A primer set for microsatellite markers of Parabramis pekinensis, and its application and evaluation method

Through high-throughput sequencing and the design of microsatellite marker primer sets, the problems of genetic diversity assessment and inbreeding of changchun bream were solved, and high-accurate genetic diversity analysis and germplasm resource protection were achieved.

CN115261489BActive Publication Date: 2025-07-25ZHEJIANG INST OF FRESH WATER FISHERIES
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202211083754.9
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2022-09-06
Publication Date
2025-07-25
Estimated Expiration
2042-09-06

AI Technical Summary

Technical Problem

The prior art is difficult to effectively evaluate the genetic diversity of celestial bream and prevent the decline of germplasm resources caused by inbreeding, and there is a lack of efficient molecular marker technical support.

Method used

High-throughput sequencing technology is used to mine the microsatellite markers of Changchun bream, design and screen primer sets with high polymorphism, and establish genetic diversity analysis methods through PCR amplification and capillary electrophoresis detection to accurately evaluate the genetic diversity of Changchun bream.

Benefits of technology

Highly accurate genetic diversity analysis is achieved, which can effectively evaluate the effects of individual identification and proliferation of Changchun bream, and prevent inbreeding and germplasm resource decline.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN115261489B_ABST
    Figure CN115261489B_ABST
Patent Text Reader

Abstract

The present invention discloses a primer set for microsatellite markers of Changchun bream and its application and evaluation method. The specific primers for the microsatellite markers of the present invention are used to PCR amplify microsatellite sequences, and DNA of the Changchun bream to be analyzed is obtained; the 5' end of the display primer set is marked with HEM, and the primer set for the microsatellite markers of the present invention is used for PCR amplification to obtain PCR amplification products, and the PCR amplification products obtained in step (3) are subjected to capillary electrophoresis detection, and the number of alleles amplified by each pair of single-site primers is counted to obtain statistical results; the amplification peak type of each pair of primers is recorded, and the obtained data is analyzed and processed to evaluate the genetic diversity of the germplasm of Changchun bream. The present invention uses microsatellites to establish a genetic diversity analysis technology for Changchun bream, which has high accuracy and can be used for late-stage individual identification of Changchun bream and evaluation of the effect of proliferation and release; population genetics analysis can also be performed to effectively prevent inbreeding and the decline of germplasm resources.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The invention relates to the technical field of molecular biology DNA markers, and in particular to a primer set for Changchun bream microsatellite markers and an application and evaluation method thereof. Background Art

[0002] Changchun bream (Parabramis pekinensis) belongs to the Cypriniformes, Cyprinidae, Cultrinae, Parabramis, commonly known as bream flower, which grows fast, has tender meat, delicious taste, high nutritional value, and is favored by consumers. It is a good freshwater fish. Changchun bream is widely distributed in my country. It likes to grow in the middle and upper layers of rivers, lakes, and reservoirs, and likes to hide in aquatic plants. Most of the young fish live in shallow water or waters with slow currents.

[0003] Microsatellite DNA, also known as Simple Sequence Repeats (SSR) or Short Tandem Repeats (STR), is generally composed of two parts: a core repeat unit of 1 to 6 bp and conserved sequences at both ends of the repeat region. Different repeat numbers and repeat positions are the basis for the polymorphism of microsatellite loci. Microsatellite molecular markers have many advantages and great application prospects, and are widely used in various biological research. In aquatic animals, they are mainly used in population genetics, kinship identification and individual identification, construction of genetic maps, and molecular marker-assisted breeding.

[0004] This study used high-throughput random sequencing methods to mine microsatellite markers for Changchun bream, and used polymorphic microsatellite markers to evaluate the population genetic characteristics of a Changchun bream broodstock population, in order to provide assistance for molecular-assisted breeding of Changchun bream and lay the foundation for cultivating high-quality, high-yield, stress-resistant and disease-resistant Changchun bream varieties. Summary of the invention

[0005] The invention aims to provide a primer for a microsatellite marker of bream, and an application and evaluation method thereof, and to establish a genetic diversity analysis technology of bream using microsatellites, which has high accuracy and can be used for evaluating the effect of later proliferation and release of bream, and can also effectively prevent inbreeding and the decline of germplasm resources.

