An improved c-Met neutralizing antibody and its preparation method and application

Abstract

The present invention discloses an improved c-Met neutralizing antibody and a preparation method and application thereof. It belongs to the field of biopharmaceutical technology. The present invention optimizes the structure and activity of an agonistic c-Met antibody with neutralizing activity through a random mutation library of antibodies and cell display technology, obtains an antibody with high affinity and low agonistic activity, and maintains the neutralization and internalization activity of the parent antibody, thereby improving the drugability of the c-Met antibody. The obtained mutant antibody 2G5 has a good purification effect, an IC50 of 41.53ng / ml, and a strong ability to bind to the extracellular region of c-Met. The results of the blocking ELISA experiment showed that the mutant antibody 2G5 had significant neutralizing activity, and in A549 cells, the antibody caused a significant internalization effect. The mutant antibody 2G5 could not activate the c-Met signaling pathway of A549 cells, and could not cause HUVEC cell proliferation and A549 cell migration. A mutant antibody with higher drugability was obtained.

Description

Technical Field

[0001] The present invention relates to the field of biopharmaceutical technology, and more specifically to an improved c-Met neutralizing antibody and a preparation method and application thereof. Background Art

[0002] Human mesenchymal epithelial transition factor (c-Met) is a type of tyrosine kinase receptor located on the cell surface. Hepatocyte growth factor (HGF) is its natural ligand, which can induce its dimerization and intracellular tyrosine phosphorylation. As a marker, c-Met is not only widely present in various tumor tissues, but the HGF / c-Met signaling pathway is also involved in various pathological processes such as tumor and cancer proliferation, survival, invasion and angiogenesis. In recent years, tumor targeted therapy based on c-Met antibodies has been widely studied. Its strategies include: 1) using naked antibodies or genetically engineered antibodies as neutralizing antibodies to antagonize the HGF / c-Met pathway; 2) using antibody-drug conjugate (ADC) strategy to develop highly specific and highly toxic cytotoxins; 3) using bispecific antibodies to recruit lymphocytes to kill tumor cells with high c-Met expression. Currently, AbbVie's ADC drug ABBV-399 is progressing rapidly and has a good anti-tumor effect on non-small cell lung cancer. The antibody ABT-700 in the ADC drug is a neutralizing antibody targeting c-Met and has excellent binding and internalization properties.

[0003] c-Met has a complex structure and activation mechanism. In the process of c-Met antibody development, differences in epitopes will lead to differences in antibody function. The bivalent structure of the antibody may directly cause c-Met dimerization through a non-HGF-dependent pathway and activate downstream tumor-promoting signaling pathways. Such agonistic antibodies are not only unable to be directly used in the development of antagonistic drugs, but also have a potential risk of secondary tumorigenesis in ADC drugs.

[0004] Although the problem of agonistic activity can be solved by constructing single-chain or single-arm antibodies through genetic engineering, there are still technical problems such as shortened half-life and difficulty in purification.

[0005] Therefore, how to provide an improved c-Met neutralizing antibody is an urgent problem to be solved by those skilled in the art. Summary of the invention

[0006] In view of this, the present invention provides an improved c-Met neutralizing antibody and a preparation method and application thereof.

[0007] The present invention is based on an agonistic c-Met antibody 3E1D7 with neutralizing activity. Through random mutation and cell display technology, a mutant antibody with high affinity and low agonistic activity and retaining neutralization and internalization ability is screened from a random mutant antibody library of heavy chain complement determining region 3 (CDR3). The agonistic activity of c-Met antibody 3E1D7 is optimized mainly by randomly mutating amino acids in CDR3, hoping to reduce or eliminate the agonistic activity through the re-shooting of its side chain groups, and to keep its neutralization and endocytosis activities as much as possible. After screening the binding ability using antigen fusion protein, mutant antibody 2G5 is successfully obtained. Through experiments on c-Met phosphorylation, tumor cell migration and endothelial cell proliferation, it is clear that its agonistic activity is significantly reduced, and through neutralization experiments, it is clear that it has a significant inhibitory effect on the binding of HGF. More importantly, the mutant antibody still retains the endocytosis activity of the parent antibody. The results showed that the c-Met mutant antibody 2G5 has higher drugability than the parent antibody, whether as a neutralizing antibody or an ADC drug precursor.

