miRNA-211 and H 2 S-synergistically triggered 3D DNA network structure and its preparation method and application

Abstract

The present invention discloses a 3D DNA network structure synergistically triggered by miRNA-211 and H2S, and a preparation method and application thereof. The 3D DNA network structure includes a DNA-cube framework, Ag NPs, and a long double-stranded DNA track formed by miRNA-211 as a triggering chain; wherein the Ag NPs are embedded in the DNA-cube framework and self-assemble with the long double-stranded DNA track to form a network structure. Compared with the prior art, the structure described in the present invention first proposes the application of miRNA-211 and H2S as a biomarker group for detecting CRC, with a detection range of 0.05-10μM for H2S and a LOD as low as 4.78nM, and is successfully applied to human colon cancer HCT 116 cell imaging, realizing rapid analysis and detection of H2S and CRC cell imaging, with good specificity and practicality. This method provides a new strategy with high sensitivity and strong specificity for early diagnosis and tracking of CRC.

Description

Technical Field

[0001] The present invention belongs to the technical field of biomarker group detection, and relates to a detection system for early screening of CRC, specifically a 3D DNA network structure synergistically triggered by miRNA-211 and H2S, and a preparation method and application thereof. Background Art

[0002] Colorectal cancer (CRC) is one of the deadliest malignancies in the world. It is characterized by high morbidity and mortality, making it a serious public health threat. CRC is believed to originate from intestinal polyps or benign tumors, and early screening and diagnosis can significantly reduce the occurrence of CRC. Currently, several common screening methods, such as colonoscopy and DNA testing, have been used in clinical practice. However, as an invasive examination method, colorectal endoscopy not only requires professional instruments and experienced experts to operate, but also has the risk of damaging cells and causing cancer to worsen. Although DNA testing has a high detection rate for advanced tumors, it cannot detect early polyps, resulting in missed diagnosis and delayed diagnosis. Therefore, there is an urgent need to develop a non-invasive and accurate CRC early screening sensor detection method.

[0003] MicroRNA (miRNA) is a promising biomarker that is closely related to human cancers. Many cancer screening methods based on miRNA detection, including CRC, have been widely established. However, the directivity and targeting ability of miRNA to specific tumors are still uncertain. It has been reported that more than a dozen miRNAs are abnormally expressed in CRC cells. On the other hand, one abnormally expressed miRNA may indicate multiple cancers. Therefore, it is difficult to achieve specific screening of CRC using only miRNA as a marker. Newer markers, especially markers with greater specificity for CRC, should be developed in combination with miRNA to improve the accuracy and directivity of CRC screening.

[0004] It is worth noting that recent studies have confirmed that endogenous hydrogen sulfide (H2S) plays an important role in various biological metabolic processes in the human body. H2S is abnormally expressed in Alzheimer's disease, hyperlipidemia, diabetes, and even in tumor microenvironment examinations. Increasing evidence shows that endogenous H2S is a key factor in CRC metabolism. Abnormal expression of cysteine-β-synthase (CBS) produces high levels of H2S gas, leading to increased H2S content in CRC tissues. Therefore, H2S has a strong correlation with colorectal cancer and can be used as a biomarker for CRC-specific detection. In summary, the combination of H2S and miRNA into a specific biomarker panel is helpful for the precise pointing and analysis of CRC. However, the existing detection technology also has certain limitations for the detection requirements of the combined biomarker panel, such as complex detection process, cumbersome analysis process, lack of correlation between markers, etc. Developing a stable, reliable, and collaborative combined biomarker panel (miRNA and H2S) for efficient detection is an increasing challenge.

[0005] DNA nanotechnology, as a promising technology, can obtain ideal target structures at the nanoscale, providing efficient and precise control advantages for sensing and manufacturing systems. Three-dimensional (3D) DNA frameworks have excellent properties of precise directional positioning and highly ordered arrangement. At the same time, DNA origami, as a molecular scaffold capable of building higher-order structures, exhibits excellent positioning addressability and structural stability. It is reported that DNA origami has the potential to solve the defects of traditional biosensor systems, such as low signal intensity and low sensitivity. Therefore, the application of DNA origami to the combined biomarker pair system will be helpful for the detection of CRC. Summary of the invention

[0006] Technical problem to be solved: In order to overcome the shortcomings of the existing technology, obtain a non-invasive and accurate CRC early screening sensor detection system, while improving the accuracy and directionality of the detection system; and develop a stable and reliable combined biomarker group and achieve efficient detection; in view of this, the present invention provides a 3D DNA network structure synergistically triggered by miRNA-211 and H2S, and a preparation method and application thereof.

[0007] Technical solution: A 3D DNA network structure synergistically triggered by miRNA-211 and H2S, the 3D DNA network structure includes a DNA-cube framework, Ag NPs and a long double-stranded DNA track formed by miRNA-211 as a triggering chain, and the mixing volume ratio of 10nM DNA-cube framework, 7.8ppm Ag NPs and 300nM long double-stranded DNA track is 1:1:40; wherein, Ag NPs are embedded in the DNA-cube framework and self-assemble with the long double-stranded DNA track to form a network structure. Wherein, the sequence of miRNA-211 is (SEQ ID NO.150): UUCCCUUUGUCAUCCUUCGCCU.

[0008] The method for preparing the 3D DNA network structure synergistically triggered by miRNA-211 and H2S comprises the following steps:

[0009] S1. Preparation of Ag NP / ssDNA complex

[0010] NaBH4 was dissolved in ice ultrapure water, and AgNO3 solution was slowly added under magnetic stirring. After the reaction stopped, the mixture was centrifuged and washed with water to obtain Ag NPs. ssDNA was mixed with Ag NPs, and oscillation and standing were performed alternately. Then, the standing time was continued for 4 hours for incubation. After the incubation, NaCl was added gradually to make the final concentration of NaCl in the system reach 0.3M, and the mixture was aged at room temperature for 12 hours. After centrifugation, the mixture was washed with 0.1M PBS to form an Ag NP / ssDNA complex. The sequence of ssDNA was:

[0011] SEQ ID NO.3, ssDNA: 5'-GTAGAGTATGAAGTGATGGAT-SH C3-3';

[0012] S2. Preparation of DNA-cube framework

[0013] M13 mp18 DNA was mixed with the staple chain and followed a certain annealing process: 95℃-70℃, 5℃ for each gradient, each gradient was maintained for 5 minutes; 70℃-50℃, 2℃ for each gradient, each gradient was maintained for 10 minutes; 50℃-20℃, 1℃ for each gradient, each gradient was maintained for 15 minutes, to form a DNA-cube framework; wherein the staple chain sequence is shown in Table 1:

[0014] Table 1 Staple chain sequence information

[0015]

[0016]

[0017]

[0018]

[0019]

[0020]

