn Gln Ala 945 950 955 960 Glu Phe Ile Ala Ser Phe Tyr Asn Asn Asp Leu Ile Lys Ile Asn Gly 965 970 975 Glu Leu Tyr Arg Val Ile Gly Val Asn Asn Asp Leu Leu Asn Arg Ile 980 985 990 Glu Val Asn Met Ile Asp Ile Thr Tyr Arg Glu Tyr Leu Glu Asn Met 995 1000 1005 Asn Asp Lys Arg Pro Pro Arg Ile Ile Lys Thr Ile Ala Ser Lys Thr 1010 1015 1020 Gln Ser Ile Lys Lys Tyr Ser Thr Asp Ile Leu Gly Asn Leu Tyr Glu 1025 1030 1035 1040 Val Lys Ser Lys Lys His Pro Gln Ile Ile Lys Lys Gly 1045 1050 <210> 3 <211> 4 <212> PRT <213> Artificial Sequence <220> <221> PEPTIDE <222> (1)..(4) <223> Description of artificial sequence: Synthetic peptide <400> 3 Gly Gly Gly Ser 1 <210> 4 <211> 5 <212> PRT <213> Artificial Sequence <220> <221> PEPTIDE <222> (1)..(5) <223> Description of artificial sequences: synthetic peptides <400> 4 Gly Gly Gly Gly Ser 1 5 <210> 5 <211> 4 <212> PRT <213> Artificial Sequence <220> <221> PEPTIDE <222> (1)..(4) <223> Description of artificial sequences: synthetic peptides <400> 5 Gly Gly Gly Ser 1 <210> 6 <211> 5 <212> PRT <213> Artificial Sequence <220> <221> PEPTIDE <222> (1)..(5) <223> Description of artificial sequences: synthetic peptides <400> 6 Gly Gly Gly Gly Ser 1 5 <210> 7 <211> 7 <212> PRT <213> Artificial Sequence <220> <221> PEPTIDE <222> (1)..(7) <223> Description of artificial sequences: synthetic peptides <400> 7 Pro Lys Lys Lys Arg Arg Val 1 5 <210> 8 <211> 16 <212> PRT <213> Artificial Sequence <220> <221> PEPTIDE <222> (1)..(16) <223> Description of artificial sequences: synthetic peptides <400> 8 Lys Arg Pro Ala Ala Thr Lys Lys Ala Gly Gln Ala Lys Lys Lys Lys 1 5 10 15 <210> 9 <211> 20 <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(20) <223> Description of artificial sequences: synthetic oligonucleotides <400> 9 gggcacgggc agcttgccgg 20 <210> 10 <211> twenty four <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(24) <223> Description of artificial sequences: synthetic oligonucleotides <400> 10 gggcacgggc agcttgccgg tggt 24 <210> 11 <211> 18 <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(18) <223> Description of artificial sequences: synthetic oligonucleotides <400> 11 gcacgggcag cttgccgg 18 <210> 12 <211> twenty two <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(22) <223> Description of artificial sequences: synthetic oligonucleotides <400> 12 gcacgggcag cttgccggtg gt 22 <210> 13 <211> 20 <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(20) <223> Description of artificial sequences: synthetic oligonucleotides <400> 13 gggcacccgc agcttgccgg 20 <210> 14 <211> twenty four <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(24) <223> Description of artificial sequences: synthetic oligonucleotides <400> 14 gggcacccgc agcttgccgg tggt 24 <210> 15 <211> 20 <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(20) <223> Description of artificial sequences: synthetic oligonucleotides <400> 15 gggctggggc agcttgccgg 20 <210> 16 <211> twenty four <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(24) <223> Description of artificial sequences: synthetic oligonucleotides <400> 16 gggctggggc agcttgccgg tggt 24 <210> 17 <211> 20 <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(20) <223> Description of artificial sequences: synthetic oligonucleotides <400> 17 ggcgacgggc agcttgccgg 20 <210> 18 <211> twenty four <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(24) <223> Description of artificial sequences: synthetic oligonucleotides <400> 18 ggcgacgggc agcttgccgg tggt 24 <210> 19 <211> 20 <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(20) <223> Description of artificial sequences: synthetic oligonucleotides <400> 19 gcccacgggc agcttgccgg 20 <210> 20 <211> twenty four <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(24) <223> Description of artificial sequences: synthetic oligonucleotides <400> 20 gcccacgggc agcttgccgg tggt 24 <210> twenty one <211> 20 <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(20) <223> Description of artificial sequences: synthetic oligonucleotides <400> twenty one gtcgccctcg aacttcacct 20 <210> twenty two <211> twenty four <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(24) <223> Description of artificial sequences: synthetic oligonucleotides <400> twenty two gtcgccctcg aacttcacct cggc 24 <210> twenty three <211> 20 <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(20) <223> Description of artificial sequences: synthetic oligonucleotides <400> twenty three gtaggtcagg gtggtcacga 20 <210> twenty four <211> twenty four <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(24) <223> Description of artificial sequences: synthetic oligonucleotides <400> twenty four gtaggtcagg gtggtcacga gggt 24 <210> 25 <211> 20 <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(20) <223> Description of artificial sequences: synthetic oligonucleotides <400> 25 ggcgagggcg atgccaccta 20 <210> 26 <211> twenty four <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(20) <223> Description of artificial sequences: synthetic oligonucleotides <400> 26 ggcgagggcg atgccaccta cggc 24 <210> 27 <211> 20 <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(20) <223> Description of artificial sequences: synthetic oligonucleotides <400> 27 ggtcgccacc atggtgagca 20 <210> 28 <211> twenty four <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(24) <223> Description of artificial sequences: synthetic oligonucleotides <400> 28 ggtcgccacc atggtgagca aggg 24 <210> 29 <211> 20 <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(20) <223> Description of artificial sequences: synthetic oligonucleotides <400> 29 ggtcagggtg gtcacgaggg 20 <210> 30 <211> twenty four <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(24) <223> Description of artificial sequences: synthetic oligonucleotides <400> 30 ggtcagggtg gtcacgaggg tggg 24 <210> 31 <211> 20 <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(20) <223> Description of artificial sequences: synthetic oligonucleotides <400> 31 ggtggtgcag atgaacttca 20 <210> 32 <211> twenty four <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(24) <223> Description of artificial sequences: synthetic oligonucleotides <400> 32 ggtggtgcag atgaacttca gggt 24 <210> 33 <211> 17 <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(17) <223> Description of artificial sequences: synthetic oligonucleotides <400> 33 ggtgcagatg aacttca 17 <210> 34 <211> twenty one <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(21) <223> Description of artificial sequences: synthetic oligonucleotides <400> 34 ggtgcagatg aacttcaggg t 21 <210> 35 <211> 20 <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(20) <223> Description of artificial sequences: synthetic oligonucleotides <400> 35 gttggggtct ttgctcaggg 20 <210> 36 <211> twenty four <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(24) <223> Description of artificial sequences: synthetic oligonucleotides <400> 36 gttggggtct ttgctcaggg cgga 24 <210> 37 <211> 20 <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(20) <223> Description of artificial sequences: synthetic oligonucleotides <400> 37 ggtggtcacg agggtgggcc 20 <210> 38 <211> twenty four <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(24) <223> Description of artificial sequences: synthetic oligonucleotides <400> 38 ggtggtcacg agggtgggcc aggg 24 <210> 39 <211> 20 <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(20) <223> Description of artificial sequences: synthetic oligonucleotides <400> 39 gatgccgttc ttctgcttgt 20 <210> 40 <211> twenty four <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(24) <223> Description of artificial sequences: synthetic oligonucleotides <400> 40 gatgccgttc ttctgcttgt cggc 24 <210> 41 <211> 17 <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(17) <223> Description of artificial sequences: synthetic oligonucleotides <400> 41 gccgttcttc tgcttgt 17 <210> 42 <211> twenty one <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(21) <223> Description of artificial sequences: synthetic oligonucleotides <400> 42 gccgttcttc tgcttgtcgg c 21 <210> 43 <211> 20 <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(20) <223> Description of artificial sequences: synthetic oligonucleotides <400> 43 gtcgccacca tggtgagcaa 20 <210> 44 <211> twenty four <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(24) <223> Description of artificial sequences: synthetic oligonucleotides <400> 44 gtcgccacca tggtgagcaa gggc 24 <210> 45 <211> 20 <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(20) <223> Description of artificial sequences: synthetic oligonucleotides <400> 45 gcactgcacg ccgtaggtca 20 <210> 46 <211> twenty four <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(24) <223> Description of artificial sequences: synthetic oligonucleotides <400> 46 gcactgcacg ccgtaggtca gggt 24 <210> 47 <211> 20 <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(20) <223> Description of artificial sequences: synthetic oligonucleotides <400> 47 gtgaaccgca tcgagctgaa 20 <210> 48 <211> twenty four <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(24) <223> Description of artificial sequences: synthetic oligonucleotides <400> 48 gtgaaccgca tcgagctgaa gggc 24 <210> 49 <211> 20 <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(20) <223> Description of artificial sequences: synthetic oligonucleotides <400> 49 gaagggcatc gacttcaagg 20 <210> 50 <211> twenty four <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(24) <223> Description of artificial sequences: synthetic oligonucleotides <400> 50 gaagggcatc gacttcaagg agga 24 <210> 51 <211> 20 <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(20) <223> Description of artificial sequences: synthetic oligonucleotides <400> 51 gcttcatgtg gtcggggtag 20 <210> 52 <211> twenty four <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(24) <223> Description of artificial sequences: synthetic oligonucleotides <400> 52 gcttcatgtg gtcggggtag cggc 24 <210> 53 <211> 20 <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(20) <223> Description of artificial sequences: synthetic oligonucleotides <400> 53 gctgaagcac tgcacgccgt 20 <210> 54 <211> twenty four <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(24) <223> Description of artificial sequences: synthetic oligonucleotides <400> 54 gctgaagcac tgcacgccgt aggt 24 <210> 55 <211> 20 <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(20) <223> Description of artificial sequences: synthetic oligonucleotides <400> 55 gccgtcgtcc ttgaagaaga 20 <210> 56 <211> twenty four <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(24) <223> Description of artificial sequences: synthetic oligonucleotides <400> 56 gccgtcgtcc ttgaagaaga tggt 24 <210> 57 <211> 20 <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(20) <223> Description of artificial sequences: synthetic oligonucleotides <400> 57 gaccaggatg ggcaccaccc 20 <210> 58 <211> twenty four <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(24) <223> Description of artificial sequences: synthetic oligonucleotides <400> 58 gaccaggatg ggcaccaccc cggt 24 <210> 59 <211> 20 <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(20) <223> Description of artificial sequences: synthetic oligonucleotides <400> 59 gacgtagcct tcgggcatgg 20 <210> 60 <211> twenty four <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(24) <223> Description of artificial sequences: synthetic oligonucleotides <400> 60 gacgtagcct tcgggcatgg cgga 24 <210> 61 <211> 20 <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(20) <223> Description of artificial sequences: synthetic oligonucleotides <400> 61 gaagttcgag ggcgacaccc 20 <210> 62 <211> twenty four <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(24) <223> Description of artificial sequences: synthetic oligonucleotides <400> 62 gaagttcgag ggcgacaccc tggt 24 <210> 63 <211> 20 <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(20) <223> Description of artificial sequences: synthetic oligonucleotides <400> 63 gagctggacg gcgacgtaaa 20 <210> 64 <211> twenty four <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(24) <223> Description of artificial sequences: synthetic oligonucleotides <400> 64 gagctggacg gcgacgtaaa cggc 24 <210> 65 <211> 20 <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(20) <223> Description of artificial sequences: synthetic oligonucleotides <400> 65 ggcatcgccc tcgccctcgc 20 <210> 66 <211> twenty four <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(24) <223> Description of artificial sequences: synthetic oligonucleotides <400> 66 ggcatcgccc tcgccctcgc cgga 24 <210> 67 <211> 20 <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(20) <223> Description of artificial sequences: synthetic oligonucleotides <400> 67 ggccacaagt tcagcgtgtc 20 <210> 68 <211> twenty four <212> DNA <213> Artificial Sequence <220> <221> GC_signal <222> (1)..