[0008] In order to achieve the above object, the present invention adopts the following technical solution:

[0009] The preservation information is as follows: Culture name (classification name): Human embryonic kidney cell 293T-2G5, preservation number: CCTCCNO: C2021157, preservation address: China Center for Type Culture Collection (Wuhan University, Wuhan, China), receipt date (preservation date): June 24, 2021.

[0010] An improved c-Met neutralizing antibody is based on the amino acid sequence of antibody 3E1D7, and the amino acid sequence of heavy chain CDR3 is replaced with the sequence shown in SEQ ID NO.2.

[0011] The present invention also provides a gene for an improved c-Met neutralizing antibody, wherein the nucleotide sequence encoding the heavy chain CDR3 amino acid is shown in SEQ ID NO.3.

[0012] The present invention also provides a recombinant vector comprising the gene according to claim 2.

[0013] The present invention also provides a recombinant cell capable of secreting the above-mentioned antibody or the above-mentioned recombinant vector.

[0014] Preferably: the deposit number is CCTCC NO: C2021157.

[0015] The present invention also provides the use of the above-mentioned improved c-Met neutralizing antibody in the preparation of anti-tumor drugs.

[0016] Preferably: the tumor is non-small cell lung cancer.

[0017] It can be seen from the above technical solutions that compared with the prior art, the present invention discloses an improved c-Met neutralizing antibody and its preparation method and application. Compared with the prior art, the present invention optimizes the structure and activity of the agonist c-Met antibody with neutralizing activity through the random mutation library of the antibody and the cell display technology, obtains an antibody with high affinity and low agonist activity, and maintains the neutralization and internalization activity of the parent antibody, thereby improving the drugability of the c-Met antibody. The mutant antibody 2G5 obtained has good purification effect, IC 50 The concentration of 2G5 in the A549 cell line was 41.53 ng / ml, and it had a strong ability to bind to the extracellular region of c-Met. The results of the blocking ELISA experiment showed that the mutant antibody 2G5 had significant neutralizing activity, and in A549 cells, the antibody caused a significant internalization effect. The mutant antibody 2G5 could not activate the c-Met signaling pathway in A549 cells, and could not cause HUVEC cell proliferation and A549 cell migration. A mutant antibody with higher drugability was obtained. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on the provided drawings without paying creative work.

[0019] Figure 1 The accompanying drawing is a schematic diagram of the basic structure of the pCMV-2G5-H lentiviral expression vector provided by the present invention.

[0020] Figure 2 The accompanying drawings are diagrams of the SDS-PAGE non-denaturing and denaturing electrophoresis results provided by the present invention, wherein the left side is the non-denaturing electrophoresis result and the right side is the denaturing electrophoresis result.

[0021] Figure 3 The accompanying drawing is a diagram showing the detection of the recognition and binding ability of the c-Met antibody provided by the present invention to the target c-Met.

[0022] Figure 4 The attached figure is a diagram of the targeting detection of the anti-human c-MET antibody provided by the present invention.

[0023] Figure 5 The accompanying drawing is a diagram for detecting the internalization effect of the anti-human c-MET antibody provided by the present invention on human non-small cell lung cancer cells (A549).

[0024] Figure 6The accompanying drawing is a diagram showing the effect of the anti-human c-MET mutant antibody provided by the present invention on the c-MET signaling pathway of human non-small cell lung cancer cells (A549).

[0025] Figure 7 The accompanying drawing is a diagram showing the effect of the anti-human c-MET antibody provided by the present invention on the proliferation of human umbilical vein endothelial cells (HUVEC).

[0026] Figure 8 The accompanying drawing is a diagram showing the effect of the anti-human c-MET mutant antibody provided by the present invention on the migration of human non-small cell lung cancer cells (A549). DETAILED DESCRIPTION

[0027] The following will be combined with the drawings in the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0028] The embodiment of the present invention discloses an improved c-Met neutralizing antibody and a preparation method and application thereof.