[0021] S3. Preparation of long double-stranded DNA tracks

[0022] Two hairpin DNAs, HP1, SEQ ID NO.1, HP2, SEQ ID NO.2, were heated at 95°C for 5 min, slowly cooled to room temperature, miRNA-211 was added to an equal amount of HP1 and HP2 mixed solution, and reacted in a 37°C water bath for 2 h to trigger the HCR reaction to form a long double-stranded DNA track; wherein the sequences of the two hairpin DNAs are:

[0023] HP1, SEQ ID NO.1:

[0024] 5'-GGGGGGGGGGAGGCGAAGGATGACAAAGGGAACAAAGTTTCCCTTTGTCATCCTATTTTTTTTTTTTTT-3';

[0025] HP2, SEQ ID NO.2:

[0026] 5'-TTTTTTTTTTTTTTCCCTTTGTCATCCTTCGCCTAGGATGACAAAGGGAAACTTTG-3';

[0027] S4. Preparation of 3D DNA network structure

[0028] The Ag NP / ssDNA complex was dissolved in the DNA-cube framework and then mixed with an equal volume of the HCR reaction solution in S3 to construct a 3D DNA network structure in a PCR instrument. The annealing program was as follows: 25°C, 10s; 35°C, 10s; 40°C, 1min; 45°C, 10min; 40°C, 1h; 35°C, 1h; 30°C, 1h; 25°C, 1h; 20°C, 1h; 15°C, 1h; 10°C, 1h; 4°C, 1h;

[0029] S5. Isolation of 3D DNA network structure

[0030] A quartz rod modified with DNA 1 was used to extract the 3D DNA network structure from the reaction system. The quartz rod was cut into 1.5 cm pieces, immersed in the DNA 1 solution, and vortexed for at least 2 hours; then transferred to the DNA 2 solution, incubated in a 37°C water bath for 1 hour, and the resulting solution was stored at 4°C. The sequences of DNA 1 and DNA 2 are:

[0031] SEQ ID NO.148, DNA 1:

[0032] 5'-CCCCCCCCCCAGTTAGACCACCTC-COOH-3';

[0033] SEQ ID NO.149, DNA 2:

[0034] 5'-GAGGTGGTCTAACTGGGGGGGGGG-3'.

[0035] Preferably, the concentration of the NaBH4 aqueous solution in S1 is 4 mM, the molar ratio of NaBH4 and AgNO3 is 1:1, and the volume ratio of 500 nM ssDNA and 7.8 ppm Ag NPs mixed is 2:1.

[0036] Preferably, the concentration of ssDNA in S1 is 500 nM; PBS is 0.1 M, including 0.1 M NaCl, 10 mM phosphate.

[0037] Preferably, the reaction time of dropping the AgNO3 solution in S1 is 10 min, and the centrifugation condition is 8000 rpm for 5 min; the ssDNA and Ag NPs are mixed and then shaken for 5 min, left to stand for 25 min, and the above shaking is repeated before being left to stand for incubation.

[0038] Preferably, the molar ratio of the M13 mp18 DNA to the staple strand in S2 is 1:10.

[0039] Preferably, the molar ratio of miRNA-211, HP1 and HP2 in S3 is 3:10:10.

[0040] Preferably, the molar ratio of DNA 1 to DNA 2 in S5 is 1:1.

[0041] The above-mentioned 3D DNA network structure synergistically triggered by miRNA-211 and H2S is used as a detection system for early screening of CRC.

[0042] Preferably, the detection range of the structure for H2S is 0.05-10 μM, and the LOD is as low as 4.78 nM.

[0043] The working principle of the 3D DNA network structure synergistically triggered by miRNA-211 and H2S as a detection system for early screening of CRC described in the present invention is as follows: First, a DNA-cube is constructed by DNA origami, and the cavity is combined with anchor-modified AgNPs to form an Ag NP@DNA-cube. Secondly, miRNA-211 acts as a triggering chain and undergoes HCR reaction with HP1 and HP2 to form a long double-stranded DNA track. Subsequently, the Ag NP@DNA-cubes are tethered to the long DNA track to form an ordered 3D DNAnetwork structure. In the presence of H2S, the Ag NPs embedded in the 3D DNA network are etched into Ag2S quantum dots with fluorescent signals for in situ imaging of cancer cells in CRC.

[0044] Beneficial effects: The structure of the present invention first proposed the use of miRNA-211 and H2S as a biomarker group for detecting CRC, with a detection range of H2S of 0.05-10μM and a LOD as low as 4.78nM, and was successfully applied to human colon cancer HCT 116 cell imaging, achieving rapid analysis and detection of H2S and CRC cell imaging, with good specificity and practicality. This method provides a new strategy with high sensitivity and strong specificity for early diagnosis and tracking of CRC. BRIEF DESCRIPTION OF THE DRAWINGS

[0045] Figure 1 Diagram of the in situ fluorescence imaging mechanism based on 3D DNA network in HCT 116 cells.

[0046] Figure 2 Schematic diagram of the process of extracting 3D DNA network using quartz rods.

[0047] Figure 3 (a) TEM image of Ag NPs; TEM images of Ag NPs after incubation with (b) 1μM, (c) 10μM, and (d) 1mM Na2S; (e) TEM image of DNA-cube; (f)-(g) TEM images of Ag NP@DNA-cube; (h) TEM image of 3D DNA network.

[0048] Figure 4 (a) Fluorescence spectrum of the 3D DNA network after reacting with different concentrations of H2S simulant (Na2S); (b) The calibration curve and linear range (inset) of the 3D DNA network's response to different concentrations of H2S simulant.

[0049] Figure 5The ability of different materials to image intracellular H2S fluorescence under complex physiological environments was investigated. Fluorescence micrographs of HCT 116 cells after incubation with PBS, Ag NPs, Ag NP@DNA-cube, and 3D DNA network for 12 h. Scale bar: 100 μm.

[0050] Figure 6 (a) Fluorescence micrographs of HCT 116 cells incubated with PBS, 0.5 mM, 1 mM, and 2 mM aminooxyacetic acid (AOAA) for 12 h; (b) Fluorescence micrographs of HCT 116 cells incubated with PBS, 1 nM, 1 μM, and 1 mM miRNA-211 for 12 h; (c) Standard curve of miRNA-211 content and mean gray value. Scale bar: 100 μm.

[0051] Figure 7 (a) Fluorescence micrographs of 3D DNA network after incubation with HCT 116, Hela, and H8 cells; (b) MTT assay to assess the viability of HCT 116 cells after incubation with PBS, Ag NPs, Ag NP@DNA-cube, and 3D DNA network for 24 h (%). Scale bar: 100 μm. DETAILED DESCRIPTION

[0052] The following examples further illustrate the content of the present invention, but should not be construed as limiting the present invention. Without departing from the spirit and essence of the present invention, modifications and substitutions made to the method, steps or conditions of the present invention all belong to the scope of the present invention. Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art.