(24) <223> Description of artificial sequences: synthetic oligonucleotides <400> 68 ggccacaagt tcagcgtgtc cggc 24 <210> 69 <211> 20 <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(20) <223> Description of artificial sequences: synthetic oligonucleotides <400> 69 gggcgaggag ctgttcaccg 20 <210> 70 <211> twenty four <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(24) <223> Description of artificial sequences: synthetic oligonucleotides <400> 70 gggcgaggag ctgttcaccg gggt 24 <210> 71 <211> 18 <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(18) <223> Description of artificial sequences: synthetic oligonucleotides <400> 71 gcgaggagct gttcaccg 18 <210> 72 <211> twenty two <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(22) <223> Description of artificial sequences: synthetic oligonucleotides <400> 72 gcgaggagct gttcaccggg gt 22 <210> 73 <211> 20 <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(20) <223> Description of artificial sequences: synthetic oligonucleotides <400> 73 cctcgaactt cacctcggcg 20 <210> 74 <211> twenty four <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(24) <223> Description of artificial sequences: synthetic oligonucleotides <400> 74 cctcgaactt cacctcggcg cggg 24 <210> 75 <211> 20 <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(20) <223> Description of artificial sequences: synthetic oligonucleotides <400> 75 gctcgaactt cacctcggcg 20 <210> 76 <211> twenty four <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(24) <223> Description of artificial sequences: synthetic oligonucleotides <400> 76 gctcgaactt cacctcggcg cggg 24 <210> 77 <211> 20 <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(20) <223> Description of artificial sequences: synthetic oligonucleotides <400> 77 caactacaag acccgcgccg 20 <210> 78 <211> twenty four <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(24) <223> Description of artificial sequences: synthetic oligonucleotides <400> 78 caactacaag acccgcgccg aggt 24 <210> 79 <211> 20 <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(20) <223> Description of artificial sequences: synthetic oligonucleotides <400> 79 gaactacaag acccgcgccg 20 <210> 80 <211> twenty four <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(24) <223> Description of artificial sequences: synthetic oligonucleotides <400> 80 gaactacaag acccgcgccg aggt 24 <210> 81 <211> 20 <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(20) <223> Description of artificial sequences: synthetic oligonucleotides <400> 81 cgctcctgga cgtagccttc 20 <210> 82 <211> twenty four <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(24) <223> Description of artificial sequences: synthetic oligonucleotides <400> 82 cgctcctgga cgtagccttc gggc 24 <210> 83 <211> 20 <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(20) <223> Description of artificial sequences: synthetic oligonucleotides <400> 83 ggctcctgga cgtagccttc 20 <210> 84 <211> twenty four <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(24) <223> Description of artificial sequences: synthetic oligonucleotides <400> 84 cgctcctgga cgtagccttc gggc 24 <210> 85 <211> 20 <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(20) <223> Description of artificial sequences: synthetic oligonucleotides <400> 85 agggcgagga gctgttcacc 20 <210> 86 <211> twenty four <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(24) <223> Description of artificial sequences: synthetic oligonucleotides <400> 86 agggcgagga gctgttcacc gggg 24 <210> 87 <211> 20 <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(20) <223> Description of artificial sequences: synthetic oligonucleotides <400> 87 ggggcgagga gctgttcacc 20 <210> 88 <211> twenty four <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(24) <223> Description of artificial sequences: synthetic oligonucleotides <400> 88 ggggcgagga gctgttcacc gggg 24 <210> 89 <211> 20 <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(20) <223> Description of artificial sequences: synthetic oligonucleotides <400> 89 gttcgagggc gacaccctgg 20 <210> 90 <211> twenty four <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(24) <223> Description of artificial sequences: synthetic oligonucleotides <400> 90 gttcgagggc gacaccctgg tgaa 24 <210> 91 <211> 20 <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(20) <223> Description of artificial sequences: synthetic oligonucleotides <400> 91 gttcaccagg gtgtcgccct 20 <210> 92 <211> twenty four <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(24) <223> Description of artificial sequences: synthetic oligonucleotides <400> 92 gttcaccagg gtgtcgccct cgaa 24 <210> 93 <211> 20 <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(20) <223> Description of artificial sequences: synthetic oligonucleotides <400> 93 gcccaccctc gtgaccaccc 20 <210> 94 <211> twenty four <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(24) <223> Description of artificial sequences: synthetic oligonucleotides <400> 94 gcccaccctc gtgaccaccc tgac 24 <210> 95 <211> 20 <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(20) <223> Description of artificial sequences: synthetic oligonucleotides <400> 95 gcccttgctc accatggtgg 20 <210> 96 <211> twenty four <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(24) <223> Description of artificial sequences: synthetic oligonucleotides <400> 96 gcccttgctc accatggtgg cgac 24 <210> 97 <211> 20 <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(20) <223> Description of artificial sequences: synthetic oligonucleotides <400> 97 gtcgccgtcc agctcgacca 20 <210> 98 <211> twenty four <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(24) <223> Description of artificial sequences: synthetic oligonucleotides <400> 98 gtcgccgtcc agctcgacca ggat 24 <210> 99 <211> 20 <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(20) <223> Description of artificial sequences: synthetic oligonucleotides <400> 99 gtgtccggcg agggcgaggg 20 <210> 100 <211> twenty four <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(24) <223> Description of artificial sequences: synthetic oligonucleotides <400> 100 gtgtccggcg agggcgaggg cgat 24 <210> 101 <211> 20 <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(20) <223> Description of artificial sequences: synthetic oligonucleotides <400> 101 ggggtggtgc ccatcctggt 20 <210> 102 <211> twenty four <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(24) <223> Description of artificial sequences: synthetic oligonucleotides <400> 102 ggggtggtgc ccatcctggt cgag 24 <210> 103 <211> 20 <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(20) <223> Description of artificial sequences: synthetic oligonucleotides <400> 103 gccaccatgg tgagcaaggg 20 <210> 104 <211> twenty four <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(24) <223> Description of artificial sequences: synthetic oligonucleotides <400> 104 gccaccatgg tgagcaaggg cgag 24 <210> 105 <211> 20 <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(20) <223> Description of artificial sequences: synthetic oligonucleotides <400> 105 gagtccgagc agaagaagaa 20 <210> 106 <211> twenty four <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(24) <223> Description of artificial sequences: synthetic oligonucleotides <400> 106 gagtccgagc agaagaagaa gggc 24 <210> 107 <211> 20 <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(20) <223> Description of artificial sequences: synthetic oligonucleotides <400> 107 gtcacctcca atgactaggg 20 <210> 108 <211> twenty four <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(24) <223> Description of artificial sequences: synthetic oligonucleotides <400> 108 gtcacctcca atgactaggg tggg 24 <210> 109 <211> 20 <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(20) <223> Description of artificial sequences: synthetic oligonucleotides <400> 109 gggaagactg aggctacata 20 <210> 110 <211> twenty four <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(24) <223> Description of artificial sequences: synthetic oligonucleotides <400> 110 gggaagactg aggctacata gggt 24 <210> 111 <211> 20 <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(20) <223> Description of artificial sequences: synthetic oligonucleotides <400> 111 gccacgaagc aggccaatgg 20 <210> 112 <211> twenty four <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(24) <223> Description of artificial sequences: synthetic oligonucleotides <400> 112 gccacgaagc aggccaatgg ggag 24 <210> 113 <211> 20 <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(20) <223> Description of artificial sequences: synthetic oligonucleotides <400> 113 ggaatccctt ctgcagcacc 20 <210> 114 <211> twenty four <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(24) <223> Description of artificial sequences: synthetic oligonucleotides <400> 114 ggaatccctt ctgcagcacc tgga 24 <210> 115 <211> 20 <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(20) <223> Description of artificial sequences: synthetic oligonucleotides <400> 115 gctgcagaag ggattccatg 20 <210> 116 <211> twenty four <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(24) <223> Description of artificial sequences: synthetic oligonucleotides <400> 116 gctgcagaag ggattccatg aggt 24 <210> 117 <211> 20 <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(20) <223> Description of artificial sequences: synthetic oligonucleotides <400> 117 ggcggctgca caaccagtgg 20 <210> 118 <211> twenty four <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(24) <223> Description of artificial sequences: synthetic oligonucleotides <400> 118 ggcggctgca caaccagtgg aggc 24 <210> 119 <211> 20 <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(20) <223> Description of artificial sequences: synthetic oligonucleotides <400> 119 gctccagagc cgtgcgaatg 20 <210> 120 <211> twenty four <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(24) <223> Description of artificial sequences: synthetic oligonucleotides <400> 120 gctccagagc cgtgcgaatg gggc 24 <210> 121 <211> 20 <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(20) <223> Description of artificial sequences: synthetic oligonucleotides <400> 121 gaatcccttc tgcagcacct 20 <210> 122 <211> twenty four <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(24) <223> Description of artificial sequences: synthetic oligonucleotides <400> 122 gaatcccttc tgcagcacct ggat 24 <210> 123 <211> 20 <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(20) <223> Description of artificial sequences: synthetic oligonucleotides <400> 123 gcggcggctg cacaaccagt 20 <210> 124 <211> twenty four <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(24) <223> Description of artificial sequences: synthetic oligonucleotides <400> 124 gcggcggctg cacaaccagt ggag 24 <210> 125 <211> 20 <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(20) <223> Description of artificial sequences: synthetic oligonucleotides <400> 125 ggttgtgcag ccgccgctcc 20 <210> 126 <211> twenty four <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(24) <223> Description of artificial sequences: synthetic oligonucleotides <400> 126 ggttgtgcag ccgccgctcc agag 24 <210> 127 <211> 20 <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(20) <223> Description of artificial sequences: synthetic oligonucleotides <400> 127 gcattttcag gaggaagcga 20 <210> 128 <211> twenty four <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(24) <223> Description of artificial sequences: synthetic oligonucleotides <400> 128 gcattttcag gaggaagcga tggc 24 <210> 129 <211> 20 <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(20) <223> Description of artificial sequences: synthetic oligonucleotides <400> 129 gggagaagaa agagagatgt 20 <210> 130 <211> twenty four <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(24) <223> Description of artificial sequences: synthetic oligonucleotides <400> 130 gggagaagaa agagagatgt aggg 24 <210> 131 <211> 20 <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(20) <223> Description of artificial sequences: synthetic oligonucleotides <400> 131 ggtgcatttt caggaggaag 20 <210> 132 <211> twenty four <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(24) <223> Description of artificial sequences: synthetic oligonucleotides <400> 132 ggtgcatttt caggaggaag cgat 24 <210> 133 <211> 20 <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(20) <223> Description of artificial sequences: synthetic oligonucleotides <400> 133 gagatgtagg gctagagggg 20 <210> 134 <211> twenty four <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(24) <223> Description of artificial sequences: synthetic oligonucleotides <400> 134 gagatgtagg gctagagggg tgag 24 <210> 135 <211> 20 <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(20) <223> Description of artificial sequences: synthetic oligonucleotides <400> 135 ggtatccagc agaggggaga 20 <210> 136 <211> twenty four <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(24) <223> Description of artificial sequences: synthetic oligonucleotides <400> 136 ggtatccagc agaggggaga agaa 24 <210> 137 <211> 20 <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(20) <223> Description of artificial sequences: synthetic oligonucleotides <400> 137 gaggcatctc tgcaccgagg 20 <210> 138 <211> twenty four <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(24) <223> Description of artificial sequences: synthetic oligonucleotides <400> 138 gaggcatctc tgcaccgagg tgaa 24 <210> 139 <211> 20 <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(20) <223> Description of artificial sequences: synthetic oligonucleotides <400> 139 gaggggtgag gctgaaacag 20 <210> 140 <211> twenty four <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(24) <223> Description of artificial sequences: synthetic oligonucleotides <400> 140 gaggggtgag gctgaaacag tgac 24 <210> 141 <211> 20 <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(20) <223> Description of artificial sequences: synthetic oligonucleotides <400> 141 gagcaaaagt agatattaca 20 <210> 142 <211> twenty four <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(24) <223> Description of artificial sequences: synthetic oligonucleotides <400> 142 gagcaaaagt agatattaca agac 24 <210> 143 <211> 20 <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(20) <223> Description of artificial sequences: synthetic oligonucleotides <400> 143 ggaattcaaa ctgaggcata 20 <210> 144 <211> twenty four <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(24) <223> Description of artificial sequences: synthetic oligonucleotides <400> 144 ggaattcaaa ctgaggcata tgat 24 <210> 145 <211> 20 <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(20) <223> Description of artificial sequences: synthetic oligonucleotides <400> 145 gcagagggga gaagaaagag 20 <210> 146 <211> twenty four <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(24) <223> Description of artificial sequences: synthetic oligonucleotides <400> 146 gcagagggga gaagaaagag agat 24 <210> 147 <211> 20 <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(20) <223> Description of artificial sequences: synthetic oligonucleotides <400> 147 gcaccgaggc atctctgcac 20 <210> 148 <211> twenty four <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(24) <223> Description of artificial sequences: synthetic oligonucleotides <400> 148 gcaccgaggc atctctgcac cgag 24 <210> 149 <211> 20 <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(20) <223> Description of artificial sequences: synthetic oligonucleotides <400> 149 gagatgtagg gctagagggg 20 <210> 150 <211> twenty four <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(24) <223> Description of artificial sequences: synthetic oligonucleotides <400> 150 gagatgtagg gctagagggg tgag 24 <210> 151 <211> 20 <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(20) <223> Description of artificial sequences: synthetic oligonucleotides <400> 151 gtgcggcaag agcttcagcc 20 <210> 152 <211> twenty four <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(24) <223> Description of artificial sequences: synthetic oligonucleotides <400> 152 gtgcggcaag agcttcagcc gggg 24 <210> 153 <211> 20 <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(20) <223> Description of artificial sequences: synthetic oligonucleotides <400> 153 gggtgggggg agtttgctcc 20 <210> 154 <211> twenty four <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(24) <223> Description of artificial sequences: synthetic oligonucleotides <400> 154 gggtgggggg agtttgctcc tgga 24 <210> 155 <211> 20 <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(20) <223> Description of artificial sequences: synthetic oligonucleotides <400> 155 gaccccctcc accccgcctc 20 <210> 156 <211> twenty four <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(24) <223> Description of artificial sequences: synthetic oligonucleotides <400> 156 gaccccctcc accccgcctc cggg 24 <210> 157 <211> 20 <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(20) <223> Description of artificial sequences: synthetic oligonucleotides <400> 157 ggtgagtgag tgtgtgcgtg 20 <210> 158 <211> twenty four <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(24) <223> Description of artificial sequences: synthetic oligonucleotides <400> 158 ggtgagtgag tgtgtgcgtg tggg 24 <210> 159 <211> 20 <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(20) <223> Description of artificial sequences: synthetic oligonucleotides <400> 159 gcgagcagcg tcttcgagag 20 <210> 160 <211> twenty four <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(24) <223> Description of artificial sequences: synthetic oligonucleotides <400> 160 gcgagcagcg tcttcgagag tgag 24 <210> 161 <211> 20 <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(20) <223> Description of artificial sequences: synthetic oligonucleotides <400> 161 gtgcggcaag agcttcagcc 20 <210> 162 <211> twenty four <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(24) <223> Description of artificial sequences: synthetic oligonucleotides <400> 162 gtgcggcaag agcttcagcc agag 24 <210> 163 <211> twenty three <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(23) <223> Description of artificial sequences: synthetic oligonucleotides <400> 163 gagtccgagc agaagaagaa ggg 23 <210> 164 <211> twenty three <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(23) <223> Description of artificial sequences: synthetic oligonucleotides <400> 164 gtcacctcca atgactaggg tgg 23 <210> 165 <211> twenty three <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(23) <223> Description of artificial sequences: synthetic oligonucleotides <400> 165 ggaatccctt ctgcagcacc tgg 23 <210> 166 <211> twenty three <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(23) <223> Description of artificial sequences: synthetic oligonucleotides <400> 166 gctgcagaag ggattccatg agg 23 <210> 167 <211> twenty three <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(23) <223> Description of artificial sequences: synthetic oligonucleotides <400> 167 ggcggctgca caaccagtgg agg 23 <210> 168 <211> twenty three <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(23) <223> Description of artificial sequences: synthetic oligonucleotides <400> 168 gctccagagc cgtgcgaatg ggg 23 <210> 169 <211> twenty three <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(23) <223> Description of artificial sequences: synthetic oligonucleotides <400> 169 gcattttcag gaggaagcga tgg 23 <210> 170 <211> twenty three <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(23) <223> Description of artificial sequences: synthetic oligonucleotides <400> 170 gtgcggcaag agcttcagcc ggg 23 <210> 171 <211> twenty three <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(23) <223> Description of artificial sequences: synthetic oligonucleotides <400> 171 gaccccctcc accccgcctc cgg 23 <210> 172 <211> twenty three <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(23) <223> Description of artificial sequences: synthetic oligonucleotides <400> 172 ggtgagtgag tgtgtgcgtg tgg 23 <210> 173 <211> 20 <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(20) <223> Description of artificial sequences: Synthetic primers <400> 173 ggagcagctg gtcagagggg 20 <210> 174 <211> twenty two <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(22) <223> Description of artificial sequences: Synthetic primers <400> 174 ccatagggaa gggggacact gg 22 <210> 175 <211> 20 <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(20) <223> Description of artificial sequences: Synthetic primers <400> 175 gggccgggaa agagttgctg 20 <210> 176 <211> twenty two <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(22) <223> Description of artificial sequences: Synthetic primers <400> 176 gcccctacatc tgctctccct cc 22 <210> 177 <211> 25 <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(25) <223> Description of artificial sequences: Synthetic primers <400> 177 ccagcacaac ttactcgcac ttgac 25 <210> 178 <211> twenty two <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(22) <223> Description of artificial sequences: Synthetic primers <400> 178 catcaccaac ccacagccaa gg 22 <210> 179 <211> 20 <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(20) <223> Description of artificial sequences: Synthetic primers <400> 179 tccagatggc acattgtcag 20 <210> 180 <211> 20 <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(20) <223> Description of artificial sequences: Synthetic primers <400> 180 agggagcagg aaagtgaggt 20 <210> 181 <211> twenty two <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(22) <223> Description of artificial sequences: Synthetic primers <400> 181 cgaggaagag agagacgggg tc 22 <210> 182 <211> twenty three <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(23) <223> Description of artificial sequences: Synthetic primers <400> 182 ctccaatgca cccaagacag cag 23 <210> 183 <211> 20 <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(20) <223> Description of artificial sequences: Synthetic primers <400> 183 agtgtggggt gtgtgggaag 20 <210> 184 <211> 20 <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(20) <223> Description of artificial sequences: Synthetic primers <400> 184 gcaaggggaa gactctggca 20 <210> 185 <211> 19 <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(19) <223> Description of artificial sequences: Synthetic primers <400> 185 tacgagtgcc tagagtgcg 19 <210> 186 <211> twenty two <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(22) <223> Description of artificial sequences: Synthetic primers <400> 186 gcagatgtag gtcttggagg ac 22 <210> 187 <211> 20 <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(20) <223> Description of artificial sequences: Synthetic primers <400> 187 ggagcagctg gtcagagggg 20 <210> 188 <211> twenty two <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(22) <223> Description of artificial sequences: Synthetic primers <400> 188 cgatgtcctc cccattggcc tg 22 <210> 189 <211> 25 <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(25) <223> Description of artificial sequences: Synthetic primers <400> 189 gtggggagatttgcatctgt ggagg 25 <210> 190 <211> 26 <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(26) <223> Description of artificial sequences: Synthetic primers <400> 190 gcttttatac catcttgggg ttacag 26 <210> 191 <211> twenty four <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(24) <223> Description of artificial sequences: Synthetic primers <400> 191 caatgtgctt caacccatca cggc 24 <210> 192 <211> 27 <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(27) <223> Description of artificial sequences: Synthetic primers <400> 192 ccatgaattt gtgatggatg cagtctg 27 <210> 193 <211> twenty four <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(24) <223> Description of artificial sequences: Synthetic primers <400> 193 gagaaggagg tgcaggagct agac 24 <210> 194 <211> twenty four <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(24) <223> Description of artificial sequences: Synthetic primers <400> 194 catcccgacc ttcatccctc ctgg 24 <210> 195 <211> 25 <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(25) <223> Description of artificial sequences: Synthetic primers <400> 195 gtagttctga cattcctcct gaggg 25 <210> 196 <211> twenty three <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(23) <223> Description of artificial sequences: Synthetic primers <400> 196 tcaaacaagg tgcagataca gca 23 <210> 197 <211> twenty two <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(22) <223> Description of artificial sequences: Synthetic primers <400> 197 cagggtcgct cagtctgtgt gg 22 <210> 198 <211> twenty four <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(24) <223> Description of artificial sequences: Synthetic primers <400> 198 ccagcgcacc attcactcca cctg 24 <210> 199 <211> 25 <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(25) <223> Description of artificial sequences: Synthetic primers <400> 199 ggctgaagag gaagaccaga ctcag 25 <210> 200 <211> 25 <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(25) <223> Description of artificial sequences: Synthetic primers <400> 200 ggcccctctg aattcaattc tctgc 25 <210> 201 <211> twenty one <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(21) <223> Description of artificial sequences: Synthetic primers <400> 201 ccacagcgag gagtgacagc c 21 <210> 202 <211> 26 <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(26) <223> Description of artificial sequences: Synthetic primers <400> 202 ccaagtcttt cctaactcga ccttgg 26 <210> 203 <211> twenty two <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(22) <223> Description of artificial sequences: Synthetic primers <400> 203 ccctaggccc acaccagcaa tg 22 <210> 204 <211> twenty four <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(24) <223> Description of artificial sequences: Synthetic primers <400> 204 gggatgggaa tgggaatgtg aggc 24 <210> 205 <211> twenty two <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(22) <223> Description of artificial sequences: Synthetic primers <400> 205 gcccaggtga aggtgtggtt cc 22 <210> 206 <211> twenty one <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(21) <223> Description of artificial sequences: Synthetic primers <400> 206 ccaaagcctg gccagggagt