[0029] Lentivirus expression plasmid pRRL-CMV and its packaging plasmid were purchased from Invitrogen (Cat. No. K497500 and K531520), pCMV-ch3E1D7-L and pCMV-ch3E1D7-H (see Zhang Longzhen, Guo Jia, Gu Hua, et al. Construction of recombinant anti-c-Met chimeric antibody and its rapid expression using lentivirus, Journal of Hefei University of Technology, 2017, 40(6): 835-839) and were kept in this laboratory; competent Escherichia coli DH5α was purchased from Beijing Quanshijin Biotechnology Co., Ltd.; restriction endonucleases and high-fidelity DNA polymerase were purchased from NEB; agarose affinity medium Protein A was purchased from the National Biochemical Engineering Technology Research Center. 293T cells and A549 cells were purchased from the Shanghai Institute of Cell Biology, Chinese Academy of Sciences, and HUVEC cells were purchased from Allcells. High-glucose DMEM medium was purchased from Gibco, HUVEC basal medium was purchased from Allcells, and fetal bovine serum was purchased from Gibco. Commercial recombinant human C-Met protein, recombinant human HGF protein, and human HGF antibody were purchased from R&D. Met antibody, p-Met antibody, beta-actin antibody, HRP-labeled anti-rabbit secondary antibody, HRP-labeled streptavidin secondary antibody, and HRP-labeled anti-mouse secondary antibody were purchased from CST. pHAb Amine Reactive Dye kit was purchased from Promega. TMB colorimetric solution was purchased from Beijing Tiangen Biotechnology Co., Ltd. Cell proliferation detection kit (CCK8) was purchased from Dojindo. NC membrane and ECL chemiluminescent reagent were purchased from Pierce, USA.

[0030] Example 1

[0031] Construction of 2G5 full-molecule expression vector

[0032] 3E1D7 is a chimeric antibody targeting human c-MET (see Zhang Longzhen, Guo Jia, Gu Hua, et al. Construction of recombinant anti-c-Met chimeric antibodies and their rapid expression using lentivirus, Journal of Hefei University of Technology, 2017, 40(6):835-839), with neutralizing activity and agonistic activity. A random mutation antibody library of 3E1D7 heavy chain CDR3 was constructed by cell surface display technology (see Guo Jia, Jiang Yun, Teng Fei, et al. Construction of a random mutation mammalian cell surface display library of heavy chain CDR3 of mesenchymal epithelial transition factor (c-Met) chimeric antibody. Journal of Cellular and Molecular Immunology, 2019, 35(5):557-562). On this basis, the amino acid sequence of the heavy chain CDR3 of the parent antibody 3E1D7 is as follows: RSGYHGTSYWYFD, as shown in SEQ ID NO.1.

[0033] An antibody strain 2G5 with relatively good performance was initially screened. The amino acid sequence of the heavy chain CDR3 of 2G5 had 4 amino acid mutations, and the sequence is as follows: RTGYHVISSWDFD, as shown in SEQ ID NO.2 (the amino acids in the rest of the region are consistent with the parent antibody). The nucleotide sequence encoding the amino acids of the heavy chain CDR3 (CGTACTGGTTATCATGTTATTTCTTCTTGGGATTTTGAT) is shown in SEQ ID NO.3.