[0053] Example 1

[0054] The 3D DNA network structure synergistically triggered by miRNA-211 and H2S was prepared by the following method:

[0055] (1) Weigh 0.72 mg NaBH4 and dissolve it in 5 mL ice-cold ultrapure water. Under magnetic stirring, slowly add 4 mM AgNO3 solution to it to make the final volume 10 mL. Stop the reaction after 10 minutes, centrifuge at 8000 rpm for 5 minutes, and wash with water twice. Take 500 nM ssDNA and mix it with the Ag NPs prepared above, oscillate for 5 minutes, let it stand for 25 minutes, repeat the above oscillation, and let it stand for 4 hours. After the incubation, gradually add NaCl to make the final concentration of NaCl in the system reach 0.3 M. Aging at room temperature for 12 hours. After centrifugation, wash with 0.1 M PBS (0.1 M NaCl, 10 mM phosphate) to form an Ag NP / ssDNA complex.

[0056] (2) M13 mp18 DNA was mixed with hundreds of staple chains at a concentration of 1:10 and followed a certain annealing process: 95℃-70℃, 5℃ as a gradient, each gradient was maintained for 5 minutes; 70℃-50℃, 2℃ as a gradient, each gradient was maintained for 10 minutes; 50℃-20℃, 1℃ as a gradient, each gradient was maintained for 15 minutes. The whole process lasted about 10 hours to form a DNA-cube.

[0057] (3) 1 μM HP1 and HP2 were heated at 95°C for 5 min and slowly cooled to room temperature. 50 μL of 300 nM miRNA-211 was added to the HP1 and HP2 mixed solution and reacted in a 37°C water bath for 2 h to trigger the HCR reaction to form long double-stranded DNA tracks.

[0058] (4) The Ag NP / ssDNA complex was dissolved in DNA-cube and then mixed with an equal volume of HCR reaction solution to construct a 3D DNA array. The annealing program was as follows: 25℃, 10s; 35℃, 10s; 40℃, 1min; 45℃, 10min; 40℃, 1h; 35℃, 1h; 30℃, 1h; 25℃, 1h; 20℃, 1h; 15℃, 1h; 10℃, 1h; 4℃, 1h.

[0059] (5) In order to separate the formed 3D DNA array from the unreacted DNA-cube monomers, a quartz rod modified with DNA 1 was used to extract the 3D DNA network from the reaction system. The quartz rod was cut into 1.5 cm pieces and immersed in a 500 nM DNA 1 solution and vortexed for at least 2 h. The quartz rod was transferred to a 500 nM DNA 2 solution and incubated in a 37°C water bath for 1 h. The resulting solution was stored at 4°C.

[0060] Example 2

[0061] The structure prepared in Example 1 was used to detect the content of endogenous H2S in HCT 116 cells. The specific method is as follows:

[0062] (1) In vitro detection of H2S was completed in a 0.5 mL brown centrifuge tube. 20 μL of 3D DNA network was added to the brown centrifuge tube, and then 20 μL of Na2S solution of different concentrations was added as a H2S simulant. After the two were fully mixed for 6 minutes, 2.0 μL was transferred to the fluorescence spectrophotometer using a pipette.

[0063] (2) In the in situ cell imaging experiment, 20uL of 3D DNA network was added to the cell culture dish and incubated for 12h before being photographed under an inverted fluorescence microscope.

[0064] To evaluate the application of the established 3D DNA network in colorectal cancer cells, the endogenous H2S content in HCT116 cells was measured. 5 Each cell was immersed in a cell lysis solution (20 mM EDTA·2Na, 100 mM Tris-HCl, 0.8 (w / v) SDS, pH=8.0), then centrifuged, and the supernatant was reacted with the 3D DNA network, and the H2S content in the HCT 116 cells was determined by fluorescence spectroscopy. The test results are shown in Table 2.

[0065] Table 2 Determination of H2S content in HCT 116 cells by fluorescence spectroscopy

[0066]

[0067]

[0068] a Relative recovery rate = (total concentration - blank concentration) / spike concentration

[0069] Result analysis:

[0070] As a proof-of-concept experiment, we synthesized Ag NPs with a particle size of approximately 24.4 nm. Figure 3 As shown in (a), Na2S was selected as a mimic of endogenous H2S in cells, and the reaction between Ag NPs and endogenous H2S was studied. Figure 3 (b)-(d) show the TEM images of Ag NPs after incubation with 1μM, 10μM, and 1mM Na2S, from which it can be seen that the degree of etching of Ag NPs gradually increases and the particle size changes significantly. Figure 3 (e)-(h) are TEM images of DNA-cube, Ag NP@DNA-cube (scale bars are 200nm and 100nm) and 3D DNA network, respectively.

[0071] In order to study the analytical detection performance of the proposed 3D DNA network for H2S, fluorescence intensity detection was carried out using Na2S aqueous solutions of different concentrations (0.01μM, 0.05μM, 0.1μM, 0.5μM, 1μM, 5μM, 10μM, 30μM, 50μM, 100μM) under optimized conditions. Figure 4 (a) is the fluorescence spectrum of the 3D DNA network after reacting with different concentrations of Na2S. Figure 4(b) is the calibration curve of the 3D DNA network response to different concentrations of H2S simulants detected by a fluorescence spectrophotometer, with a linear range of 0.05-10 μM. According to LOD=3δ0 / k (δ0 is the standard deviation of the blank sample, k is the slope of the calibration curve), LOD=4.78 nM is obtained.

[0072] We investigated the ability of 3D DNA network to image intracellular H2S fluorescence in complex physiological environments. PBS, Ag NPs, Ag NP@DNA-cube and 3D DNA network were added to HCT 116 cells and incubated for 12 hours. Figure 5 As shown. No red fluorescence was observed in HCT 116 cells added with PBS, weak red fluorescence was observed in HCT 116 cells added with Ag NPs, and the red fluorescence intensity observed in cells added with Ag NP@DNA-cube was stronger than that in the previous group. This is because the coating of DNA-cube increased the biocompatibility of Ag NPs and promoted the imaging of Ag NPs through the cell membrane in HCT 116 cells. Compared with the first three groups, HCT 116 cells incubated with 3D DNA network showed significantly enhanced red fluorescence. This is because 3D DNA network can evenly arrange Ag NPs, avoiding the low yield of Ag2S quantum dots due to the aggregation of Ag NPs.