g 21 <210> 207 <211> 25 <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(25) <223> Description of artificial sequences: Synthetic primers <400> 207 aggcaaagat ctaggacctg gatgg 25 <210> 208 <211> twenty four <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(24) <223> Description of artificial sequences: Synthetic primers <400> 208 ccatctgagt cagccagcct tgtc 24 <210> 209 <211> twenty one <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(21) <223> Description of artificial sequences: Synthetic primers <400> 209 ggttccctcc cttctgagcc c 21 <210> 210 <211> 25 <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(25) <223> Description of artificial sequences: Synthetic primers <400> 210 ggataggaat gaagaccccc tctcc 25 <210> 211 <211> 25 <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(25) <223> Description of artificial sequences: Synthetic primers <400> 211 ggactggctg gctgtgtgtt ttgag 25 <210> 212 <211> twenty four <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(24) <223> Description of artificial sequences: Synthetic primers <400> 212 cttatccagg gctacctcat tgcc 24 <210> 213 <211> 25 <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(25) <223> Description of artificial sequences: Synthetic primers <400> 213 gctgctgctg ctttgatcac tcctg 25 <210> 214 <211> twenty four <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(24) <223> Description of artificial sequences: Synthetic primers <400> 214 ctccttaaac cctcagaagc tggc 24 <210> 215 <211> twenty three <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(23) <223> Description of artificial sequences: Synthetic primers <400> 215 gcactgtcag ctgatcctac agg 23 <210> 216 <211> twenty four <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(24) <223> Description of artificial sequences: Synthetic primers <400> 216 acgttggaac agtcgagctg tagc 24 <210> 217 <211> 25 <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(25) <223> Description of artificial sequences: Synthetic primers <400> 217 tgtgcataac tcatgttggc aaact 25 <210> 218 <211> twenty three <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(23) <223> Description of artificial sequences: Synthetic primers <400> 218 tccacaacta ccctcagctg gag 23 <210> 219 <211> 25 <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(25) <223> Description of artificial sequences: Synthetic primers <400> 219 ccactgacaa ttcactcaac cctgc 25 <210> 220 <211> twenty four <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(24) <223> Description of artificial sequences: Synthetic primers <400> 220 aggcagacca gttatttggc agtc 24 <210> 221 <211> twenty two <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(22) <223> Description of artificial sequences: Synthetic primers <400> 221 acaggcgcag ttcactgaga ag 22 <210> 222 <211> twenty two <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(22) <223> Description of artificial sequences: Synthetic primers <400> 222 gggtaggctg actttgggct cc 22 <210> 223 <211> twenty two <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(22) <223> Description of artificial sequences: Synthetic primers <400> 223 gccctcttgc ctccactggt tg 22 <210> 224 <211> twenty three <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(23) <223> Description of artificial sequences: Synthetic primers <400> 224 cgcggatgtt ccaatcagta cgc 23 <210> 225 <211> twenty two <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(22) <223> Description of artificial sequences: Synthetic primers <400> 225 gcgggcagtg gcgtcttagt cg 22 <210> 226 <211> twenty two <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(22) <223> Description of artificial sequences: Synthetic primers <400> 226 ccctgggttt ggttggctgc tc 22 <210> 227 <211> twenty one <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(21) <223> Description of artificial sequences: Synthetic primers <400> 227 ctccttgccg cccagccggt c 21 <210> 228 <211> twenty three <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(23) <223> Description of artificial sequences: Synthetic primers <400> 228 cactggggaa gaggcgagga cac 23 <210> 229 <211> twenty three <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(23) <223> Description of artificial sequences: Synthetic primers <400> 229 ccagtgtttc ccatccccaa cac 23 <210> 230 <211> twenty three <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(23) <223> Description of artificial sequences: Synthetic primers <400> 230 gaatggatcc ccccctagag ctc 23 <210> 231 <211> twenty two <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(22) <223> Description of artificial sequences: Synthetic primers <400> 231 caggcccaca ggtccttctg ga 22 <210> 232 <211> twenty one <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(21) <223> Description of artificial sequences: Synthetic primers <400> 232 ccacacggaa ggctgaccac g 21 <210> 233 <211> twenty one <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(21) <223> Description of artificial sequences: Synthetic primers <400> 233 gcgcagagag agcaggacgt c 21 <210> 234 <211> twenty three <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(23) <223> Description of artificial sequences: Synthetic primers <400> 234 gcacctcatg gaatcccttc tgc 23 <210> 235 <211> twenty three <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(23) <223> Description of artificial sequences: Synthetic primers <400> 235 caagtgatgc gacttccaac ctc 23 <210> 236 <211> 26 <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(26) <223> Description of artificial sequences: Synthetic primers <400> 236 ccctcagagt tcagcttaaa aagacc 26 <210> 237 <211> 25 <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(25) <223> Description of artificial sequences: Synthetic primers <400> 237 tgcttctcat ccactctaga ctgct 25 <210> 238 <211> twenty two <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(22) <223> Description of artificial sequences: Synthetic primers <400> 238 caccaaccag ccatgtgcca tg 22 <210> 239 <211> twenty two <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(22) <223> Description of artificial sequences: Synthetic primers <400> 239 ctgcctgtgc tcctcgatgg tg 22 <210> 240 <211> twenty two <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(22) <223> Description of artificial sequences: Synthetic primers <400> 240 gggttcaaag ctcatctgcc cc 22 <210> 241 <211> twenty three <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(23) <223> Description of artificial sequences: Synthetic primers <400> 241 gcatgtgcct tgagattgcc tgg 23 <210> 242 <211> 25 <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(25) <223> Description of artificial sequences: Synthetic primers <400> 242 gacattcaga gaagcgacca tgtgg 25 <210> 243 <211> twenty three <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(23) <223> Description of artificial sequences: Synthetic primers <400> 243 ccatcttccc ctttggccca cag 23 <210> 244 <211> 25 <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(25) <223> Description of artificial sequences: Synthetic primers <400> 244 ccccaaaagt ggccaagagcctgag 25 <210> 245 <211> 26 <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(26) <223> Description of artificial sequences: Synthetic primers <400> 245 gttctccaaa ggaagagagg ggaatg 26 <210> 246 <211> twenty two <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(22) <223> Description of artificial sequences: Synthetic primers <400> 246 ggtgctgtgt cctcatgcat cc 22 <210> 247 <211> twenty two <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(22) <223> Description of artificial sequences: Synthetic primers <400> 247 cggcttgcct agggtcgttg ag 22 <210> 248 <211> twenty two <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(22) <223> Description of artificial sequences: Synthetic primers <400> 248 ccttcagggg ctcttccagg tc 22 <210> 249 <211> twenty one <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(21) <223> Description of artificial sequences: Synthetic primers <400> 249 gggaactggc aggcaccgag g 21 <210> 250 <211> twenty two <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(22) <223> Description of artificial sequences: Synthetic primers <400> 250 gggtgaggct gaaacagtga cc 22 <210> 251 <211> 26 <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(26) <223> Description of artificial sequences: Synthetic primers <400> 251 gggaggatgt tggttttagg gaactg 26 <210> 252 <211> 27 <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(27) <223> Description of artificial sequences: Synthetic primers <400> 252 tccaatcact acatgccatt ttgaaga 27 <210> 253 <211> twenty four <212> DNA <213> Artificial Sequence <220> <221> GC_signal <222> (1)..(24) <223> Description of artificial sequences: Synthetic primers <400> 253 ccaccctctt cctttgatcc tccc 24 <210> 254 <211> twenty three <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(23) <223> Description of artificial sequences: Synthetic primers <400> 254 tcctccctac tccttcaccc agg 23 <210> 255 <211> twenty three <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(23) <223> Description of artificial sequences: Synthetic primers <400> 255 gagtgcctga catgtgggga gag 23 <210> 256 <211> twenty three <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(23) <223> Description of artificial sequences: Synthetic primers <400> 256 tccagctaaa gcctttccca cac 23 <210> 257 <211> 26 <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(26) <223> Description of artificial sequences: Synthetic primers <400> 257 gaactctctg atgcacctga aggctg 26 <210> 258 <211> 25 <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(25) <223> Description of artificial sequences: Synthetic primers <400> 258 accgtatcag tgtgatgcat gtggt 25 <210> 259 <211> 28 <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(28) <223> Description of artificial sequences: Synthetic primers <400> 259 tgggtttaat catgtgttct gcactatg 28 <210> 260 <211> twenty four <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(24) <223> Description of artificial sequences: Synthetic primers <400> 260 cccatcttcc attctgccct ccac 24 <210> 261 <211> 28 <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(28) <223> Description of artificial sequences: Synthetic primers <400> 261 cagctagtcc atttgttctc agactgtg 28 <210> 262 <211> 25 <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(25) <223> Description of artificial sequences: Synthetic primers <400> 262 ggccaacatt gtgaaaccct gtctc 25 <210> 263 <211> twenty two <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(22) <223> Description of artificial sequences: Synthetic primers <400> 263 ccagggacct gtgcttgggt tc 22 <210> 264 <211> twenty three <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(23) <223> Description of artificial sequences: Synthetic primers <400> 264 caccccatga cctggcacaa gtg 23 <210> 265 <211> twenty four <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(24) <223> Description of artificial sequences: Synthetic primers <400> 265 aagtgttcct cagaatgcca gccc 24 <210> 266 <211> twenty three <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(23) <223> Description of artificial sequences: Synthetic primers <400> 266 caggagtgca gttgtgttgg gag 23 <210> 267 <211> 25 <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(25) <223> Description of artificial sequences: Synthetic primers <400> 267 ctgatgaagc accagagaac ccacc 25 <210> 268 <211> twenty one <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(21) <223> Description of artificial sequences: Synthetic primers <400> 268 cacacctggc acccatatgg c 21 <210> 269 <211> 25 <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(25) <223> Description of artificial sequences: Synthetic primers <400> 269 gatccacact ggtgagaagccttac 25 <210> 270 <211> 26 <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(26) <223> Description of artificial sequences: Synthetic primers <400> 270 cttcccacac tcacagcaga tgtagg 26 <210> 271 <211> 4206 <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(4206) <223> Description of artificial sequences: synthetic polynucleotides <400> 271 atggataaaa agtattctat tggtttagac atcggcacta attccgttgg atgggctgtc 60 ataaccgatg aatacaaagt accttcaaag aaatttaagg tgttggggaa cacagaccgt 120 cattcgatta aaaagaatct tatcggtgcc ctcctattcg atagtggcga aacggcagag 180 gcgactcgcc tgaacgaac cgctcggaga aggtatacac gtcgcaagaa ccgaatatgt 240 tacttacaag aaatttttag caatgagatg gccaaagttg acgattcttt ctttcaccgt 300 360 aacatagtag atgaggtggc atatcatgaa aagtacccaa cgatttatca cctcagaaaa 420 aagctagttg actcaactga taagcggac ctgaggttaa tctacttggc tcttgcccat 480 atgataaagt tccgtgggca ctttctcatt gagggtgatc taaatccgga caactcggat 540 gtcgacaaac tgttcatcca gttagtacaa acctataatc agttgtttga agagaaccct 600 ataaatgcaa gtggcgtgga tgcgaaggct attcttagcg cccgcctctc taaatcccga 660 cggctgaaa acctgatcgc acaattaccc ggagagaaga aaaatgggtt gttcggtaac 720 cttatagcgc tctcactagg cctgacacca aattttaagt cgaacttcga cttagctgaa 780 gatgccaaat tgcagcttag taggcacag tacgatgacg atctcgacaa tctactggca 840 caaattggag atcagtatgc ggacttattt ttggctgcca aaaaccttag cgatgcaatc 900 