[0034] Expression and purification

[0035] In order to further compare the biological function differences between 2G5 and the parent antibody 3E1D7, the heavy chain and light chain lentiviral secretory expression vectors of human and mouse 2G5 were constructed respectively. First, the heavy chain lentiviral expression vector of 2G5 was constructed. According to the heavy chain variable region sequence of antibody 2G5 and the constant region sequence of human IgG1, a DNA fragment with the structure as shown in the figure Figure 1 As shown, the synthesized DNA fragment was used as a template, upstream and downstream primers were designed, and PCR was performed (upstream primer sequence: 5'-TCACAGGATCTAGTTCCGGA-3' as SEQ ID NO.4; downstream primer sequence: 5'-TCACTATTTACCCGGAGACAGGG-3' as SEQ ID NO.5; 50 microliter PCR system was as follows: 1 μL template, 1 μL upstream and downstream primers each, 1 μL high-fidelity enzyme, 2× reaction buffer: 25 μL, water 22 μL. PCR machine conditions: 98°C, 3 min; 98°C denaturation for 15 s, 52°C annealing for 30 s, 72°C extension for 1 min; 30 cycles; 72°C extension for 10 min). The PCR product was connected to the lentiviral expression vector pCMV to form pCMV-2G5-H (pCMV was purchased from Invitrogen, and the connection and transformation process was carried out according to the instructions. When using, just mix the appropriate amount of vector with the corresponding PCR product and let it stand for 5 minutes to complete the connection step, and then proceed to the subsequent transformation). Since the light chain (Light chain, L) sequence of 2G5 is the same as that of the parent antibody 3E1D7 without any changes, pCMV-ch3E1D7-L constructed in this laboratory can be used instead for subsequent transfection. pCMV-2G5-H (see Figure 1 ) and p CMV-ch3E1D7-L were co-transfected into HEK293T cells (HEK293T cells in the logarithmic growth phase were inoculated, and when the cells grew to 50% to 60% confluence, the above two plasmids were transfected at a ratio of 1:1 using the calcium phosphate method) to obtain human embryonic kidney cells 293T-2G5 (deposit number: CCTCCNO: C2021157), and secretory 2G5 antibodies were obtained by Protein A purification (see Figure 2The parent antibody 3E1D7 protein is preserved by our laboratory (for the parent antibody 3E1D7, see: Zhang Longzhen, Guo Jia, Gu Hua, et al. Construction of recombinant anti-c-Met chimeric antibody and its rapid expression using lentivirus [J]. Journal of Hefei University of Technology, 2017, 40(6): 835-839).

[0036] The results of SDS-PAGE non-denaturing electrophoresis showed a band of about 150KDa, indicating that the disulfide bonds in the antibody were not broken and the antibody was in the form of dimers. However, two bands were observed in SDS-PAGE denaturing electrophoresis, with molecular weights of 50KDa and 25kDa, respectively, corresponding to the heavy chain and light chain of the antibody after the disulfide bonds were broken. The above results were consistent with the expected results, and there were no obvious miscellaneous bands in the electrophoresis results, indicating that the antibody purification effect was good.

[0037] Example 2

[0038] Binding activity detection of secreted mutant antibody 2G5

[0039] The affinity of parental antibody 3E1D7 and secretory 2G5 for antigen in vitro was compared by enzyme-linked immunosorbent assay (ELISA).

[0040] Coating solution (CBS) (0.05M Carbonate-Bicarbonate, pH 9.6) was used to dilute the antigen (c-MET extracellular domain) to 2 μg / ml, 100 μl / well, and incubated at 4°C overnight. The next day, the ELISA plate coated with the antigen was washed twice with washing solution (PBS + 0.05% Tween20), followed by adding 200 μl / well blocking solution (PBS + 1% BSA) and incubating at 37°C for 2 hours. Wash three times with washing solution, add the c-MET antibody to be tested to the 96-well ELISA plate, and incubate at room temperature for 2 hours. The plates were washed three times with the washing solution, and 100 μl / well of enzyme-labeled secondary antibody (Goatanti-Mouse IgG (H+L) (HRP) was added to a 96-well ELISA plate and incubated at room temperature for 1 hour. The plates were washed three times with the washing solution, and TMB colorimetric solution was used for 10 min. Then, the stop solution (2M H2SO4) was added, and the plate was read at a wavelength of 450 nm using an ELISA reader (Bio-Rad, iMark).

[0041] Results Figure 3 The mutant antibody 2G5 can specifically bind to the c-MET extracellular domain fusion protein. As the concentration of 2G5 increases, the signal increases. Under the conditions of this system, the IC50 of the mutant antibody 2G5 and the parent antibody 3E1D7 are 41.53 ng / ml and 39.32 ng / ml, respectively, proving that the mutant antibody 2G5 has a strong binding ability to the c-MET extracellular domain fusion protein, which is basically consistent with the parent antibody.