[0006] The above technical objectives of the present invention are achieved through the following technical solutions:

[0007] 1. High-throughput sequencing

[0008] Individual DNA extraction of Parabramis pekinensis: The fin tissue of randomly selected Parabramis pekinensis individuals was preserved in anhydrous alcohol. After genomic DNA was detected by 1% agarose gel electrophoresis, it was stored at -20°C.

[0009] High-throughput sequencing of Parabramis pekinensis and mining of microsatellite loci: The genomic DNA of Parabramis pekinensis was randomly sequenced across the whole genome using the HiSeq2500 high-throughput sequencer (Illumina, USA) (sequencing service provided by Yuewei Gene Co., Ltd.), and second-generation sequencing data were obtained. After filtering out adapters and low-quality sequences, the MISA software was used to search for microsatellite loci.

[0010] 2. Screening of SSR sequences

[0011] The screening criteria include that when the repeat unit is dinucleotide, the number of repeats is greater than or equal to 6 times; when the repeat unit is trinucleotide, the number of repeats is greater than or equal to 5 times; when the repeat unit is tetranucleotide, the number of repeats is greater than or equal to 5 times; when the repeat unit is pentanucleotide, the number of repeats is at least 4; when the repeat unit is hexanucleotide, the number of repeats is greater than or equal to 4 times.

[0012] 3. Primer design

[0013] The primer3 software was used to design primers on the microsatellite flanking sequences. The main parameters of the designed primers were: GC content 40% - 60%; primer length 15 - 30 bp; annealing temperature 45 - 60°C; expected product length 100 - 400 bp.

[0014] 4. Screening of microsatellite markers

[0015] Forty pairs of microsatellite primers were randomly selected and synthesized. The 40 pairs of microsatellite markers obtained were subjected to PCR amplification, and primers with high polymorphism were screened and isolated for further temperature gradient screening analysis.

[0016] Synthesis and PCR amplification of fluorescently labeled microsatellite primers for Parabramis pekinensis: Ten pairs of microsatellite markers with high polymorphism and stable amplification were screened, and were respectively labeled with two fluorescent primers. After PCR amplification, the allele values were read. The specific primers for the 10 pairs of microsatellite markers are as follows:

[0017] Specific primers for microsatellite locus N771877:

[0018] F: CGCTGATTAATCCTCCTCCT, R: AATATTTACCTCGAGCCGCC

[0019] Specific primers for microsatellite locus N1004204:

[0020] F: GGGCATGAGCCCTCTTAGAT, R: TGTGAATGTGTCAGTGTTTCAGA

[0021] Specific primers for microsatellite locus N1229163:

[0022] F: CATGGGGTATGTCCTTGTACCT, R: TTGCGCTACAAAGTGATGCT

[0023] Specific primers for microsatellite locus N1765979:

[0024] F: CGTGCAAATGTGTTCATGTT, R: ACTTGATTGTGCTTGGCTGG

[0025] Specific primers for microsatellite locus N2548867:

[0026] F: GACTGTAAACGAAGCTCGGG, R: GCTGCTTCTTCAGTGACGC

[0027] Specific primers for microsatellite locus N2986794:

[0028] F: CGGAGAAATAGCGCAGACTC, R: CATCCAAGGGCATCGTAAGT

[0029] Specific primers for microsatellite locus N3407068:

[0030] F: GGCATGAACAGAAACCGAAT, R: AGAGAGCTGCTGTTTGCTGC

[0031] Specific primers for microsatellite locus N5571249:

[0032] F: TATTTCAGGAAGCACGGAGG, R: GGGCTGTGCATTTAAAGGTG

[0033] Specific primers for microsatellite locus N5671554:

[0034] F: TGCTGTATAAGTGCAGTTCATCATT, R: CCATGATGGTTAATCGCTACAA

[0035] Specific primers for microsatellite locus N5986326:

[0036] F: GCATTATTTAACGTGCAGCC, R: CTCAGGCTTAGGTGAGGGTG.

[0037] The primer combination obtained by the above screening was applied to the evaluation of the genetic diversity of Changchun bream.