ctcctatctg acatactgag agttaatact gagattacca aggcgccgtt atccgcttca 960 atgatcaaaa ggtacgatga acatcaccaa gacttgacac ttctcaaggc cctagtccgt 1020 cagcaactgc ctgagaaata taggaaata ttctttgatc agtcgaaaaa cgggtacgca 1080 ggttatattg acggcggagc gagtcaagag gaattctaca agtttatcaa acccatatta 1140 1200 aagcagcgga ctttcgacaa cggtagcatt ccacatcaaa tccacttagg cgaattgcat 1260 1320 gagaaaatcc taacctttcg cataccttac tatgtgggac ccctggcccg agggaactct 1380 cggttcgcat ggatgacaag aaagtccgaa gaacgatta ctccatggaa ttttgagaa 1440 gttgtcgata aaggtgcgtc agctcaatcg ttcatcgaga ggatgaccaa ctttgacaag 1500 1560 tacaatgaac tcacgaaagt tagtatgtc actgagggca tgcgtaaacc cgcctttcta 1620 agcggagaac agaagaaagc atatagtagat ctgttattca agaccaaccg caaagtgaca 1680 gttaagcaat tgaaagagga ctactttaag aaaattgaat gcttcgattc tgtcgagatc 1740 tccggggtag aagatcgatt taatgcgtca cttggtacgt atcatgacct cctaaagata 1800 attaaagata aggacttcct ggataacgaa gagaatgaag atatcttaga agatatagtg 1860 ttgactctta ccctctttga agatcgggaa atgattgagg aaagactaaa aacatacgct 1920 cacctgtcg acgataaggt tatgaaacag ttaaagaggc gtcgctatac gggctgggga 1980 cgattgtcgc ggaaacttat caacgggata agagacaagc aaagtggtaa aactattctc 2040 gattttctaa agagcgacgg cttcgccaat aggaacttta tgcagctgat ccatgatgac 2100 tctttaacct tcaaagagga tatacaaaag gcacaggtttt ccggacaagg ggactcattg 2160 cacgaacata ttgcgaatct tgctggttcg ccagccatca aaaagggcat actccagaca 2220 gtcaaagtag tggatgagct agttaaggtc atgggacgtc acaaaccgga aaacattgta 2280 atcgagatgg cacgcgaaaa tcaaacgact cagaaggggc aaaaaacag tcgagagcgg 2340 atgaagagaa tagaagagg tattaaagaa ctgggcagcc agatcttaaa ggagcatcct 2400 gtggaaaata cccaattgca gaacgagaaa ctttacctct attacctaca aaatggaagg 2460 gacatgtatg ttgatcagga actggacata aaccgtttat ctgattacga cgtcgatcac 2520 attgtacccc aatccttttt gaaggacgat tcaatcgaca ataaagtgct tacacgctcg 2580 gataagaacc gagggaaaag tgacaatgtt ccaagcgagg aagtcgtaaa gaaaatgaag 2640 aactattggc ggcagctcct aaatgcgaaa ctgataacgc aaagaaagtt cgataactta 2700 actaaagctg agaggggtgg cttgtctgaa cttgacaagg ccggatttat taaacgtcag 2760 ctkgtggaaa cccgccaaat cacaaagcat gttgcacaga tactagattc ccgaatgaat 2820 acgaaatacg acgagaacga taagctgatt cgggaagtca aagtaatcac tttaaaagtca 2880 aaattggtgt cggacttcag aaaggatttt caattctata aagttaggga gataaataac 2940 taccaccatg cgcacgacgc ttatcttaat gccgtcgtag ggaccgcact cattaagaaa 3000 tacccgaagc tagaaagtga gtttgtgtat ggtgattaca aagtttatga cgtccgtaag 3060 atgatcgcga aaagcgaaca ggagataggc aaggctacag ccaaatactt cttttattct 3120 aacattatga atttctttaa gacggaaatc actctggcaa acggagagat acggaaacga 3180 cctttaattg aaaccaatgg ggagacaggt gaaatcgtat gggataaggg ccgggacttc 3240 gcgacggtga gaaaagtttt gtccatgccc caagtcaaca tagtaagaa aactgaggtg 3300 cagaccggag ggttttcaaa ggaatcgatt cttccaaaaa ggaatagtga taagctcatc 3360 gctcgtaaa aggactggga cccgaaaaag tacggtggct tcgatagccc tacagttgcc 3420 tattctgtcc tagtagtggc aaaagttgag aagggaaaat ccaagaaact gaagtcagtc 3480 aaagaattat tggggataac gattatggag cgctcgtctt ttgaaaagaa ccccatcgac 3540 ttccttgagg cgaaaggtta caaggaagta aaaaaggatc tcataattaa actaccaaag 3600 tatagtctgt ttgagttaga aaatggccga aaacggatgt tggctagcgc cggagagctt 3660 caaaagggga acgaactcgc actaccgtct aaatacgtga atttcctgta tttagcgtcc 3720 cattacgaga agttgaaagg ttcacctgaa gataacgaac agaagcaact ttttgttgag 3780 cagcacaaac attatctcga cgaaatcata gagcaaattt cggaattcag taagagagtc 3840 atcctagctg atgccaatct ggacaaagta ttaagcgcat acaacaagca cagggataaa 3900 cccatacgtg agcaggcgga aaatattatc catttgttta ctcttaccaa cctcggcgct 3960 ccagccgcat tcaagtattt tgacacaacg atagatcgca aacgatacac ttctaccaag 4020 gaggtgctag acgcgacact gattcaccaa tccatcacgg gattatatga aactcggata 4080 gatttgtcac agcttggggg tgacggatcc cccaagaaga agaggaaagt ctcgagcgac 4140 tacaaagacc atgacggtga ttataaagat catgacatcg attacaagga tgacgatgac 4200 aagtga 4206 <210> 272 <211> 4206 <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(4206) <223> Description of artificial sequences: synthetic polynucleotides <400> 272 atggataaaa agtattctat tggtttagac atcggcacta attccgttgg atgggctgtc 60 ataaccgatg aatacaaagt accttcaaag aaatttaagg tgttggggaa cacagaccgt 120 cattcgatta aaaagaatct tatcggtgcc ctcctattcg atagtggcga aacggcagag 180 gcgactcgcc tgaacgaac cgctcggaga aggtatacac gtcgcaagaa ccgaatatgt 240 tacttacaag aaatttttag caatgagatg gccaaagttg acgattcttt ctttcaccgt 300 360 aacatagtag atgaggtggc atatcatgaa aagtacccaa cgatttatca cctcagaaaa 420 aagctagttg actcaactga taagcggac ctgaggttaa tctacttggc tcttgcccat 480 atgataaagt tccgtgggca ctttctcatt gagggtgatc taaatccgga caactcggat 540 gtcgacaaac tgttcatcca gttagtacaa acctataatc agttgtttga agagaaccct 600 ataaatgcaa gtggcgtgga tgcgaaggct attcttagcg cccgcctctc taaatcccga 660 cggctgaaa acctgatcgc acaattaccc ggagagaaga aaaatgggtt gttcggtaac 720 cttatagcgc tctcactagg cctgacacca aattttaagt cgaacttcga cttagctgaa 780 gatgccaaat tgcagcttag taggcacag tacgatgacg atctcgacaa tctactggca 840 caaattggag atcagtatgc ggacttattt ttggctgcca aaaaccttag cgatgcaatc 900 ctcctatctg acatactgag agttaatact gagattacca aggcgccgtt atccgcttca 960 atgatcaaaa ggtacgatga acatcaccaa gacttgacac ttctcaaggc cctagtccgt 1020 cagcaactgc ctgagaaata taggaaata ttctttgatc agtcgaaaaa cgggtacgca 1080 ggttatattg acggcggagc gagtcaagag gaattctaca agtttatcaa acccatatta 1140 1200 aagcagcgga ctttcgacaa cggtagcatt ccacatcaaa tccacttagg cgaattgcat 1260 1320 gagaaaatcc taacctttcg cataccttac tatgtgggac ccctggcccg agggaactct 1380 cggttcgcat ggatgacaag aaagtccgaa gaacgatta ctccctggaa ttttgagaa 1440 gttgtcgata aaggtgcgtc agctcaatcg ttcatcgaga ggatgaccgc ctttgacaag 1500 1560 tacaatgaac tcacgaaagt taagtatgtc actgagggca tgcgtaaacc cgcctttcta 1620 agcggagaac agaagaaagc atatagtagat ctgttattca agaccaaccg caaagtgaca 1680 gttaagcaat tgaaagagga ctactttaag aaaattgaat gcttcgattc tgtcgagatc 1740 tccggggtag aagatcgatt taatgcgtca cttggtacgt atcatgacct cctaaagata 1800 attaaagata aggacttcct ggataacgaa gagaatgaag atatcttaga agatatagtg 1860 ttgactctta ccctctttga agatcgggaa atgattgagg aaagactaaa aacatacgct 1920 cacctgtcg acgataaggt tatgaaacag ttaaagaggc gtcgctatac gggctgggga 1980 gccttgtcgc ggaaacttat caacgggata agagacaagc aaagtggtaa aactattctc 2040 gattttctaa agagcgacgg cttcgccaat aggaacttta tggccctgat ccatgatgac 2100 tctttaacct tcaaagagga tatacaaaag gcacaggtttt ccggacaagg ggactcattg 2160 cacgaacata ttgcgaatct tgctggttcg ccagccatca aaaagggcat actccagaca 2220 gtcaaagtag tggatgagct agttaaggtc atgggacgtc acaaaccgga aaacattgta 2280 atcgagatgg cacgcgaaaa tcaacgact cagaggggc aaaaaaacag tcgagagcgg 2340 atgagagaa tagagagggg tattaaagaa ctggggcagcc agatcttaa ggagcatccct 2400 gtggaaaata cccaattgca gaacgagaaa ctttacctct attackaca aaatggaagg 2460 gatagtatg ttgatcagga actggacata aaccgtttat ctgattacga cgtcgatcac 2520 attgtacccc aatcctttt gaaggacgat tcaatcgaca ataagtgct tacacgctcg 2580 gatagaacc gagggaaag tgacaatgtt ccaagcgagg aagtcgtaaa gaaatgaag 2640 aactattggc ggcagctcct aaatgcgaaa ctgataacgc aaagaaagtt cgataactta 2700 actaaagctg agaggggtgg cttgtctgaa cttgacaagg ccggattt taaacgtcag 2760 ctcgtggaaa cccgcgccat cacaagcat gttgcgcaga tactagattc ccgaatgaat 2820 acgaaatacg acgagaacga taagctgat cgggaagtca aagtaatcac ttagtca 2880 aaatttggtgt cggactcag aaaggatttt caatctata aagttagg gataaataac 2940 taccaccatg cgcacgacgc tattacttaat gccgtcgtag taccaccgcact cattagaaaa 3000 tacccgaagc tagaaagtga gtttgtgtat ggtgattaca aagtttatga cgtccgtaag 3060 atgatcgcga aaagcgaaca ggagataggc aaggctacag ccaaatactt cttttattct 3120 aacattatga atttctttaa gacggaaatc actctggcaa acggagagat acggaaacga 3180 cctttaattg aaaccaatgg ggagacaggt gaaatcgtat gggataaggg ccgggacttc 3240 gcgacggtga gaaaagtttt gtccatgccc caagtcaaca tagtaagaa aactgaggtg 3300 cagaccggag ggttttcaaa ggaatcgatt cttccaaaaa ggaatagtga taagctcatc 3360 gctcgtaaa aggactggga cccgaaaaag tacggtggct tcgatagccc tacagttgcc 3420 tattctgtcc tagtagtggc aaaagttgag aagggaaaat ccaagaaact gaagtcagtc 3480 aaagaattat tggggataac gattatggag cgctcgtctt ttgaaaagaa ccccatcgac 3540 ttccttgagg cgaaaggtta caaggaagta aaaaaggatc tcataattaa actaccaaag 3600 tatagtctgt ttgagttaga aaatggccga aaacggatgt tggctagcgc cggagagctt 3660 caaaagggga acgaactcgc actaccgtct aaatacgtga atttcctgta tttagcgtcc 3720 cattacgaga agttgaaagg ttcacctgaa gataacgaac agaagcaact ttttgttgag 3780 cagcacaaac attatctcga cgaaatcata gagcaaattt cggaattcag taagagagtc 3840 atcctagctg atgccaatct ggacaaagta ttaagcgcat acaacaagca cagggataaa 3900 cccatacgtg agcaggcgga aaatattatc catttgttta ctcttaccaa cctcggcgct 3960 ccagccgcat tcaagtattt tgacacaacg atagatcgca aacgatacac ttctaccaag 4020 gaggtgctag acgcgacact gattcaccaa tccatcacgg gattatatga aactcggata 4080 gatttgtcac agcttggggg tgacggatcc cccaagaaga agaggaaagt ctcgagcgac 4140 tacaaagacc atgacggtga ttataaagat catgacatcg attacaagga tgacgatgac 4200 aagtga 4206 <210> 273 <211> 4206 <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(4206) <223> Description of artificial sequences: synthetic polynucleotides <400> 273 atggataaaa agtattctat tggtttagac atcggcacta attccgttgg atgggctgtc 60 ataaccgatg aatacaaagt accttcaaag aaatttaagg tgttggggaa cacagaccgt 120 cattcgatta aaaagaatct tatcggtgcc ctcctattcg atagtggcga aacggcagag 180 gcgactcgcc tgaacgaac cgctcggaga aggtatacac gtcgcaagaa ccgaatatgt 240 tacttacaag aaatttttag caatgagatg gccaaagttg acgattcttt ctttcaccgt 300 360 aacatagtag atgaggtggc atatcatgaa aagtacccaa cgatttatca cctcagaaaa 420 aagctagttg actcaactga taagcggac ctgaggttaa tctacttggc tcttgcccat 480 atgataaagt tccgtgggca ctttctcatt gagggtgatc taaatccgga caactcggat 540 gtcgacaaac tgttcatcca gttagtacaa acctataatc agttgtttga agagaaccct 600 ataaatgcaa gtggcgtgga tgcgaaggct attcttagcg cccgcctctc taaatcccga 660 cggctgaaa acctgatcgc acaattaccc ggagagaaga aaaatgggtt gttcggtaac 720 cttatagcgc tctcactagg cctgacacca aattttaagt cgaacttcga cttagctgaa 780 gatgccaaat tgcagcttag taggcacag tacgatgacg atctcgacaa tctactggca 840 caaattggag atcagtatgc ggacttattt ttggctgcca aaaaccttag cgatgcaatc 900 ctcctatctg acatactgag agttaatact gagattacca aggcgccgtt atccgcttca 960 atgatcaaaa ggtacgatga acatcaccaa gacttgacac ttctcaaggc cctagtccgt 1020 cagcaactgc ctgagaaata taggaaata ttctttgatc agtcgaaaaa cgggtacgca 1080 ggttatattg acggcggagc gagtcaagag gaattctaca agtttatcaa acccatatta 1140 1200 aagcagcgga ctttcgacaa cggtagcatt ccacatcaaa tccacttagg cgaattgcat 1260 1320 gagaaaatcc taacctttcg cataccttac tatgtgggac ccctggcccg agggaactct 1380 cggttcgcat ggatgacaag aaagtccgaa gaacgatta ctccctggaa ttttgagaa 1440 gttgtcgata aaggtgcgtc agctcaatcg ttcatcgaga ggatgaccgc ctttgacaag 1500 aatttaccga acgaaaaagt attgcctaag cacagtttac tttacgagta tttcacagtg 1560 tacaatgaac tcacgaaagt taagtatgtc actgagggca tgcgtaaacc cgcctttcta 1620 agcggagaac agaagaaagc atatagtagat ctgttattca agaccaaccg caaagtgaca 1680 gttaagcaat tgaaagagga ctactttaag aaaattgaat gcttcgattc tgtcgagatc 1740 tccggggtag aagatcgatt taatgcgtca cttggtacgt atcatgacct cctaaagata 1800 attaaagata aggacttcct ggataacgaa gagaatgaag atatcttaga agatatagtg 1860 ttgactctta ccctctttga agatcgggaa atgattgagg aaagactaaa aacatacgct 1920 cacctgtcg acgataaggt tatgaaacag ttaaagaggc gtcgctatac gggctgggga 1980 gccttgtcgc ggaaacttat caacgggata agagacaagc aaagtggtaa aactattctc 2040 gattttctaa agagcgacgg cttcgccaat aggaacttta tggccctgat ccatgatgac 2100 tctttaacct tcaaagagga tatacaaaag gcacaggtttt ccggacaagg ggactcattg 2160 cacgaacata ttgcgaatct tgctggttcg ccagccatca aaaagggcat actccagaca 2220 gtcaaagtag tggatgagct agttaaggtc atgggacgtc aaaccgga aaacattgta 2280 atcgagatgg cacgcgaaaa tcaacgact cagaggggc aaaaaaacag tcgagagcgg 2340 atgagagaa tagagagggg tattaaagaa ctggggcagcc agatcttaa ggagcatccct 2400 gtggaaaata cccaattgca gaacgagaaa ctttacctct attackaca aaatggaagg 2460 gatagtatg ttgatcagga actggacata aaccgtttat ctgattacga cgtcgatcac 2520 attgtacccc aatcctttt gaaggacgat tcaatcgaca ataagtgct tacacgctcg 2580 gatagaacc gagggaaag tgacaatgtt ccaagcgagg aagtcgtaaa gaaatgaag 2640 aactattggc ggcagctcct aaatgcgaaa ctgataacgc aaagaaagtt cgataactta 2700 actaaagctg agaggggtgg cttgtctgaa cttgacaagg ccggattt taaacgtcag 2760 ctcgtggaaa cccgcgccat cacaagcat gttgcgcaga tactagattc ccgaatgaat 2820 acgaaatacg acgagaacga taagctgat cgggaagtca aagtaatcac ttagtca 2880 aaatttggtgt cggactcag aaaggatttt caatctata aagttagg gataaataac 2940 taccaccatg cgcacgacgc ttatcttaat gccgtcgtag ggaccgcact cattaagaaa 3000 tacccgaagc tagaaagtga gtttgtgtat ggtgattaca aagtttatga cgtccgtaag 3060 atgatcgcga aaagcgaaca ggagataggc aaggctacag ccaaatactt cttttattct 3120 aacattatga atttctttaa gacggaaatc actctggcaa acggagagat acggaaacga 3180 cctttaattg aaaccaatgg ggagacaggt gaaatcgtat gggataaggg ccgggacttc 3240 gcgacggtga gaaaagtttt gtccatgccc caagtcaaca tagtaagaa aactgaggtg 3300 cagaccggag ggttttcaaa ggaatcgatt cttccaaaaa ggaatagtga taagctcatc 3360 gctcgtaaa aggactggga cccgaaaaag tacggtggct tcgagagccc tacagttgcc 3420 tattctgtcc tagtagtggc aaaagttgag aagggaaaat ccaagaaact gaagtcagtc 3480 aaagaattat tggggataac gattatggag cgctcgtctt ttgaaaagaa ccccatcgac 3540 ttccttgagg cgaaaggtta caaggaagta aaaaaggatc tcataattaa actaccaaag 3600 tatagtctgt ttgagttaga aaatggccga aaacggatgt tggctagcgc cggagagctt 3660 caaaagggga acgaactcgc actaccgtct aaatacgtga atttcctgta tttagcgtcc 3720 cattacgaga agttgaaagg ttcacctgaa gataacgaac agaagcaact ttttgttgag 3780 cagcacaaac attatctcga