[0042] Example 3

[0043] Neutralizing activity detection of secreted mutant antibody 2G5

[0044] Competitive ELISA binding assay was performed using c-MET natural ligand HGF to detect the neutralizing activity of parental antibody 3E1D7 and secreted 2G5.

[0045] The coating and blocking steps of the blocking ELISA are the same as those of the indirect ELISA (Example 2). After the blocked ELISA plate is washed three times with the washing solution, the c-MET antibody to be tested is added to the 96-well ELISA plate and incubated at room temperature for 1.5 hours. Wash three times with the washing solution, add HGF at a final concentration of 15 ng / ml, 100 μl / well, and incubate at 37°C for 2 hours. Wash three times with the washing solution, add 100 μl / well of HGF antibody, and incubate at room temperature for 1 hour. Wash three times with the washing solution, add 100 μl / well of streptavidin-HRP enzyme-labeled secondary antibody, and incubate at room temperature for 0.5 hours. Wash three times with the washing solution. After the TMB colorimetric solution acts for 10 minutes, the stop solution (2M H2SO4) is added, and the plate is read at a wavelength of 450nm using an ELISA reader (Bio-Rad, iMark).

[0046] The competitive binding results of HGF to mutant antibody 2G5 are shown in Figure 4 As shown, it can be seen that the mutant antibody 2G5 can effectively inhibit the binding of HGF to the c-MET antigen, indicating that the mutant antibody 2G5 has a blocking effect on c-MET / HGF binding.

[0047] Example 4

[0048] Internalization effect of secreted mutant antibody 2G5

[0049] The internalization effect of 2G5 was detected by flow cytometry, and the antibody was coupled with fluorescent signal according to the pHAb Amine ReactiveDye kit of Promega. Human non-small cell lung cancer cells (A549) in the logarithmic growth phase were digested and counted and plated. The next day, c-MET antibody coupled with fluorescent signal was added to the A549 cell culture plate, and the cells were digested after 24 hours of incubation. The cells were washed twice with pre-cooled D-PBS + 5% FBS and stored on ice. Both the mutant antibody 2G5 and the parent antibody 3E1D7 can significantly induce the internalization effect of A549 cells. FACS results are shown in Figure 5 The results showed that after 24 hours of antibody incubation, more than 95% of the antibody molecules were internalized into the cells.

[0050] Example 5

[0051] Effect of secreted mutant antibody 2G5 on c-MET signaling pathway in human non-small cell lung cancer cells (A549).

[0052] After the agonist antibody binds to c-MET, it can cause c-MET dimerization and tyrosine phosphorylation, further activating the c-MET downstream signaling pathway, thereby promoting the proliferation of vascular endothelial cells and the migration of tumor cells. To verify the agonist activity of the mutant antibody 2G5, the mutant antibody 2G5 and the parent antibody 3E1D7 were subjected to a c-Met signaling pathway experiment in human non-small cell lung cancer cells (A549).

[0053] Human non-small cell lung cancer cells (A549) in the logarithmic growth phase were digested and counted. 5 / well density plated 35mm cell culture dishes. The next day, high-glucose DMEM basal medium was replaced and starved for 24h. Different c-MET antibodies at a concentration of 1μg / ml were added. After stimulation at different time points, RIPA lysis buffer was added and lysed on ice for 10 minutes. After adding loading buffer, WB detection was performed to detect the content of total c-MET protein, phosphorylated c-MET protein and β-actin protein.

[0054] Results Figure 6 The results showed that the parental antibody 3E1D7 exhibited significant c-MET agonist activity. At a concentration of 1 μg / ml, it significantly activated the c-MET signaling pathway of A549 cells. As the stimulation time prolonged, the activation effect became more significant. However, the mutant antibody 2G5 did not exhibit agonist activity in activating the c-MET signaling pathway.