[0073] The effect of H2S concentration on the imaging of 3D DNA network in HCT 116 cells was investigated. AOAA is a CBS inhibitor and thus can inhibit the production of endogenous H2S. The results after HCT 116 cells were incubated with different levels (0.5mM, 1mM, 2mM) of AOAA are shown in Figure 2. Figure 6 (a) As shown. In the blank control group, the red fluorescence intensity in the cells was high, and as the concentration of AOAA increased, the H2S content decreased, so the red fluorescence intensity in HCT 116 cells decreased. It can be concluded that the 3D DNA network constructed by the colorectal cancer collaborative marker group (miRNA-211+H2S) has a good fluorescence response to CRC cells and is successfully used for in situ fluorescence imaging of HCT 116 cells.

[0074] By controlling the content of miRNA-211, we explored its effect on the 3D DNA network cell imaging ability. Figure 6As shown in (b), 100 μL of miRNA-211 of different concentrations (1 nM, 1 μM, 1 mM) was added to HCT 116 cells for incubation, and then the raw materials for forming 3D DNA network (Ag NP@DNA-cube, HP1, HP2) were added. The miRNA-211 content in HCT 116 cells is usually 16 times higher than that in normal cells. In the control group, the overexpressed miRNA-211 in HCT 116 cells opened HP1 and HP2 as the initiator chain to undergo HCR, and then assembled with Ag NP@DNA-cube to form a 3D DNA network, which was etched by endogenous H2S into Ag2S quantum dots with red fluorescence properties. In the other three groups of experiments with additional addition of miRNA-211, the fluorescence intensity in the cells increased with the concentration of miRNA-211 added, which can be attributed to the effect of miRNA-211 on the number of 3D DNA networks formed. The more miRNA-211, the more HCR long double-stranded products will be produced, thus forming more 3DDNA networks. The fluorescence intensity in each group of fluorescence micrographs was converted into the average gray value by using ImageJ software, thereby achieving the quantification of the concentration of miRNA-211 in HCT 116 cells. Figure 6 (c) The average gray value of the image is proportional to the logarithm of the miRNA-211 concentration, and the content of miRNA-211 in HCT 116 cells was calculated to be 0.238 pM.

[0075] Since the specificity of 3D DNA network imaging mainly comes from the high expression of endogenous H2S in CRC cells, we selected human cervical cancer (Hela) cells and normal cervical (H8) cells as control groups to investigate the specificity of 3D DNA network in diagnosing CRC. Figure 7 (a) shows the fluorescence micrographs of three different cell groups incubated with the 3D DNA network under the same conditions. Among the three groups of cells, only HCT 116 cells expressed strong red fluorescence, which confirmed that the 3D DNA network has good selectivity for CRC cells.