cgaaatcata gagcaaattt cggaattcag taagagagtc 3840 atcctagctg atgccaatct ggacaaagta ttaagcgcat acaacaagca cagggataaa 3900 cccatacgtg agcaggcgga aaatattatc catttgttta ctcttaccaa cctcggcgct 3960 ccagccgcat tcaagtattt tgacacaacg atagatcgca aacgatacac ttctaccaag 4020 gaggtgctag acgcgacact gattcaccaa tccatcacgg gattatatga aactcggata 4080 gatttgtcac agcttggggg tgacggatcc cccaagaaga agaggaaagt ctcgagcgac 4140 tacaaagacc atgacggtga ttataaagat catgacatcg attacaagga tgacgatgac 4200 aagtga 4206 <210> 274 <211> 4206 <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(4206) <223> Description of artificial sequences: synthetic polynucleotides <400> 274 atggataaaa agtattctat tggtttagac atcggcacta attccgttgg atgggctgtc 60 ataaccgatg aatacaaagt accttcaaag aaatttaagg tgttggggaa cacagaccgt 120 cattcgatta aaaagaatct tatcggtgcc ctcctattcg atagtggcga aacggcagag 180 gcgactcgcc tgaacgaac cgctcggaga aggtatacac gtcgcaagaa ccgaatatgt 240 tacttacaag aaatttttag caatgagatg gccaaagttg acgattcttt ctttcaccgt 300 360 aacatagtag atgaggtggc atatcatgaa aagtacccaa cgatttatca cctcagaaaa 420 aagctagttg actcaactga taagcggac ctgaggttaa tctacttggc tcttgcccat 480 atgataaagt tccgtgggca ctttctcatt gagggtgatc taaatccgga caactcggat 540 gtcgacaaac tgttcatcca gttagtacaa acctataatc agttgtttga agagaaccct 600 ataaatgcaa gtggcgtgga tgcgaaggct attcttagcg cccgcctctc taaatcccga 660 cggctgaaa acctgatcgc acaattaccc ggagagaaga aaaatgggtt gttcggtaac 720 cttatagcgc tctcactagg cctgacacca aattttaagt cgaacttcga cttagctgaa 780 gatgccaaat tgcagcttag taggcacag tacgatgacg atctcgacaa tctactggca 840 caaattggag atcagtatgc ggacttattt ttggctgcca aaaaccttag cgatgcaatc 900 ctcctatctg acatactgag agttaatact gagattacca aggcgccgtt atccgcttca 960 atgatcaaaa ggtacgatga acatcaccaa gacttgacac ttctcaaggc cctagtccgt 1020 cagcaactgc ctgagaaata taggaaata ttctttgatc agtcgaaaaa cgggtacgca 1080 ggttatattg acggcggagc gagtcaagag gaattctaca agtttatcaa acccatatta 1140 1200 aagcagcgga ctttcgacaa cggtagcatt ccacatcaaa tccacttagg cgaattgcat 1260 1320 gagaaaatcc taacctttcg catacctgcc tatgtgggac ccctggcccg agggaactct 1380 cggttcgcat ggatgacaag aaagtccgaa gaacgatta ctccctggaa ttttgagaa 1440 gttgtcgata aaggtgcgtc agctcaatcg ttcatcgaga ggatgaccgc ctttgacaag 1500 aatttaccga acgaaaaagt attgcctaag cacagtttac tttacgagta tttcacagtg 1560 tacaatgaac tcacgaaagt taagtatgtc actgagggca tgcgtaaacc cgcctttcta 1620 agcggagaac agaagaaagc atatagtagat ctgttattca agaccaaccg caaagtgaca 1680 gttaagcaat tgaaagagga ctactttaag aaaattgaat gcttcgattc tgtcgagatc 1740 tccggggtag aagatcgatt taatgcgtca cttggtacgt atcatgacct cctaaagata 1800 attaaagata aggacttcct ggataacgaa gagaatgaag atatcttaga agatatagtg 1860 ttgactctta ccctctttga agatcgggaa atgattgagg aaagactaaa aacatacgct 1920 cacctgtcg acgataaggt tatgaaacag ttaaagaggc gtcgctatac gggctgggga 1980 gccttgtcgc ggaaacttat caacgggata agagacaagc aaagtggtaa aactattctc 2040 gattttctaa agagcgacgg cttcgccaat aggaacttta tggccctgat ccatgatgac 2100 tctttaacct tcaaagagga tatacaaaag gcacaggtttt ccggacaagg ggactcattg 2160 cacgaacata ttgcgaatct tgctggttcg ccagccatca aaaagggcat actccagaca 2220 gtcaaagtag tggatgagct agttaaggtc atgggacgtc aaaccgga aaacattgta 2280 atcgagatgg cacgcgaaaa tcaacgact cagaggggc aaaaaaacag tcgagagcgg 2340 atgagagaa tagagagggg tattaaagaa ctggggcagcc agatcttaa ggagcatccct 2400 gtggaaaata cccaattgca gaacgagaaa ctttacctct attackaca aaatggaagg 2460 gatagtatg ttgatcagga actggacata aaccgtttat ctgattacga cgtcgatcac 2520 attgtacccc aatcctttt gaaggacgat tcaatcgaca ataagtgct tacacgctcg 2580 gatagaacc gagggaaag tgacaatgtt ccaagcgagg aagtcgtaaa gaaatgaag 2640 aactattggc ggcagctcct aaatgcgaaa ctgataacgc aaagaaagtt cgataactta 2700 actaaagctg agaggggtgg cttgtctgaa cttgacaagg ccggattt taaacgtcag 2760 ctcgtggaaa cccgcgccat cacaagcat gttgcgcaga tactagattc ccgaatgaat 2820 acgaaatacg acgagaacga taagctgat cgggaagtca aagtaatcac ttagtca 2880 2940 taccaccatg cgcacgacgc ttatcttaat gccgtcgtag ggaccgcact cattaagaaa 3000 tacccgaagc tagaaagtga gtttgtgtat ggtgattaca aagtttatga cgtccgtaag 3060 atgatcgcga aaagcgaaca ggagataggc aaggctacag ccaaatactt cttttattct 3120 aacattatga atttctttaa gacggaaatc actctggcaa acggagagat acggaaacga 3180 cctttaattg aaaccaatgg ggagacaggt gaaatcgtat gggataaggg ccgggacttc 3240 gcgacggtga gaaaagtttt gtccatgccc caagtcaaca tagtaagaa aactgaggtg 3300 cagaccggag ggttttcaaa ggaatcgatt cttccaaaaa ggaatagtga taagctcatc 3360 gctcgtaaa aggactggga cccgaaaaag tacggtggct tcgatagccc tacagttgcc 3420 tattctgtcc tagtagtggc aaaagttgag aagggaaaat ccaagaaact gaagtcagtc 3480 aaagaattat tggggataac gattatggag cgctcgtctt ttgaaaagaa ccccatcgac 3540 ttccttgagg cgaaaggtta caaggaagta aaaaaggatc tcataattaa actaccaaag 3600 tatagtctgt ttgagttaga aaatggccga aaacggatgt tggctagcgc cggagagctt 3660 caaaagggga acgaactcgc actaccgtct aaatacgtga atttcctgta tttagcgtcc 3720 cattacgaga agttgaaagg ttcacctgaa gataacgaac agaagcaact ttttgttgag 3780 cagcacaaac attatctcga cgaaatcata gagcaaattt cggaattcag taagagagtc 3840 atcctagctg atgccaatct ggacaaagta ttaagcgcat acaacaagca cagggataaa 3900 cccatacgtg agcaggcgga aaatattatc catttgttta ctcttaccaa cctcggcgct 3960 ccagccgcat tcaagtattt tgacacaacg atagatcgca aacgatacac ttctaccaag 4020 gaggtgctag acgcgacact gattcaccaa tccatcacgg gattatatga aactcggata 4080 gatttgtcac agcttggggg tgacggatcc cccaagaaga agaggaaagt ctcgagcgac 4140 tacaaagacc atgacggtga ttataaagat catgacatcg attacaagga tgacgatgac 4200 aagtga 4206 <210> 275 <211> 4206 <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(4206) <223> Description of artificial sequence: synthetic polynucleotide <400> 275 atggataaaa agtattctat tggtttagac atcggcacta attccgttgg atgggctgtc 60 ataaccgatg aatacaaagt accttcaaag aaatttaagg tgttggggaa cacagaccgt 120 cattcgatta aaaagaatct tatcggtgcc ctcctattcg atagtggcga aacggcagag 180 gcgactcgcc tgaaacgaac cgctcggaga aggtatacac gtcgcaagaa ccgaatatgt 240 tacttacaag aaatttttag caatgagatg gccaaagttg acgattcttt ctttcaccgt 300 ttggaagagt ccttccttgt cgaagaggac aagaaacatg aacggcaccc catctttgga 360 aacatagtag atgaggtggc atatcatgaa aagtacccaa cgatttatca cctcagaaaa 420 aagctagttg actcaactga taaagcggac ctgaggttaa tctacttggc tcttgcccat 480 atgataaagt tccgtgggca ctttctcatt gagggtgatc taaatccgga caactcggat 540 gtcgacaaac tgttcatcca gttagtacaa acctataatc agttgtttga agagaaccct 600 ataaatgcaa gtggcgtgga tgcgaaggct attcttagcg cccgcctctc taaatcccga 660 cggctgaaa acctgatcgc acaattaccc ggagagaaga aaaatgggtt gttcggtaac 720 cttatagcgc tctcactagg cctgacacca aattttaagt cgaacttcga cttagctgaa 780 gatgccaaat tgcagcttag taggcacag tacgatgacg atctcgacaa tctactggca 840 caaattggag atcagtatgc ggacttattt ttggctgcca aaaaccttag cgatgcaatc 900 ctcctatctg acatactgag agttaatact gagattacca aggcgccgtt atccgcttca 960 atgatcaaaa ggtacgatga acatcaccaa gacttgacac ttctcaaggc cctagtccgt 1020 cagcaactgc ctgagaaata taggaaata ttctttgatc agtcgaaaaa cgggtacgca 1080 ggttatattg acggcggagc gagtcaagag gaattctaca agtttatcaa acccatatta 1140 1200 aagcagcgga ctttcgacaa cggtagcatt ccacatcaaa tccacttagg cgaattgcat 1260 1320 gagaaaatcc taacctttcg cataccttac tatgtgggac ccctggcccg agggaactct 1380 cggttcgcat ggatgacaag aaagtccgaa gaaacgatta ctccatggaa ttttgaggaa 1440 gttgtcgata aaggtgcgtc agctcaatcg ttcatcgaga ggatgaccaa ctttgacaag 1500 aatttaccga acgaaaaagt attgcctaag cacagtttac tttacgagta tttcacagtg 1560 tacaatgaac tcacgaaagt taagtatgtc actgagggca tgcgtaaacc cgcctttcta 1620 agcggagaac agaagaaagc atatagtagat ctgttattca agaccaaccg caaagtgaca 1680 gttaagcaat tgaaagagga ctactttaag aaaattgaat gcttcgattc tgtcgagatc 1740 tccggggtag aagatcgatt taatgcgtca cttggtacgt atcatgacct cctaaagata 1800 attaaagata aggacttcct ggataacgaa gagaatgaag atatcttaga agatatagtg 1860 ttgactctta ccctctttga agatcgggaa atgattgagg aaagactaaa aacatacgct 1920 cacctgtcg acgataaggt tatgaaacag ttaaagaggc gtcgctatac gggctgggga 1980 cgattgtcgc ggaaacttat caacgggata agagacaagc aaagtggtaa aactattctc 2040 gattttctaa agagcgacgg cttcgccaat aggaacttta tgcagctgat ccatgatgac 2100 tctttaacct tcaagagga tatacaaag gcacaggtttt ccggacagg ggactcattg 2160 cacgaacata ttgcgaatct tgctggttcg ccagccatca aaaagggcat actccagaca 2220 gtcaaagtag tggatgagct agttaaggtc atgggacgtc aaaccgga aaacattgta 2280 atcgagatgg cacgcgaaaa tcaacgact cagaggggc aaaaaaacag tcgagagcgg 2340 atgagagaa tagagagggg tattaaagaa ctggggcagcc agatcttaa ggagcatccct 2400 gtggaaaata cccaattgca gaacgagaaa ctttacctct attackaca aaatggaagg 2460 gatagtatg ttgatcagga actggacata aaccgtttat ctgattacga cgtcgatcac 2520 attgtacccc aatcctttt gaaggacgat tcaatcgaca ataagtgct tacacgctcg 2580 gatagaacc gagggaaag tgacaatgtt ccaagcgagg aagtcgtaaa gaaatgaag 2640 aactattggc ggcagctcct aaatgcgaaa ctgataacgc aaagaaagtt cgataactta 2700 actaaagctg agaggggtgg cttgtctgaa cttgacaagg ccggattt taaacgtcag 2760 ctcgtggaaa cccgccaaat cacaagcat gttgcacaga tactagattc ccgaatgaat 2820 acgaaatacg acgagaacga taagctgatt cgggaagtca aagtaatcac tttaaaagtca 2880 aaattggtgt cggacttcag aaaggatttt caattctata aagttaggga gataaataac 2940 taccaccatg cgcacgacgc ttatcttaat gccgtcgtag ggaccgcact cattaagaaa 3000 tacccgaagc tagaaagtga gtttgtgtat ggtgattaca aagtttatga cgtccgtaag 3060 atgatcgcga aaagcgaaca ggagataggc aaggctacag ccaaatactt cttttattct 3120 aacattatga atttctttaa gacggaaatc actctggcaa acggagagat acgcaaacga 3180 cctttaattg aaaccaatgg ggagacaggt gaaatcgtat gggataaggg ccgggacttc 3240 gcgacggtga gaaaagttt gtccatgccc caagtcaaca tagtaaagaa aactgaggtg 3300 cagaccggag ggttttcaaa ggaatcgatt cttccaaaaa ggaatagtga taagctcatc 3360 gctcgtaaa aggactggga cccgaaaaag tacggtggct tcgtgagccc tacagttgcc 3420 tattctgtcc tagtagtggc aaaagttgag aagggaaaat ccaagaaact gaagtcagtc 3480 aaagaattat tggggataac gattatggag cgctcgtctt ttgaaaagaa ccccatcgac 3540 ttccttgagg cgaaaggtta caggaagta aaaaaggatc tcatattaa actaccaag 3600 tatagtctgt ttgagttaga aaatggccga aaacggatgt tggctagcgc cggagagctt 3660 caaaagggga acgaaccgc actaccgtct aaatacgtga atttcctgta tttagcgtcc 3720 cattacgaga agttgaagg ttcacctgaa gatacgaac agaagcaact tttgttgag 3780 cagcacaac attatctcga cgaaatcata gagcaattt cggaattcag windowgagtc 3840 atcctagctg atgccaatct ggacaagta ttaagcgcat acaacca caggtaaaa 3900 cccatacgtg agcaggcgga aaatattatc cattgttta ctcttaccaa cctcggcgct 3960 ccagccgcat tcaagtattt tgacacaacg atagatcgca aacagtacag atctaccaag 4020 gaggtgctag acgcgacact gattcaccaa tccatcacgg gattatatga aactcggata 4080 gatttgtcac agcttggggg tgacggatcc cccagaaga agaggaagt ctcgagcgac 4140 tacaagacc atgacggtga ttaaagat catgacatcg attackagga tgacgatgac 4200 Augtga 4206 <210> 276 <211> 4206 <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(4206) <223> Description of artificial sequences: synthetic polynucleotides <400> 276 atggataaaa agtattctat tggtttagac atcggcacta attccgttgg atgggctgtc 60 ataaccgatg aatacaaagt accttcaaag aaatttaagg tgttggggaa cacagaccgt 120 cattcgatta aaaagaatct tatcggtgcc ctcctattcg atagtggcga aacggcagag 180 gcgactcgcc tgaaacgaac cgctcggaga aggtatacac gtcgcaagaa ccgaatatgt 240 tacttacaag aaatttttag caatgagatg gccaaagttg acgattcttt ctttcaccgt 300 ttggaagagt ccttccttgt cgaagaggac aagaaacatg aacggcaccc catctttgga 360 aacatagtag atgaggtggc atatcatgaa aagtacccaa cgatttatca cctcagaaaa 420 aagctagttg actcaactga taaagcggac ctgaggttaa tctacttggc tcttgcccat 480 atgataaagt tccgtgggca ctttctcatt gagggtgatc taaatccgga caactcggat 540 gtcgacaaac tgttcatcca gttagtacaa acctataatc agttgtttga agagaaccct 600 ataaatgcaa gtggcgtgga tgcgaaggct attcttagcg cccgcctctc taaatcccga 660 cggctgaaa acctgatcgc acaattaccc ggagagaaga aaaatgggtt gttcggtaac 720 cttatagcgc tctcactagg cctgacacca aattttaagt cgaacttcga cttagctgaa 780 gatgccaaat tgcagcttag taggcacag tacgatgacg atctcgacaa tctactggca 840 caaattggag atcagtatgc ggacttattt ttggctgcca aaaaccttag cgatgcaatc 900 ctcctatctg acatactgag agttaatact gagattacca aggcgccgtt atccgcttca 960 atgatcaaaa ggtacgatga acatcaccaa gacttgacac ttctcaaggc cctagtccgt 1020 cagcaactgc ctgagaaata taggaaata ttctttgatc agtcgaaaaa cgggtacgca 1080 ggttatattg acggcggagc gagtcaagag gaattctaca agtttatcaa acccatatta 1140 1200 aagcagcgga ctttcgacaa cggtagcatt ccacatcaaa tccacttagg cgaattgcat 1260 1320 gagaaaatcc taaccttcg cataccttac tatgtgggac ccctggcccg agggaactct 1380 cggttcgcat ggatgacaag aaagtccgaa gaaacgatta ctccctggaa ttttgaggaa 1440 gttgtcgata aaggtgcgtc agctcaatcg ttcatcgaga ggatgaccgc ctttgacaag 1500 aatttaccga acgaaaaagt attgcctaag cacagtttac tttacgagta tttcacagtg 1560 tacaatgaac tcacgaaagt taagtatgtc actgagggca tgcgtaaacc cgcctttcta 1620 agcggagaac agaagaaagc atatagtagat ctgttattca agaccaaccg caaagtgaca 1680 gttaagcaat tgaaagagga ctactttaag aaaattgaat gcttcgattc tgtcgagatc 1740 tccggggtag aagatcgatt taatgcgtca cttggtacgt atcatgacct cctaaagata 1800 attaaagata aggacttcct ggataacgaa gagaatgaag atatcttaga agatatagtg 1860 ttgactctta ccctctttga agatcgggaa atgattgagg aaagactaaa aacatacgct 1920 cacctgtcg acgataaggt tatgaaacag ttaaagaggc gtcgctatac gggctgggga 1980 gccttgtcgc ggaaacttat caacgggata agagacaagc aaagtggtaa aactattctc 2040 gattttctaa agagcgacgg cttcgccaat aggacttta tggccctgat ccatgatgac 2100 tctttaacct tcaagagga tatacaaag gcacaggtttt ccggacagg ggactcattg 2160 cacgaacata ttgcgaatct tgctggttcg ccagccatca aaaagggcat actccagaca 2220 gtcaaagtag tggatgagct agttaaggtc atgggacgtc aaaccgga aaacattgta 