[0038] 5. The method for evaluating the genetic diversity of Changchun bream includes the following steps

[0039] (1) obtaining DNA of bream to be analyzed;

[0040] (2) The 5′ end of the primer set is labeled with HEM;

[0041] (3) performing PCR amplification using the primer set to obtain a PCR amplification product;

[0042] (4) performing capillary electrophoresis detection on the PCR amplification products obtained in step (3), counting the number of alleles amplified by each pair of single-site primers, and obtaining statistical results;

[0043] (5) Record the amplification peaks of each primer pair, analyze and process the obtained data, and evaluate the genetic diversity of Changchun bream germplasm.

[0044] Further preferably, in step (1), when extracting and analyzing the DNA of Changchun bream, the abdominal muscle tissue of Changchun bream is used as the extraction sample.

[0045] Further preferably, the PCR amplification system (25 μL) comprises 12.5 μL of 2×Taq PCR Mix, 6.5 μL of double distilled water, 1 μL each of upstream and downstream primers (5'-FAM or 5'-HEX) and 4 μL of DNA template (100 ng / ul).

[0046] Further preferably, the PCR amplification program is 95°C for 5 min, 95°C for 30 s, 45-60°C for 30 s, and 72°C for 30 s for a total of 30 cycles, 95°C for 30 s, 53°C for 30 s, and 72°C for 30 s for a total of 10 cycles, and 60°C for 30 min.

[0047] Compared with the prior art, the present invention has the following beneficial effects:

[0048] The genetic diversity analysis technology of Changchun bream was established using microsatellites. It has high accuracy and can be used for late-stage individual identification of Changchun bream and evaluation of the effects of reproduction and release. It can also be used for population genetics analysis to effectively prevent inbreeding and the decline of germplasm resources. BRIEF DESCRIPTION OF THE DRAWINGS

[0049] Figure 1 is the frequency of occurrence of each base repeat type in Changchun bream;

[0050] Figure 2 This is the agarose electrophoresis detection diagram of the genomic DNA of Changchun bream;

[0051] Figure 3 It is the capillary electrophoresis detection diagram of PCR amplification products. Specific implementation manners

[0052] In order to enable those skilled in the art to better understand the technical solutions of the present invention, the present invention will be further described in detail below in conjunction with embodiments. Those skilled in the art will understand that the following embodiments are only used to illustrate the present invention and should not be regarded as limiting the scope of the present invention.

[0053] Embodiment

[0054] 1. High-throughput sequencing:

[0055] After randomly selecting the caudal fin rays of 3 healthy individuals of Parabramis pekinensis, they were placed in an anhydrous ethanol centrifuge tube. The genomic DNA of the samples was extracted using a DNA extraction kit (Qiagen). The sample DNA was detected by 1% agarose electrophoresis and stored at -20°C for later use. A genomic library was constructed and sequenced. The sequencing was commissioned to Yuewei Technology Co., Ltd. to complete using the Illumina HiSeq 2500 sequencing platform. Then, the MISA software was used to search for microsatellite loci, and 93,929 microsatellite sequences were obtained.

[0056] 2. Screening and identification of SSR sequences:

[0057] Statistical analysis was performed on the SSR occurrence frequency, repeat motif type, repeat times, and their polymorphisms.

[0058] Figure 1 is the proportion of each base repeat type of Parabramis pekinensis in all microsatellite sequences. Among them, dinucleotide repeats are the most main microsatellite type of Parabramis pekinensis, accounting for 73.51%. Followed by trinucleotide and mononucleotide repeats, accounting for 12.06% and 7.49% of all microsatellite sequences respectively. The first three account for 93.06% of all microsatellite sequences, while tetranucleotide (5.80%), pentanucleotide (1.03%), and hexanucleotide (0.11%) only account for 6.94% of all microsatellite sequences. At the same time, among the base repeat types, the dinucleotide repeat times are from 6 to 61 times, the trinucleotide are from 5 to 31 times, the tetranucleotide are from 7 to 27 times, the pentanucleotide are from 6 to 12 times, and the hexanucleotide are from 5 to 17 times. The larger the number of bases, the gradually decreasing repeat times and the fewer corresponding microsatellite numbers.