[0076] Next, we evaluated the cytotoxicity of the 3D DNA network. The MTT assay was used to evaluate the cytotoxicity of the 3D DNA network. Figure 7As shown in (b), after incubation with HCT 116 cells for 24 h, the cell viability of the Ag NPs group and Ag NP@DNA-cube group was 50% and 55%, respectively, while the cell viability of the 3D DNA network group was higher, about 87%, indicating that the 3D DNA network is a live cell imaging probe with low cytotoxicity and good biocompatibility. Sequence Listing <110> Jiangsu University of Science and Technology <120> 3D structure synergistically triggered by miRNA-211 and H2S and its preparation method and application <160> 150 <170> SIPOSequenceListing 1.0 <210> 1 <211> 69 <212> DNA <213> Artificial Sequence <400> 1 gggggggggg aggcgaagga tgacaaaggg aacaaagttt ccctttgtca tcctattttt 60 ttttttttt 69 <210> 2 <211> 59 <212> DNA <213> Artificial Sequence <400> 2 tttttttttt ttttattccc tttgtcatcc ttcgcctagg atgacaaagg gaaactttg 59 <210> 3 <211> twenty one <212> DNA <213> Artificial Sequence <400> 3 gtagagtatg aagtgatgga t 21 <210> 4 <211> 30 <212> DNA <213> Artificial Sequence <400> 4 taaatattga cggaaaattg aggttgtcac 30 <210> 5 <211> 30 <212> DNA <213> Artificial Sequence <400> 5 ccgaacaaag ttaccaaaaa gtataagccc 30 <210> 6 <211> 30 <212> DNA <213> Artificial Sequence <400> 6 tgaatcggcc aacgcggtgc cagaatgagt 30 <210> 7 <211> 30 <212> DNA <213> Artificial Sequence <400> 7 aatcgtaaaa ctagcaagaa tcggggtagc 30 <210> 8 <211> 30 <212> DNA <213> Artificial Sequence <400> 8 agaagccttt atttcagtaa tacgcaaaat 30 <210> 9 <211> 30 <212> DNA <213> Artificial Sequence <400> 9 attgtgaatt accttaaatt tcatcagtga 30 <210> 10 <211> 30 <212> DNA <213> Artificial Sequence <400> 10 atagaaagga acaacttttc agctagcgta 30 <210> 11 <211> 30 <212> DNA <213> Artificial Sequence <400> 11 catgtaattt aggcagtatt taatgcgtta 30 <210> 12 <211> 30 <212> DNA <213> Artificial Sequence <400> 12 acgttgtaaa acgacgggttttcaagggcg 30 <210> 13 <211> 30 <212> DNA <213> Artificial Sequence <400> 13 gacttcaaat atcgcgaaga ggaaatcaaa 30 <210> 14 <211> 30 <212> DNA <213> Artificial Sequence <400> 14 caaataagaa acgattatta tttgaatctt 30 <210> 15 <211> 30 <212> DNA <213> Artificial Sequence <400> 15 gagtgaataa ccttgcataa atctcaagaa 30 <210> 16 <211> 30 <212> DNA <213> Artificial Sequence <400> 16 attgcgtaga ttttcaaaac agattgtttg 30 <210> 17 <211> 30 <212> DNA <213> Artificial Sequence <400> 17 gtccactatt aaagaaccag ttttggttcc 30 <210> 18 <211> 30 <212> DNA <213> Artificial Sequence <400> 18 cccaattctg cgaacgcata taaaatataa 30 <210> 19 <211> 30 <212> DNA <213> Artificial Sequence <400> 19 atttaccgtt ccagtaaaag cgcttgaggc 30 <210> 20 <211> 30 <212> DNA <213> Artificial Sequence <400> 20 ggcttttgca aaagaaaacc aaacaaaagg 30 <210> twenty one <211> 30 <212> DNA <213> Artificial Sequence <400> twenty one aactttttca aatataacaa agattttaac 30 <210> twenty two <211> 30 <212> DNA <213> Artificial Sequence <400> twenty two cgtactcagg aggtttggaa tagtcctcaa 30 <210> twenty three <211> 30 <212> DNA <213> Artificial Sequence <400> twenty three ccgtaatggg ataggtacaa acgaaaataa 30 <210> twenty four <211> 30 <212> DNA <213> Artificial Sequence <400> twenty four taatcaaaat caccgggttt gccgtttgcc 30 <210> 25 <211> 30 <212> DNA <213> Artificial Sequence <400> 25 agccgttttt attttctcat cgacctaatt 30 <210> 26 <211> 30 <212> DNA <213> Artificial Sequence <400> 26 agccggaacg aggcgcctgc tcccaagcgc 30 <210> 27 <211> 30 <212> DNA <213> Artificial Sequence <400> 27 atcggaacga gggtagagca gcgaaccgat 30 <210> 28 <211> 42 <212> DNA <213> Artificial Sequence <400> 28 aaaaatgagt tacagcgtct ttccagagaa tcatcatatt cc 42 <210> 29 <211> 42 <212> DNA <213> Artificial Sequence <400> 29 gaattacatt ctagaggatc cccgggtaat ccgctcacaa tt 42 <210> 30 <211> 42 <212> DNA <213> Artificial Sequence <400> 30 aagcaaagac atctgccagt ttgaggggcc gcttctggtg ag 42 <210> 31 <211> 42 <212> DNA <213> Artificial Sequence <400> 31 accccggtga gagtctacaa aggctatctc gcaagcggtc ca 42 <210> 32 <211> 42 <212> DNA <213> Artificial Sequence <400> 32 gagaagggcc tgtaccatgt accgtaaccc accctccacc ct 42 <210> 33 <211> 42 <212> DNA <213> Artificial Sequence <400> 33 tgaatattat caaaataatg gaagggttgc gcctgtttat ca 42 <210> 34 <211> 42 <212> DNA <213> Artificial Sequence <400> 34 cctaccaaca gtaatataaa gtaccgacaa tgcagaacgc tc 42 <210> 35 <211> 42 <212> DNA <213> Artificial Sequence <400> 35 gattataata agtccaacat gttcagctaa aaggtcgtca ga 42 <210> 36 <211> 42 <212> DNA <213> Artificial Sequence <400> 36 cctgataccg aactcaccga cttgagccgg ccggaaacgt cg 42 <210> 37 <211> 42 <212> DNA <213> Artificial Sequence <400> 37 aaacgcactt accggaaaca atgaaatata caccatcaat at 42 <210> 38 <211> 42 <212> DNA <213> Artificial Sequence <400> 38 taccgcggta ttaaaaccaa tcaataattc gccttaaatc aa 42 <210> 39 <211> 42 <212> DNA <213> Artificial Sequence <400> 39 taataatttg ctaatgtcgt ctttccagat gcttgatacc ga 42 <210> 40 <211> 42 <212> DNA <213> Artificial Sequence <400> 40 gaaacaaagc agcaattacc attagcaaat ttgggcaatc at 42 <210> 41 <211> 42 <212> DNA <213> Artificial Sequence <400> 41 aggtcagaaa cacttacgaa ggcaccaagg aagtttacat gg 42 <210> 42 <211> 42 <212> DNA <213> Artificial Sequence <400> 42 cattgccttg ataaccaggg tggtttttga gagagttgca ac 42 <210> 43 <211> 42 <212> DNA <213> Artificial Sequence <400> 43 taagcaagaa acgctagcaa acgtagaaga actgggataa aa 42 <210> 44 <211> 42 <212> DNA <213> Artificial Sequence <400> 44 atattcgtct gaaaccgtat aaacagttat aagtttacag ag 42 <210> 45 <211> 42 <212> DNA <213> Artificial Sequence <400> 45 taaagtaaga tacacagtca ggacgttggt agaaagattc ac 42 <210> 46 <211> 42 <212> DNA <213> Artificial Sequence <400> 46 agaacggccc aatagcaagc ctccctcaca cttatcattc ca 42 <210> 47 <211> 42 <212> DNA <213> Artificial Sequence <400> 47 tgctgtatac cacacaacat tattacagggg aagaattagt tt 42 <210> 48 <211> 42 <212> DNA <213> Artificial Sequence <400> 48 cagaaccggg ttgattagcg gggttttgta caccagtaca aa 42 <210> 49 <211> 42 <212> DNA <213> Artificial Sequence <400> 49 gaaatcgaat atcaaattaa ctgaacacag aataatccaa cg 42 <210> 50 <211> 42 <212> DNA <213> Artificial