2280 atcgagatgg cacgcgaaaa tcaacgact cagaggggc aaaaaaacag tcgagagcgg 2340 atgagagaa tagagagggg tattaaagaa ctggggcagcc agatcttaa ggagcatccct 2400 gtggaaaata cccaattgca gaacgagaaa ctttacctct attackaca aaatggaagg 2460 gatagtatg ttgatcagga actggacata aaccgtttat ctgattacga cgtcgatcac 2520 attgtacccc aatcctttt gaaggacgat tcaatcgaca ataagtgct tacacgctcg 2580 gatagaacc gagggaaag tgacaatgtt ccaagcgagg aagtcgtaaa gaaatgaag 2640 aactattggc ggcagctcct aaatgcgaaa ctgataacgc aaagaaagtt cgataactta 2700 actaaagctg agaggggtgg cttgtctgaa cttgacaagg ccggattt taaacgtcag 2760 ctcgtggaaa cccgcgccat cacaaagcat gttgcgcaga tactagattc ccgaatgaat 2820 acgaaatacg acgagaacga taagctgatt cgggaagtca aagtaatcac tttaaaagtca 2880 aaattggtgt cggacttcag aaaggatttt caattctata aagttaggga gataaataac 2940 taccaccatg cgcacgacgc ttatcttaat gccgtcgtag ggaccgcact cattaagaaa 3000 tacccgaagc tagaaagtga gtttgtgtat ggtgattaca aagtttatga cgtccgtaag 3060 atgatcgcga aaagcgaaca ggagataggc aaggctacag ccaaatactt cttttattct 3120 aacattatga atttctttaa gacggaaatc actctggcaa acggagagat acgcaaacga 3180 cctttaattg aaaccaatgg ggagacaggt gaaatcgtat gggataaggg ccgggacttc 3240 gcgacggtga gaaaagttt gtccatgccc caagtcaaca tagtaaagaa aactgaggtg 3300 cagaccggag ggttttcaaa ggaatcgatt cttccaaaaa ggaatagtga taagctcatc 3360 gctcgtaaa aggactggga cccgaaaaag tacggtggct tcgtgagccc tacagttgcc 3420 tattctgtcc tagtagtggc aaaagttgag aagggaaaat ccaagaaact gaagtcagtc 3480 aaagaattat tggggataac gattatggag cgctcgtctt ttgaaaagaa ccccatcgac 3540 ttccttgagg cgaaaggtta caaggaagta aaaaaggatc tcataatttaa actaccaaag 3600 tatagtctgt ttgagttaga aaatggccga aaacggatgt tggctagcgc cggagagctt 3660 caaaagggga acgaactcgc actaccgtct aatacgtga atttcctgta tttagcgtcc 3720 cattacgaga agttgaaagg ttcacctgaa gataacgaac agaagcaact ttttgttgag 3780 cagcacaaac attatctcga cgaaatcata gagcaaattt cggaattcag taagagagtc 3840 atcctagctg atgccaatct ggacaaagta ttaagcgcat acaacaagca cagggataaa 3900 cccatacgtg agcaggcgga aaattatc catttgttta ctcttaccaa cctcggcgct 3960 ccagccgcat tcaagtattt tgacacaacg atagatcgca aacagtacag atctaccaag 4020 gaggtgctag acgcgacact gattcaccaa tccatcacgg gattatatga aactcggata 4080 gatttgtcac agcttggggg tgacggatcc cccaagaaga agaggaaagt ctcgagcgac 4140 tacaaagacc atgacggtga ttataaagat catgacatcg attacaagga tgacgatgac 4200 aagtga 4206 <210> 277 <211> 4206 <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(4206) <223> Description of artificial sequence: Synthetic polynucleotide <400> 277 atggataaaa agtattctat tggtttagac atcggcacta attccgttgg atgggctgtc 60 ataaccgatg aatacaaagt accttcaaag aaatttaagg tgttggggaa cacagaccgt 120 cattcgatta aaaagaatct tatcggtgcc ctcctattcg atagtggcga aacggcagag 180 gcgactcgcc tgaaacgaac cgctcggaga aggtatacac gtcgcaagaa ccgaatatgt 240 tacttacaag aaatttttag caatgagatg gccaaagttg acgattcttt ctttcaccgt 300 ttggaagagt ccttccttgt cgaagaggac aagaaacatg aacggcaccc catctttgga 360 aacatagtag atgaggtggc atatcatgaa aagtacccaa cgatttatca cctcagaaaa 420 aagctagttg actcaactga taaagcggac ctgaggttaa tctacttggc tcttgcccat 480 atgataaagt tccgtgggca ctttctcatt gagggtgatc taaatccgga caactcggat 540 gtcgacaaac tgttcatcca gttagtacaa acctataatc agttgtttga agagaaccct 600 ataaatgcaa gtggcgtgga tgcgaaggct attcttagcg cccgcctctc taaatcccga 660 cggctgaaa acctgatcgc acaattaccc ggagagaaga aaaatgggtt gttcggtaac 720 cttatagcgc tctcactagg cctgacacca aattttaagt cgaacttcga cttagctgaa 780 gatgccaaat tgcagcttag taggcacag tacgatgacg atctcgacaa tctactggca 840 caaattggag atcagtatgc ggacttattt ttggctgcca aaaaccttag cgatgcaatc 900 ctcctatctg acatactgag agttaatact gagattacca aggcgccgtt atccgcttca 960 atgatcaaaa ggtacgatga acatcaccaa gacttgacac ttctcaaggc cctagtccgt 1020 cagcaactgc ctgagaaata taggaaata ttctttgatc agtcgaaaaa cgggtacgca 1080 ggttatattg acggcggagc gagtcaagag gaattctaca agtttatcaa acccatatta 1140 1200 aagcagcgga ctttcgacaa cggtagcatt ccacatcaaa tccacttagg cgaattgcat 1260 gctatactta gaaggcagga ggatttttat ccgttcctca aagacaatcg tgaaaagatt 1320 gagaaaatcc taaccttcg cataccttac tatgtgggac ccctggcccg agggaactct 1380 cggttcgcat ggatgacaag aaagtccgaa gaaacgatta ctccatggaa ttttgaggaa 1440 gttgtcgata aaggtgcgtc agctcaatcg ttcatcgaga ggatgaccaa ctttgacaag 1500 aatttaccga acgaaaaagt attgcctaag cacagtttac tttacgagta tttcacagtg 1560 tacaatgaac tcacgaaagt taagtatgtc actgagggca tgcgtaaacc cgcctttcta 1620 agcggagaac agaagaaagc atatagtagat ctgttattca agaccaaccg caaagtgaca 1680 gttaagcaat tgaaagagga ctactttaag aaaattgaat gcttcgattc tgtcgagatc 1740 tccggggtag aagatcgatt taatgcgtca cttggtacgt atcatgacct cctaaagata 1800 attaaagata aggacttcct ggataacgaa gagaatgaag atatcttaga agatatagtg 1860 ttgactctta ccctctttga agatcgggaa atgattgagg aaagactaaa aacatacgct 1920 cacctgtcg acgataaggt tatgaaacag ttaaagaggc gtcgctatac gggctgggga 1980 cgattgtcgc ggaacttat caacgggata agagacaagc aaagtggtaa aactattctc 2040 gattttctaa agagcgacgg cttcgccaat aggacttta tgcagctgat ccatgatgac 2100 tctttaacct tcaagagga tatacaaag gcacaggtttt ccggacagg ggactcattg 2160 cacgaacata ttgcgaatct tgctggttcg ccagccatca aaaagggcat actccagaca 2220 gtcaaagtag tggatgagct agttaaggtc atgggacgtc aaaccgga aaacattgta 2280 atcgagatgg cacgcgaaaa tcaacgact cagaggggc aaaaaaacag tcgagagcgg 2340 atgagagaa tagagagggg tattaaagaa ctggggcagcc agatcttaa ggagcatccct 2400 gtggaaaata cccaattgca gaacgagaaa ctttacctct attackaca aaatggaagg 2460 gatagtatg ttgatcagga actggacata aaccgtttat ctgattacga cgtcgatcac 2520 attgtacccc aatcctttt gaaggacgat tcaatcgaca ataagtgct tacacgctcg 2580 gatagaacc gagggaaag tgacaatgtt ccaagcgagg aagtcgtaaa gaaatgaag 2640 aactattggc ggcagctcct aaatgcgaaa ctgataacgc aaagaaagtt cgataactta 2700 actaaagctg agaggggtgg cttgtctgaa cttgacaagg ccggatttat taaacgtcag 2760 ctkgtggaaa cccgccaaat cacaaagcat gttgcacaga tactagattc ccgaatgaat 2820 acgaaatacg acgagaacga taagctgatt cgggaagtca aagtaatcac tttaaaagtca 2880 aaattggtgt cggacttcag aaaggatttt caattctata aagttaggga gataaataac 2940 taccaccatg cgcacgacgc ttatcttaat gccgtcgtag ggaccgcact cattaagaaa 3000 tacccgaagc tagaaagtga gtttgtgtat ggtgattaca aagtttatga cgtccgtaag 3060 atgatcgcga aaagcgaaca ggagataggc aaggctacag ccaaatactt cttttattct 3120 aacattatga atttctttaa gacggaaatc actctggcaa acggagagat acgcaaacga 3180 cctttaattg aaaccaatgg ggagacaggt gaaatcgtat gggataaggg ccgggacttc 3240 gcgacggtga gaaaagttt gtccatgccc caagtcaaca tagtaaagaa aactgaggtg 3300 cagaccggag ggttttcaaa ggaatcgatt cttccaaaaa ggaatagtga taagctcatc 3360 gctcgtaaa aggactggga cccgaaaaag tacggtggct tcgtgagccc tacagttgcc 3420 tattctgtcc tagtagtgc aaagttgag aaggaaat ccagaaact gaagtcagtc 3480 aaagaattat tggttaac gatttaggag cgctcgtctt ttgaaagaa cccatcgac 3540 ttccttgagg cgaaaggtta caggaagta aaaaaggatc tcatattaa actaccaag 3600 tatagtctgt ttgagttaga aaatggccga aaacggatgt tggctagcgc cagagagctt 3660 caaaagggga acgaaccgc actaccgtct aaatacgtga atttcctgta tttagcgtcc 3720 cattacgaga agttgaagg ttcacctgaa gatacgaac agaagcaact tttgttgag 3780 cagcacaac attatctcga cgaaatcata gagcaattt cggaattcag windowgagtc 3840 atcctagctg atgccaatct ggacaagta ttaagcgcat acaacca caggtaaaa 3900 cccatacgtg agcaggcgga aaatattatc cattgttta ctcttaccaa cctcggcgct 3960 ccagccgcat tcaagtattt tgacacaacg atagatcgca aacagtacag atctaccaag 4020 gaggtgctag acgcgacact gattcaccaa tccatcacgg gattatatga aactcggata 4080 gatttgtcac agcttggggg tgacggatcc cccagaaga agaggaagt ctcgagcgac 4140 tacaaagacc atgacggtga ttataaagat catgacatcg attacaagga tgacgatgac 4200 aagtga 4206 <210> 278 <211> 4206 <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(4206) <223> Description of artificial sequence: Synthetic polynucleotide <400> 278 atggataaaa agtattctat tggtttagac atcggcacta attccgttgg atgggctgtc 60 ataaccgatg aatacaaagt accttcaaag aaatttaagg tgttggggaa cacagaccgt 120 cattcgatta aaaagaatct tatcggtgcc ctcctattcg atagtggcga aacggcagag 180 gcgactcgcc tgaaacgaac cgctcggaga aggtatacac gtcgcaagaa ccgaatatgt 240 tacttacaag aaatttttag caatgagatg gccaaagttg acgattcttt ctttcaccgt 300 ttggaagagt ccttccttgt cgaagaggac aagaaacatg aacggcaccc catctttgga 360 aacatagtag atgaggtggc atatcatgaa aagtacccaa cgatttatca cctcagaaaa 420 aagctagttg actcaactga taaagcggac ctgaggttaa tctacttggc tcttgcccat 480 atgataaagt tccgtgggca ctttctcatt gagggtgatc taaatccgga caactcggat 540 gtcgacaaac tgttcatcca gttagtacaa acctataatc agttgtttga agagaaccct 600 ataaatgcaa gtggcgtgga tgcgaaggct attcttagcg cccgcctctc taaatcccga 660 cggctgaaa acctgatcgc acaattaccc ggagagaaga aaaatgggtt gttcggtaac 720 cttatagcgc tctcactagg cctgacacca aattttaagt cgaacttcga cttagctgaa 780 gatgccaaat tgcagcttag taggcacag tacgatgacg atctcgacaa tctactggca 840 caaattggag atcagtatgc ggacttattt ttggctgcca aaaaccttag cgatgcaatc 900 ctcctatctg acatactgag agttaatact gagattacca aggcgccgtt atccgcttca 960 atgatcaaaa ggtacgatga acatcaccaa gacttgacac ttctcaaggc cctagtccgt 1020 cagcaactgc ctgagaaata taggaaata ttctttgatc agtcgaaaaa cgggtacgca 1080 ggttatattg acggcggagc gagtcaagag gaattctaca agtttatcaa acccatatta 1140 1200 aagcagcgga ctttcgacaa cggtagcatt ccacatcaaa tccacttagg cgaattgcat 1260 gctatactta gaaggcagga ggatttttat ccgttcctca aagacaatcg tgaaaagatt 1320 gagaaaatcc taaccttcg cataccttac tatgtgggac ccctggcccg agggaactct 1380 cggttcgcat ggatgacaag aaagtccgaa gaaacgatta ctccctggaa ttttgaggaa 1440 gttgtcgata aaggtgcgtc agctcaatcg ttcatcgaga ggatgaccgc ctttgacaag 1500 aatttaccga acgaaaaagt attgcctaag cacagtttac tttacgagta tttcacagtg 1560 tacaatgaac tcacgaaagt taagtatgtc actgagggca tgcgtaaacc cgcctttcta 1620 agcggagaac agaagaaagc atatagtagat ctgttattca agaccaaccg caaagtgaca 1680 gttaagcaat tgaaagagga ctactttaag aaaattgaat gcttcgattc tgtcgagatc 1740 tccggggtag aagatcgatt taatgcgtca cttggtacgt atcatgacct cctaaagata 1800 attaaagata aggacttcct ggataacgaa gagaatgaag atatcttaga agatatagtg 1860 ttgactctta ccctctttga agatcgggaa atgattgagg aaagactaaa aacatacgct 1920 cacctgttcg acgataggt tatgaacag ttaaagaggc gtcgctatac gggctgggga 1980 gccttgtcgc ggaacttat caacgggata agagacaagc aaagtgtaa actattctc 2040 gattttctaa agagcgacgg cttcgccaat aggacttta tggccctgat ccatgatgac 2100 tctttaacct tcaagagga tatacaaag gcacaggtttt ccggacagg ggactcattg 2160 cacgaacata ttgcgaatct tgctggttcg ccagccatca aaaagggcat actccagaca 2220 gtcaaagtag tggatgagct agttaaggtc atgggacgtc aaaccgga aaacattgta 2280 atcgagatgg cacgcgaaaa tcaacgact cagaggggc aaaaaaacag tcgagagcgg 2340 atgagagaa tagagagggg tattaaagaa ctggggcagcc agatcttaa ggagcatccct 2400 gtggaaaata cccaattgca gaacgagaaa ctttacctct attackaca aaatggaagg 2460 gatagtatg ttgatcagga actggacata aaccgtttat ctgattacga cgtcgatcac 2520 attgtacccc aatcctttt gaaggacgat tcaatcgaca ataagtgct tacacgctcg 2580 gatagaacc gagggaaag tgacaatgtt ccaagcgagg aagtcgtaaa gaaatgaag 2640 aactattggc ggcagctcct aaatgcgaaa ctgataacgc aaagaaagtt cgataactta 2700 actaaagctg agaggggtgg cttgtctgaa cttgacaagg ccggatttat taaacgtcag 2760 ctcgtggaaa cccgcgccat cacaaagcat gttgcgcaga tactagattc ccgaatgaat 2820 acgaaatacg acgagaacga taagctgatt cgggaagtca aagtaatcac tttaaaagtca 2880 aaattggtgt cggacttcag aaaggatttt caattctata aagttaggga gataaataac 2940 taccaccatg cgcacgacgc ttatcttaat gccgtcgtag ggaccgcact cattaagaaa 3000 tacccgaagc tagaaagtga gtttgtgtat ggtgattaca aagtttatga cgtccgtaag 3060 atgatcgcga aaagcgaaca ggagataggc aaggctacag ccaaatactt cttttattct 3120 aacattatga atttctttaa gacggaaatc actctggcaa acggagagat acgcaaacga 3180 cctttaattg aaaccaatgg ggagacaggt gaaatcgtat gggataaggg ccgggacttc 3240 gcgacggtga gaaaagttt gtccatgccc caagtcaaca tagtaaagaa aactgaggtg 3300 cagaccggag ggttttcaaa ggaatcgatt cttccaaaaa ggaatagtga taagctcatc 3360 gctcgtaaaa aggactggga cccgaaaag tacggtggct tcgtgagccc tacagttgcc 3420 tattctgtcc tagtagtgc aaagttgag aaggaaat ccagaaact gaagtcagtc 3480 aaagaattat tggttaac gatttaggag cgctcgtctt ttgaaagaa cccatcgac 3540 ttccttgagg cgaaaggtta caggaagta aaaaaggatc tcatattaa actaccaag 3600 tatagtctgt ttgagttaga aaatggccga aaacggatgt tggctagcgc cagagagctt 3660 caaaagggga acgaaccgc actaccgtct aaatacgtga atttcctgta tttagcgtcc 3720 cattacgaga agttgaagg ttcacctgaa gatacgaac agaagcaact tttgttgag 3780 cagcacaac attatctcga cgaaatcata gagcaattt cggaattcag windowgagtc 3840 atcctagctg atgccaatct ggacaagta ttaagcgcat acaacca caggtaaaa 3900 cccatacgtg agcaggcgga aaatattatc cattgttta ctcttaccaa cctcggcgct 3960 ccagccgcat tcaagtattt tgacacaacg atagatcgca aacagtacag atctaccaag 4020 gaggtgctag acgcgacact gattcaccaa tccatcacgg gattatatga aactcggata 4080 gatttgtcac agcttggggg tgacggatcc cccaagaaga agaggaaagt ctcgagcgac 4140 tacaaagacc atgacggtga ttataaagat catgacatcg attacaagga tgacgatgac 4200 aagtga 4206 <210> 279 <211> 422 <212> DNA <213> Artificial Sequence <220> <221> gene <222> (1)..(422) <223> Description of artificial sequence: Synthetic polynucleotide <400> 279 tgtacaaaaa agcaggcttt aaaggaacca attcagtcga ctggatccgg taccaaggtc 60 gggcaggaag agggcctatt tcccatgatt ccttcatatt tgcatatacg atacaaggct 120 gttagagaga taattagaat taatttgact gtaaacacaa agatattagt acaaaatacg 180 tgacgtagaa agtaataatt tcttgggtag tttgcagttt taaaattatg ttttaaaatg 240 gactatcata tgcttaccgt aacttgaaag tatttcgatt tcttggcttt atatatcttg 300 tggaaaggac gaaacaccgg agacgattaa tgcgtctccg ttttagagct agaaatagca 360 agttaaaata aggctagtcc gttatcaact tgaaaaagtg gcaccgagtc ggtgcttttt 420 tt 422