[0059] 3. Design and synthesis of SSR primers:

[0060] Batch design of SSR primers using primer3 (https: / / sourceforge.net / projects / primer3 / ). The primer design criteria are as follows: there is no SSR in the primer sequence; the sequence is within the DNA conserved sequence region; the length is between 15 - 30 bp; there is no complementary sequence between the upstream and downstream primers; there is no self-complementary sequence in the primer; the primer annealing temperature (Tm) is between 45 - 60 °C; the difference in Tm values between the upstream and downstream primers is ≤ 5 °C; the GC content is between 40% - 60%; the product size is 100 - 400 bp. Primers with 2 - 6 nucleotide repeat motifs were synthesized by Shanghai Sangon Biotech Co., Ltd. for SSR primer screening.

[0061] 4. Screening of primers:

[0062] The PCR reaction system (25 μL) contains 12.5 μL of 2×TaqPCR Mix, 6.5 μL of double-distilled water, 1 μL each of the upstream and downstream primers (5'-FAM or 5'-HEX), and 4 μL of DNA template (100 ng / μL). The PCR amplification program is 95 °C for 5 min, 30 cycles of 95 °C for 30 s, 45 - 60 °C for 30 s, and 72 °C for 30 s, 10 cycles of 95 °C for 30 s, 53 °C for 30 s, and 72 °C for 30 s, and 60 °C for 30 min.

[0063] After the PCR reaction, capillary electrophoresis is performed, and primers with different bands within the target range are counted according to the band migration. In this example, 10 pairs of primers were screened, and the primer sequences are shown in Table 1.

[0064] Table 1 Characteristics of 10 microsatellite markers of Parabramis pekinensis

[0065]

[0066]

[0067] 5. Genetic diversity analysis of primers in the released parental population of Parabramis pekinensis:

[0068] Twenty-seven Parabramis pekinensis parental populations were selected as test materials. Their abdominal muscles were collected and fixed in absolute ethanol and stored at -20 °C for later use.

[0069] Collect the abdominal muscles of the above population samples, and use the Axygen nucleic acid extraction DNA preparation kit from the United States to extract the genomic DNA of each sample. The concentration and purity of the test sample DNA were detected by a spectrophotometer and 1% agarose gel electrophoresis. The results are shown in Figure 2 Qualified DNA samples were stored in a -20 °C refrigerator for later use.

[0070] The reaction system of PCR (25 μL) contains 12.5 μL of 2× Taq PCR Mix, 6.5 μL of double-distilled water, 1 μL each of the upstream and downstream primers (5'-FAM or 5'-HEX), and 4 μL of DNA template (100 ng / μL). The amplification program of PCR is 5 min at 95 °C, 30 s at 95 °C, 30 s at 45 - 60 °C, 30 s at 72 °C for a total of 30 cycles, 30 s at 95 °C, 30 s at 53 °C, 30 s at 72 °C for a total of 10 cycles, and 30 min at 60 °C.

[0071] The above PCR amplification products were detected by capillary electrophoresis, and the presence and size of the product fragments were directly read out. The results are shown in Figure 3 .

[0072] The genetic diversity of Parabramis pekinensis was analyzed using the above statistical results. The specific method for analyzing the genetic diversity of Parabramis pekinensis is as follows: The POPGENE 3.2 software was used to analyze the observed heterozygosity (Ho), effective number of alleles (Ne), polymorphic information content (PIC), expected heterozygosity (He), and other genetic parameters of the parental population of Parabramis pekinensis, and the Hardy-Weinberg equilibrium (HWE) of each locus was tested. The results are shown in Table 2.

[0073] The results showed that the number of alleles detected at 10 loci was 37, the average number of alleles was 3.7, and the number of alleles per locus (Na) was 3 - 6; the polymorphic information content (PIC) was 0.392 - 0.654, and the average polymorphic information content was 0.4913. Except for the primers CH01, CH02, CH06, and CH10, the PIC of other microsatellite loci was > 0.5, all showing high polymorphism; the expected heterozygosity (He) was 0.429 - 0.733, and the average expected heterozygosity was 0.5743; the observed heterozygosity (Ho) was 0.250 - 0.813, and the average observed heterozygosity was 0.5091. In addition, all deviated from the Hardy-Weinberg index.