Sequence <400> 50 cagtaatggg cttaagtata aagccaacag gcgaattatt ca 42 <210> 51 <211> 42 <212> DNA <213> Artificial Sequence <400> 51 atcttcttga tgcagggtta tataactact cagtaccagg cc 42 <210> 52 <211> 42 <212> DNA <213> Artificial Sequence <400> 52 ataaggccca ataactgaaa aggtggcaaa taaccttaag aa 42 <210> 53 <211> 42 <212> DNA <213> Artificial Sequence <400> 53 aagggaaaat tgtgcggaga tttgtatcag caccaatgaa ac 42 <210> 54 <211> 42 <212> DNA <213> Artificial Sequence <400> 54 tgggattttt ttcacgttga aaatgtttcc gaattttctg ta 42 <210> 55 <211> 42 <212> DNA <213> Artificial Sequence <400> 55 gagtagtatt atactttcgc aaatggtctc aattctacta ac 42 <210> 56 <211> 42 <212> DNA <213> Artificial Sequence <400> 56 tcaaagcgcg gattcctgac tattatagtt catcaacatt ta 42 <210> 57 <211> 42 <212> DNA <213> Artificial Sequence <400> 57 gagctaaagc tcataacgtt aatattttaa aacagaggcg gt 42 <210> 58 <211> 42 <212> DNA <213> Artificial Sequence <400> 58 ttcgcgtcca ttcgccagct ttccggcaac gacgagtgta ga 42 <210> 59 <211> 42 <212> DNA <213> Artificial Sequence <400> 59 aacagtaaag agaacagtac cttttacaaa tcgcgcagag aa 42 <210> 60 <211> 42 <212> DNA <213> Artificial Sequence <400> 60 ccggaacggt catagtagcg cgttttcacg gctgtctttc cc 42 <210> 61 <211> 42 <212> DNA <213> Artificial Sequence <400> 61 gctattacttttttcattta acaatttcca gctggcgaaa aa 42 <210> 62 <211> 42 <212> DNA <213> Artificial Sequence <400> 62 taaccctgta aaatctccaa aaaaaaggat ttcttaaaca ca 42 <210> 63 <211> 42 <212> DNA <213> Artificial Sequence <400> 63 ctggctcaaa ttgggacgag aaacaccaca atagtagtag ca 42 <210> 64 <211> 42 <212> DNA <213> Artificial Sequence <400> 64 tcggttggaa ccctcggaat acccaaaaaa tacatacata aa 42 <210> 65 <211> 42 <212> DNA <213> Artificial Sequence <400> 65 cttttgatcc tcatgccttg atattcactt gaggcaaaag aa 42 <210> 66 <211> 42 <212> DNA <213> Artificial Sequence <400> 66 tagctatata ataacatata ttttaaatag acagtcaaat aa 42 <210> 67 <211> 42 <212> DNA <213> Artificial Sequence <400> 67 taaatgcgaa ccgccaccct cagagccaac tgagtttcgt tg 42 <210> 68 <211> 42 <212> DNA <213> Artificial Sequence <400> 68 accaacgcag atgaagaaac caccagaatt taaaataacg tc 42 <210> 69 <211> 42 <212> DNA <213> Artificial Sequence <400> 69 ccaaagatca ccgtgaccaa ctttgaaaca agagtaatct cg 42 <210> 70 <211> 42 <212> DNA <213> Artificial Sequence <400> 70 tacgagctgc tattcctccc gacttgcgtt atccggaatc at 42 <210> 71 <211> 42 <212> DNA <213> Artificial Sequence <400> 71 cattttccgc aaatcagata tagaaggcgg aggttttgaa gg 42 <210> 72 <211> 42 <212> DNA <213> Artificial Sequence <400> 72 atcggtgcgg aagctgtgtg aaattgttcc gagctccaag ct 42 <210> 73 <211> 42 <212> DNA <213> Artificial Sequence <400> 73 ggtaatacgt ttacgtaaga gcaacactac gttagtaaat ct 42 <210> 74 <211> 42 <212> DNA <213> Artificial Sequence <400> 74 atttgccaaa atagaccgtc tatcaaatgg agcggaatta ga 42 <210> 75 <211> 42 <212> DNA <213> Artificial Sequence <400> 75 tttagcgcca ccagaccctc agagccgcga gccgcgccac ca 42 <210> 76 <211> 42 <212> DNA <213> Artificial Sequence <400> 76 tatttttttg cccccaccgc ctggccctct tttcacatat gt 42 <210> 77 <211> 42 <212> DNA <213> Artificial Sequence <400> 77 atttttatac caaatcagag cataaagcgc aaggtggcaa ca 42 <210> 78 <211> 42 <212> DNA <213> Artificial Sequence <400> 78 acgatctgcc gacatgcttt cgaggtgact ccaaattgcg aa 42 <210> 79 <211> 42 <212> DNA <213> Artificial Sequence <400> 79 aatcaatatt accctggctg accttcatga ggacattaaa gg 42 <210> 80 <211> 42 <212> DNA <213> Artificial Sequence <400> 80 aataataaac cgttgtgaga aaggccgggc aatgcaccga gg 42 <210> 81 <211> 42 <212> DNA <213> Artificial Sequence <400> 81 tgggcgcccc gtcgtcctgt agccagcttc ccggaaacca gg 42 <210> 82 <211> 42 <212> DNA <213> Artificial Sequence <400> 82 aacaaaattt atcagacgct gagaagagct tagaaaatcg tc 42 <210> 83 <211> 42 <212> DNA <213> Artificial Sequence <400> 83 tcaaagggag atagccctta taaatcaacc cagagggtaa tt 42 <210> 84 <211> 42 <212> DNA <213> Artificial Sequence <400> 84 tacaaattac ctgaatacca agttacaatc gggagttcga gc 42 <210> 85 <211> 42 <212> DNA <213> Artificial Sequence <400> 85 aggccgcgga ctaaggagtg tactggtaaa tgccccctgc ac 42 <210> 86 <211> 42 <212> DNA <213> Artificial Sequence <400> 86 aattacgttt aaactattca ttgaatccag actggcagag gg 42 <210> 87 <211> 42 <212> DNA <213> Artificial Sequence <400> 87 gcaaggcctg caggtcgact aattttcctc gggggatgtg ct 42 <210> 88 <211> 42 <212> DNA <213> Artificial Sequence <400> 88 gctttgattt tgcgaggctt gcagggagaa ctatttcgga ac 42 <210> 89 <211> 42 <212> DNA <213> Artificial Sequence <400> 89 gtcgagagcc accctcagac ctaaatttca cggataagtg cc 42 <210> 90 <211> 42 <212> DNA <213> Artificial Sequence <400> 90 ttgcgtattt ccagtaattg cgttgcgcag attaaatttt tg 42 <210> 91 <211> 42 <212> DNA <213> Artificial Sequence <400> 91 gtaacaaatc gtaaccgtga ccagaccgga aaatgtgagc ga 42 <210> 92 <211> 42 <212> DNA <213> Artificial Sequence <400> 92 aatcaggatt tttgtaattg ctccttttga agcaatcgag ct 42 <210> 93 <211> 42 <212> DNA <213> Artificial Sequence <400> 93 tgaattacaa aaggtcatat ggtttaccat tgacaagaac cg 42 <210> 94 <211> 42 <212> DNA <213> Artificial Sequence <400> 94 ctccggctaa ttaactaaata agaataaaaa tggtttaatt tc 42 <210> 95 <211> 42 <212> DNA <213> Artificial Sequence <400> 95 gaccattcgg tgtcatgttt taaatatgga atcagttgag at 42 <210> 96 <211> 42 <212> DNA <213> Artificial Sequence <400> 96 aaataaatga tacaagactttttcatgacc taaaacgaaa aa 42 <210> 97 <211> 42 <212> DNA <213> Artificial Sequence <400> 97 atagcccgcg aaaacagcct ttacagagcc tgaacaaagt ta 42 <210> 98 <211> 42 <212> DNA <213> Artificial Sequence <400> 98 tgcccgcttg ggcgtcagaa aagccccagt taaaattcgc gt 42 <210> 99 <211> 42 <212> DNA <213> Artificial Sequence <400> 99 tgcatgcgat taagcttcgc tattacgcat ttccacacaa ca 42 <210> 100 <211> 54 <212> DNA <213> Artificial Sequence <400> 100 acaatagctt ctgaattatt tgcacgtagg tttaaaaagt aattctgtcc agac 54 <210> 101 <211> 54 <212> DNA <213> Artificial Sequence <400> 101 tagtgaatta attaaatgga aacagtactt ctgtatcctt gaaaacatag cgat 54 <210> 102 <211> 54 <212> DNA <213> Artificial Sequence <400> 102 agaaccatca gactgccccc ttattagcaa ccagacaccc tcagaaccgc cacc 54 <210> 103 <211> 54 <212> DNA <213> Artificial