[0055] Example 6

[0056] Detection of agonistic activity of secreted mutant antibody 2G5

[0057] Effect of 2G5 on the proliferation of human umbilical vein endothelial cells (HUVEC).

[0058] To further verify the agonistic activity of mutant antibody 2G5, human umbilical vein endothelial cell (HUVEC) proliferation assay was performed on mutant antibody 2G5 and parent antibody 3E1D7.

[0059] Human umbilical vein endothelial cells (HUVEC) 1x10 5 cells / ml, 50μl / well added to 96-well cell culture plates, the culture medium is HUVEC basal culture medium + 1% fetal bovine serum. After 24h of cell culture, add 50μl / well anti-human c-MET test antibody and culture in a 37℃ cell culture incubator for 3 days. Use a cell proliferation detection kit to detect cell proliferation according to the kit instructions. Use a microplate reader (Bio-Rad, iMark) to read the plate at 450nm.

[0060] Results Figure 7The parental antibody 3E1D7 exhibited significant c-MET agonist activity and significantly promoted HUVEC cell proliferation at a concentration of 200 ng / ml. This effect became more significant with the increase of antibody concentration, while the mutant antibody 2G5 did not show any effect in promoting HUVEC cell proliferation.

[0061] Example 7

[0062] Effect of 2G5 on the migration of human non-small cell lung cancer cells (A549)

[0063] To further verify the agonistic activity of mutant antibody 2G5, a human non-small cell lung cancer cell (A549) migration assay was performed on mutant antibody 2G5 and parent antibody 3E1D7.

[0064] Human non-small cell lung cancer cells (A549) 2×10 5 10 cells / ml, 500 μl / well was added to the upper chamber of the transwell chamber, and 750 μl of medium containing different concentrations of the antibody to be tested was added to the lower chamber, the medium was high-glucose DMEM basal medium. After 16 hours of cell culture, crystal violet staining was performed, and the cells on the lower surface of the chamber were counted under a microscope.

[0065] Results Figure 8 The parent antibody 3E1D7 exhibited significant c-MET agonistic activity and significantly promoted the migration effect of A549 cells at a concentration of 500 ng / ml, while the mutant antibody 2G5 did not exhibit pro-migration activity, proving that 2G5 met our expectations. While retaining its binding activity and internalization properties, its c-MET antibody agonistic activity was significantly reduced, providing a more suitable alternative molecule for drug development.

[0066] The various embodiments in this specification are described in a progressive manner, and each embodiment focuses on the differences from other embodiments. The same or similar parts between the various embodiments can be referenced to each other.

[0067] The above description of the disclosed embodiments enables one skilled in the art to implement or use the present invention. Various modifications to these embodiments will be apparent to one skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the present invention. Therefore, the present invention will not be limited to the embodiments shown herein, but rather to the widest scope consistent with the principles and novel features disclosed herein. Sequence Listing <110> Tongji University Suzhou Research Institute <120> An improved c-Met neutralizing antibody and its preparation method and application <160> 5 <170> SIPOSequenceListing 1.0 <210> 1 <211> 13 <212> PRT <213> Artificial Sequence <400> 1 Arg Ser Gly Tyr His Gly Thr Ser Tyr Trp Tyr Phe Asp 1 5 10 <210> 2 <211> 13 <212> PRT <213> Artificial Sequence <400> 2 Arg Thr Gly Tyr His Val Ile Ser Ser Trp Asp Phe Asp 1 5 10 <210> 3 <211> 39 <212> DNA <213> Artificial Sequence <400> 3 cgtactggtt atcatgttat ttcttcttgg gattttgat 39 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <400> 4 tcacaggatc tagttccgga 20 <210> 5 <211> twenty three <212> DNA <213> Artificial Sequence <400> 5 tcactattta cccggagaca ggg 23

Claims

1. A recombinant cell capable of secreting an improved c-Met neutralizing antibody, characterized in that: The deposit number is CCTCC NO:C2021157.

2. The improved c-Met neutralizing antibody secreted by the recombinant cell of claim 1.

3. Use of the antibody according to claim 2 in the preparation of an anti-non-small cell lung cancer drug.

Images