[0074] Table 2 Polymorphism parameters of 10 microsatellites

[0075]

[0076]

[0077] This specific embodiment is only an explanation of the present invention and is not a limitation thereof. Those skilled in the art can make modifications to this embodiment without creative contributions according to needs after reading this specification, but as long as it is within the scope of the claims of the present invention, it is protected by the patent law.

Claims

1. A primer composition for microsatellite markers of Parabramis pekinensis, characterized in that, The specific primer composition of the microsatellite markers consists of the following primers: Specific primers for microsatellite locus N771877: F: CGCTGATTAATCCTCCTCCT, R: AATATTTACCTCGAGCCGCC; Specific primers for microsatellite locus N1004204: F: GGGCATGAGCCCTCTTAGAT, R: TGTGAATGTGTCAGTGTTTCAGA; Specific primers for microsatellite locus N1229163: F: CATGGGGTATGTCCTTGTACCT, R: TTGCGCTACAAAGTGATGCT; Specific primers for microsatellite locus N1765979: F: CGTGCAAATGTGTTCATGTT, R: ACTTGATTGTGCTTGGCTGG; Specific primers for microsatellite locus N2548867: F: GACTGTAAACGAAGCTCGGG, R: GCTGCTTCTTCAGTGACGC; Specific primers for microsatellite locus N2986794: F: CGGAGAAATAGCGCAGACTC, R: CATCCAAGGGCATCGTAAGT; Specific primers for microsatellite locus N3407068: F: GGCATGAACAGAAACCGAAT, R: AGAGAGCTGCTGTTTGCTGC; Specific primers for microsatellite locus N5571249: F: TATTTCAGGAAGCACGGAGG, R: GGGCTGTGCATTTAAAGGTG; Specific primers for microsatellite locus N5671554: F: TGCTGTATAAGTGCAGTTCATCATT, R: CCATGATGGTTAATCGCTACAA; and Specific primers for microsatellite locus N5986326: F: GCATTATTTAACGTGCAGCC, R: CTCAGGCTTAGGTGAGGGTG.

2. Use of the primer composition according to claim 1 in evaluating the genetic diversity of Parabramis pekinensis.

3. A method for evaluating the genetic diversity of Parabramis pekinensis, characterized in that, It includes the following steps: (1) Take the DNA of Parabramis pekinensis to be analyzed; (2) Label the 5' end of the primer set with HEM; (3) Perform PCR amplification using the primer composition according to claim 1 to obtain a PCR amplification product; (4) Perform capillary electrophoresis detection on the PCR amplification product obtained in step (3), count the number of alleles amplified by each pair of single-locus primers, and obtain a statistical result; (5) Record the amplification peak pattern of each pair of primers, analyze and process the obtained data, and evaluate the genetic diversity of the Parabramis pekinensis germplasm.

4. The method for evaluating the genetic diversity of Parabramis pekinensis according to claim 3, characterized in that: In step (1), when extracting and analyzing the DNA of Parabramis pekinensis, the abdominal muscle tissue of Parabramis pekinensis is used as the extraction sample.

5. A method for evaluating the genetic diversity of Parabramis pekinensis according to claim 3, characterized in that: The volume of the PCR amplification system is 25 µL. The PCR amplification system contains 12.5 μL of 2×Taq PCR Mix, 6.5 μL of double-distilled water, 1 µL each of the upstream and downstream primers, and 4 μL of DNA template; the modification group of the primers is 5'-FAM or 5'-HEX, and the concentration of the DNA template is 100 ng / ul.

6. The method for evaluating the genetic diversity of Parabramis pekinensis according to claim 3, characterized in that: The PCR amplification program is 5 min at 95°C, 30 cycles of 30 s at 95°C, 30 s at 45 - 60°C, and 30 s at 72°C, 10 cycles of 30 s at 95°C, 30 s at 53°C, and 30 s at 72°C, and 30 min at 60°C.

Citation Information

Patent Citations

  • Microsatellite molecular marker sites of platichthys stellatus and primers

    CN104975012A

  • Parabramis pekinensis population genetic diversity analysis and excellent parent screening method

    CN116769932A