Sequence <400> 103 agaggtctct ttacgcatca aaaagatttt ttaatactcc aacaggtcag gatt 54 <210> 104 <211> 54 <212> DNA <213> Artificial Sequence <400> 104 tagttgcaaa gtttacaact ttcaacagaa aggaaaggag cctttaattg tatc 54 <210> 105 <211> 54 <212> DNA <213> Artificial Sequence <400> 105 gatattcaga gcaaaagccc tttttaagga aggaactgag taatgtgtag gtaa 54 <210> 106 <211> 54 <212> DNA <213> Artificial Sequence <400> 106 tgattatcta acgaaaataa acagccattt ttgttgtttg agtaacatta tcat 54 <210> 107 <211> 54 <212> DNA <213> Artificial Sequence <400> 107 caaatgcagg catacagacg acgataaagt tttgcatagc gtccaatact gcgg 54 <210> 108 <211> 54 <212> DNA <213> Artificial Sequence <400> 108 ttaaatcctc acattcggga aacctgtccg gggaggaaga ttgtataagc aaat 54 <210> 109 <211> 54 <212> DNA <213> Artificial Sequence <400> 109 ttaggaagct caactggaag tttcattcag tagataaatc tacgttaata aaac 54 <210> 110 <211> 54 <212> DNA <213> Artificial Sequence <400> 110 ctattatgtc gctgggatcg tcaccctcca acggcttaac ggggtcagtg cctt 54 <210> 111 <211> 54 <212> DNA <213> Artificial Sequence <400> 111 catcgatagt acaatcgaaa tccgcgacag acggtaatta gagccagcaa aatc 54 <210> 112 <211> 54 <212> DNA <213> Artificial Sequence <400> 112 gatattcaga aaatgcgaca ttcaaccgtt attcagatga acggtgtaca gacc 54 <210> 113 <211> 54 <212> DNA <213> Artificial Sequence <400> 113 ttaacatttg ccctgcttga gatggttttg cgatttgttt agctatattt tcat 54 <210> 114 <211> 54 <212> DNA <213> Artificial Sequence <400> 114 tttcaattct taccattgag aatcgccaag gcattaaaca ataacggatt cgcc 54 <210> 115 <211> 54 <212> DNA <213> Artificial Sequence <400> 115 caaagcgctg gcctgattct ccgtgggaca cgttgcagta tcggcctcag gaag 54 <210> 116 <211> 54 <212> DNA <213> Artificial Sequence <400> 116 gagcgctgca aaatggttga gtgttgttcg tggaccataa aaacagggaa gcgc 54 <210> 117 <211> 54 <212> DNA <213> Artificial Sequence <400> 117 ggaatcatta ggttaatcca atcgcaagtt ttagttgaaa taccgaccgt gtga <210> 118 <211> 54 <212> DNA <213> Artificial Sequence <400> 118 father agccaacatt atgaccctac gcaagcatga ttaagactcc ttat <210> 119 <211> 54 <212> DNA <213> Artificial Sequence <400> 119 ctacaacatt snow snow snow snow snow snow snow 54 snow snow <210> 120 <211> 54 <212> DNA <213> Artificial Sequence <400> 120 gattagtatg tagaaccaag taccgcacat cgtaggtatt ctaagaacgc gagg <210> 121 <211> 54 <212> DNA <213> Artificial Sequence <400> 121 54. attgtaagc cagaatggag cgtcatccat taaacgggta aaat <210> 122 <211> 54 <212> DNA <213> Artificial Sequence <400> 122 tacgagccgg gccttttgggt aacgccaggc cagtgcgaat tcgtaatcat ggtc <210> 123 <211> 54 <212> DNA <213> Artificial Sequence <400> 123 cgctggtgag agatctggag caaacaagtg tcaatccagt gagacgggca acag <210> 124 <211> 56 <212> DNA <213> Artificial Sequence <400> 124 56. accagtagca ccccgtaatc agtagcatta tacatgttac ttaaaaaaaa aaaaaa <210> 125 <211> 56 <212> DNA <213> Artificial Sequence <400> 125 attagacggg aggagagata acccacttga tggggaacaa aaaaaaa aaaaaa <210> 126 <211> 56 <212> DNA <213> Artificial Sequence <400> 126 aggcgcatag gcaaatcaac gtaacagttt attgagggaa ggaaaaaaaa aaaaaa 56 <210> 127 <211> 56 <212> DNA <213> Artificial Sequence <400> 127 cccaatagga acgcattcca cagacactga gacgtgtatc acaaaaaaaa aaaaaa 56 <210> 128 <211> 56 <212> DNA <213> Artificial Sequence <400> 128 agcttagatt aaaaatcata ggtctgacaa acaaatat gtaaaaaaaa aaaaaa 56 <210> 129 <211> 56 <212> DNA <213> Artificial Sequence <400> 129 acgtaatgcc accatctttg accccccagg aggagtctct gaaaaaaaaa aaaaaa 56 <210> 130 <211> 56 <212> DNA <213> Artificial Sequence <400> 130 ctcagagcca ccagccgccg ccagcagaat caaatctttt caaaaaaaaa aaaaaa 56 <210> 131 <211> 56 <212> DNA <213> Artificial Sequence <400> 131 atagctgttt ccataaagtg taaagctgtt gggccagtca cgaaaaaaaa aaaaaa 56 <210> 132 <211> 56 <212> DNA <213> Artificial Sequence <400> 132 gagtaacagt gccatgaaag tattaacacg cataaagaca gcaaaaaaaa aaaaaa 56 <210> 133 <211> 56 <212> DNA <213> Artificial Sequence <400> 133 agattcaaaa ggctagctga taaattattg agtagcagat agaaaaaaaa aaaaaa 56 <210> 134 <211> 56 <212> DNA <213> Artificial Sequence <400> 134 gaactaacgg aattcaacta atgcagattg ctgcagttga ttaaaaaaaa aaaaaa 56 <210> 135 <211> 56 <212> DNA <213> Artificial Sequence <400> 135 tttgcggaac aatggcaatt catcaattat cctatcccaa tcaaaaaaaa aaaaaa 56 <210> 136 <211> 56 <212> DNA <213> Artificial Sequence <400> 136 tacgcagtat gtaaagacac cacggaagaa ttattttgcg ggaaaaaaaa aaaaaa 56 <210> 137 <211> 56 <212> DNA <213> Artificial Sequence <400> 137 tgattgcttt gagcaaaaga agatgatatc atacaacgcc aaaaaaaaaa aaaaaa 56 <210> 138 <211> 56 <212> DNA <213> Artificial Sequence <400> 138 ttggggcgcg agatcataca ggcaagtgct catactttaa tcaaaaaaaa aaaaaa 56 <210> 139 <211> 56 <212> DNA <213> Artificial Sequence <400> 139 ctgattgccc ttagcaggcg aaaatcccgg agaatgaacg gtaaaaaaaa aaaaaa 56 <210> 140 <211> 56 <212> DNA <213> Artificial Sequence <400> 140 atcgcactcc agccattcag gctgcggcca tcagcggatt gaaaaaaaaa aaaaaa 56 <210> 141 <211> 56 <212> DNA <213> Artificial Sequence <400> 141 aatcgtcata aaagttcaga aaacgaataa cgcatagcga gaaaaaaaaa aaaaaa 56 <210> 142 <211> 56 <212> DNA <213> Artificial Sequence <400> 142 cgttttagcg aattgcaccc agctacatcc catgaacaag caaaaaaaaa aaaaaa 56 <210> 143 <211> 56 <212> DNA <213> Artificial Sequence <400> 143 gacgacaata aactgaacaa gaaaaaatcc tgaaataaag aaaaaaaaaa aaaaaa 56 <210> 144 <211> 56 <212> DNA <213> Artificial Sequence <400> 144 taaataaggc gttagaaaaa gcctgtacta cctacgcgag aaaaaaaaaa aaaaaa 56 <210> 145 <211> 56 <212> DNA <213> Artificial Sequence <400> 145 ggtttatcag ctatgacaac aaccattcat agtggagtga gaaaaaaaaa aaaaaa 56 <210> 146 <211> 56 <212> DNA <213> Artificial Sequence <400> 146 atttaaattg tatttttaac caatagggtg cctctgcatt aaaaaaaaaa aaaaaa 56 <210> 147 <211> 56 <212> DNA <213> Artificial Sequence <400> 147 agagagtacc ttcggatggc ttagaggacc ataagcccga aaaaaaaaaa aaaaaa 56 <210> 148 <211> twenty four <212> DNA <213> Artificial Sequence <400> 148 cccccccccc agttagacca cctc 24 <210> 149 <211> twenty four <212> DNA <213> Artificial Sequence <400> 149 gaggtggtct aactgggggg gggg 24 <210> 150 <211> twenty two <212> RNA <213> Artificial Sequence <400> 150 uucccuuugu cauccuucgc with 22