Claims

1. An isolated Staphylococcus aureus Cas9 (SaCas9) protein, the amino acid sequence of which is any one of the following mutations in the amino acid sequence shown in SEQ ID NO: 2: Y211A, Y212A, W229A, Y230A, R245A, T392A and / or Y651A, and the protein optionally comprises one or more of a nuclear localization sequence, a cell penetrating peptide sequence, and / or an affinity tag.

2. The isolated protein of claim 1, further comprising one or more of the following mutations: N419A, L446A, R654A, R499A / Q500A and / or R499A / Q500A / R654A / G655A.

3. The isolated protein of claim 1 or claim 2, comprising one of the following mutation sets: Y211A / R654A, Y211A / Y212A, Y211A / Y230A, Y211A / R245A, Y212A / Y230A, Y212A / R245A, Y230A / R245A, W229A / Y230A, W229 A / R654A, Y211A / Y212A / Y230A, Y211A / Y212A / R245A, Y211A / Y212A / Y651A, Y211A / Y230A / R245A, Y211A / Y230A / Y651A, Y211A / R245A / Y651A, Y211A / R245A / R654A, Y21 1A / R245A / N419A, Y211A / N419A / R654A, Y212A / Y230A / R245A, Y212A / Y230A / Y651A , Y212A / R245A / Y651A, Y230A / R245A / Y651A, R245A / N419A / R654A, T392A / N419A / R6 54A, R245A / T392A / N419A / R654A, Y211A / R245A / N419A / R654A, W229A / R245A / N419A / R654A, Y211A / R245A / T392A / N419A / R654A, or Y211A / W229A / R245A / N419A / R654A.

4. The isolated protein of claim 1, further comprising one or more mutations selected from the group consisting of: (i) D10A or D10N, and / or (ii) H557A, H557N, or H557Y, and / or (iii) N580A, and / or (iv)D556A.

5. A fusion protein comprising the isolated protein as described in any one of claims 1 to 4 fused to a heterologous functional domain using an optional intervening linker, wherein the linker does not interfere with the activity of the fusion protein. The fusion protein of claim 5 , wherein the heterologous functional domain is a transcriptional activation domain. The fusion protein of claim 6 , wherein the transcriptional activation domain is from VP64 or NF-κB p65. The fusion protein of claim 5 , wherein the heterologous functional domain is a transcriptional silencer or a transcriptional repressor domain.

9. The fusion protein of claim 8, wherein the transcriptional repression domain is a Kluybel-associated box (KRAB) domain, an ERF repressor domain (ERD), or a mSin3A interaction domain (SID).

10. The fusion protein of claim 8, wherein the transcriptional silencer is heterochromatin protein 1 (HP1). The fusion protein of claim 10 , wherein the transcriptional silencer is HP1α or HP1β.

12. The fusion protein of claim 5, wherein the heterologous functional domain is an enzyme that modifies the methylation status of DNA.

13. The fusion protein of claim 12, wherein the enzyme that modifies the methylation state of DNA is DNA methyltransferase (DNMT) or TET protein. The fusion protein of claim 13 , wherein the TET protein is TET1. The fusion protein of claim 5 , wherein the heterologous functional domain is an enzyme that modifies a histone subunit.

16. The fusion protein of claim 15, wherein the enzyme that modifies the histone subunit is a histone acetyltransferase (HAT), a histone deacetylase (HDAC), a histone methyltransferase (HMT) or a histone demethylase.

17. The fusion protein of claim 5, wherein the heterologous functional domain is a biological tether.

18. fusion rotein as claimed in claim 17, wherein this biological tether is MS2, Csy4 or λ N albumen.

19. The fusion protein of claim 17, wherein the heterologous functional domain is FokI.

20. An isolated nucleic acid encoding the protein of any one of claims 1-4.

21. A vector comprising the isolated nucleic acid of claim 20, optionally operably linked to one or more regulatory domains to express the protein of any one of claims 1-4.

22. A host cell comprising the nucleic acid of claim 20.

23. The host cell of claim 22, wherein the cell is a mammalian host cell.

24. The host cell of claim 22, wherein the cell expresses the protein of any one of claims 1-4.

25. An ex vivo or in vitro method for altering the genome or epigenome of a cell, the method comprising expressing in the cell an isolated protein as described in any one of claims 1 to 4 or expressing a fusion protein as described in any one of claims 5 to 19, and a guide RNA having a region complementary to a selected portion of the genome of the cell, or contacting the cell with the isolated protein or with the fusion protein and the guide RNA.

26. The method of claim 25, wherein the isolated protein or fusion protein comprises one or more of a nuclear localization sequence, a cell penetrating peptide sequence and / or an affinity tag.

27. The method of claim 25, wherein the cell is a stem cell.

28. The method of claim 27, wherein the stem cell is a mesenchymal stem cell or an induced pluripotent stem cell.

29. An ex vivo or in vitro method for altering a double-stranded DNA (dsDNA) molecule, the method comprising contacting the dsDNA molecule with an isolated protein as described in any one of claims 1-4 or a fusion protein as described in any one of claims 5-19, and a guide RNA having a region complementary to a selected portion of the dsDNA molecule.

30. Use of the isolated protein of any one of claims 1 to 4 or the isolated fusion protein of any one of claims 5 to 19 in a method of altering a double-stranded DNA (dsDNA) molecule, the method comprising contacting the dsDNA molecule with the isolated protein or with the fusion protein, and a guide RNA having a region complementary to a selected portion of the dsDNA molecule.

Images