Claims

1. The 3D DNA network structure synergistically triggered by miRNA-211 and H2S is characterized by: The 3D DNAnetwork structure includes a DNA-cube framework, Ag NPs and a long double-stranded DNA track formed by miRNA-211 as a trigger chain, wherein the mixing volume ratio of 10 nM DNA-cube framework, 7.8 ppm Ag NPs and 300 nM long double-stranded DNA track is 1:1:40; wherein the Ag NPs are embedded in the DNA-cube framework and self-assemble with the long double-stranded DNA track to form a network structure.

2. The method for preparing the 3D DNA network structure synergistically triggered by miRNA-211 and H2S according to claim 1, characterized in that: The following steps are involved: S1. Preparation of Ag NP / ssDNA complex NaBH4 was dissolved in ice ultrapure water, and AgNO3 solution was slowly added under magnetic stirring. After the reaction stopped, the mixture was centrifuged and washed with water to obtain Ag NPs. ssDNA was mixed with Ag NPs, and oscillation and standing were performed alternately, and then the standing time was continued for 4 hours for incubation. After the incubation, NaCl was added successively to make the final concentration of NaCl in the system reach 0.3 M, and the mixture was aged at room temperature for 12 hours. After centrifugation, it was washed with 0.1 M PBS to form an Ag NP / ssDNA complex. S2. Preparation of DNA-cube framework M13 mp18 DNA was mixed with the staple strands and followed a certain annealing process: 95°C-70°C, with each 5°C gradient, each gradient was maintained for 5 min; 70°C-50°C, with each 2°C gradient, each gradient was maintained for 10 min; 50°C-20°C, with each 1°C gradient, each gradient was maintained for 15 min, to form a DNA-cube framework; S3. Preparation of long double-stranded DNA tracks Two hairpin DNAs, HP1, SEQ ID NO.1, HP2, SEQ ID NO.2, were heated at 95°C for 5 min and slowly cooled to room temperature. MiRNA-211 was added to an equal amount of HP1 and HP2 mixed solution and reacted in a 37°C water bath for 2 h to trigger the HCR reaction to form a long double-stranded DNA track. S4. Preparation of 3D DNA network structure The Ag NP / ssDNA complex was dissolved in the DNA-cube framework and then mixed with an equal volume of the HCR reaction solution in S3 to construct a 3D DNA network structure in a PCR instrument. The annealing program was as follows: 25 ℃, 10 s; 35 ℃, 10 s; 40 ℃, 1 min; 45 ℃, 10 min; 40 ℃, 1 h; 35 ℃, 1 h; 30 ℃, 1 h; 25 ℃, 1 h; 20 ℃, 1 h; 15 ℃, 1 h; 10 ℃, 1 h; 4 ℃, 1 h; S5. Isolation of 3D DNA network structure A quartz rod modified with DNA 1 was used to extract the 3D DNA network structure from the reaction system. The quartz rod was cut and immersed in the DNA 1 solution and vortexed for at least 2 h. It was then transferred to the DNA 2 solution and incubated in a 37 °C water bath for 1 h. The resulting solution was stored at 4 °C. Among them, the sequence of DNA 1 is shown as SEQ ID NO.148, and the sequence of DNA 2 is shown as SEQ ID NO.

149.

3. The method for preparing a 3D DNA network structure synergistically triggered by miRNA-211 and H2S according to claim 2, characterized in that: The concentration of NaBH4 aqueous solution in S1 was 4 mM, the molar ratio of NaBH4 and AgNO3 was 1:1, and the volume ratio of 500 nMssDNA and 7.8 ppm Ag NPs was 2:

1.

4. The method for preparing a 3D DNA network structure synergistically triggered by miRNA-211 and H2S according to claim 2, characterized in that: The ssDNA concentration in S1 is 500 nM; PBS is 0.1 M, including 0.1 M NaCl, 10 mM phosphate.

5. The method for preparing a 3D DNA network structure synergistically triggered by miRNA-211 and H2S according to claim 2, characterized in that: The reaction time of adding AgNO3 solution to S1 was 10 min, and the centrifugation condition was 8000 rpm for 5 min; ssDNA and Ag NPs were mixed and oscillated for 5 min, left to stand for 25 min, and the above oscillation was repeated before incubation.

6. The method for preparing a 3D DNA network structure synergistically triggered by miRNA-211 and H2S according to claim 2, characterized in that: The molar ratio of M13 mp18 DNA mixed with staple strand in S2 was 1:

10.

7. The method for preparing a 3D DNA network structure synergistically triggered by miRNA-211 and H2S according to claim 2, characterized in that: The molar ratio of miRNA-211, HP1, and HP2 in S3 was 3:10:

10.

8. The method for preparing a 3D DNA network structure synergistically triggered by miRNA-211 and H2S according to claim 2, characterized in that: The molar ratio of DNA 1 to DNA 2 in S5 is 1:

1.

9. Use of the 3D DNA network structure synergistically triggered by miRNA-211 and H2S as described in claim 1 in preparing a detection system for early screening of CRC.

10. The use according to claim 9, characterized in that: The structure has a detection range of 0.05-10 μM for H2S, with a LOD as low as 4.78 nM.

Images