A NELL1 gene methylation detection reagent and its application

Abstract

The present invention discloses a NELL1 gene methylation detection reagent and its application, wherein the NELL1 gene methylation detection reagent comprises: a forward primer having a sequence as shown in SEQ ID NO: 1 and a reverse primer having a sequence as shown in SEQ ID NO: 2; and / or a forward primer having a sequence as shown in SEQ ID NO: 4 and a reverse primer having a sequence as shown in SEQ ID NO: 5. The NELL1 gene methylation detection reagent prepared by the scheme of the present invention has a short target sequence obtained by amplification and high amplification efficiency, can accurately detect a methylation ratio of 0.5% under a 200ng DNA background, is simple to operate, fast and low-cost, and is suitable for clinical detection.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and particularly relates to a NELL1 gene methylation detection reagent and application thereof. Background Art

[0002] Cervical cancer is the fourth most common female malignancy in the world, which seriously threatens women's health and creates heavy social and economic burdens. Persistent infection with human papilloma virus (HPV) is a necessary factor for the occurrence of cervical cancer. Persistent high-risk HPV infection can lead to high-grade cervical intraepithelial neoplasia (CIN), which then develops into cancer. Persistent high-risk HPV infection is the main cause of cervical intraepithelial neoplasia and cervical cancer.

[0003] The occurrence and development of cervical cancer is a slow process, usually lasting 10-30 years, which provides an excellent time window for the screening and prevention of cervical cancer. By screening for early cervical precancerous lesions, the cure rate is 100%. At present, the main screening methods are liquid-based cytology testing (TCT) and HPV testing, but the sensitivity of cytology testing is low, only about 60%, and the specificity of HPV testing is poor. Using cytology testing, 40-60% of ASCUS patients (changes in atypical cells with no clear meaning) test HPV positive, but less than 1% of patients will be diagnosed with cancer. The problems of missed diagnosis and overdiagnosis caused by the shortcomings of the above two methods have always plagued the clinic. There is an urgent need for new detection methods to accurately identify high-grade lesions for cervical cancer screening.

[0004] DNA methylation is an epigenetic modification of DNA, a process in which a methyl group is added to the 5' carbon atom of cytosine by methyltransferase. DNA methylation plays an important role in the occurrence and development of many diseases. Abnormal methylation is directly related to the progression of cervical cancer. Methylation is the most promising clinical diagnostic and therapeutic marker. Therefore, it is urgent to find and develop a highly sensitive and specific molecular marker methylation detection kit for cervical cancer, which can provide strong support for the early diagnosis of cervical cancer. Summary of the invention

[0005] The present invention aims to solve at least one of the technical problems existing in the above-mentioned prior art. To this end, the present invention provides a NELL1 gene methylation detection reagent.

[0006] The present invention also provides an application of the NELL1 gene methylation detection reagent.

[0007] The present invention also provides a kit containing the NELL1 gene methylation detection reagent.

[0008] In the first aspect of the present invention, a NELL1 gene methylation detection reagent is provided, comprising a forward primer having a sequence as shown in SEQ ID NO: 1 and a reverse primer having a sequence as shown in SEQ ID NO: 2; and / or a forward primer having a sequence as shown in SEQ ID NO: 4 and a reverse primer having a sequence as shown in SEQ ID NO: 5.

[0009] In some embodiments of the present invention, the NELL1 gene methylation detection reagent further comprises a fluorescent probe sequence having a nucleotide sequence such as SEQ ID NO: 3 and / or SEQ ID NO: 6.

[0010] In some embodiments of the present invention, the 5' end of the fluorescent probe sequence has a fluorescent group, and the 3' end has a quenching group; the fluorescent group is VIC, ROX, FAM, Cy5, HEX, TET, JOE, NED or TexasRed; the quenching group is TAMRA, BHQ, MGB or Dabcyl.

[0011] In some embodiments of the present invention, the NELL1 gene methylation detection reagent is used to detect the sequence of the NELL1 gene modified by a conversion reagent; the conversion reagent is a reagent that converts unmethylated cytosine in DNA into uracil while leaving 5-MeC substantially unaffected.

[0012] In some embodiments of the present invention, the conversion reagent includes a hydrazine salt, a bisulfite (such as sodium bisulfite, etc.), a bisulfite (such as sodium metabisulfite, potassium bisulfite, cesium bisulfite, ammonium bisulfite, etc.) or a reagent that can produce one or more of the compounds of a hydrazine salt, a bisulfite, and a bisulfite under appropriate reaction conditions.

[0013] In some embodiments of the invention, the conversion reagent is bisulfite.

[0014] In some embodiments of the present invention, the bisulfite conversion in the embodiments of the present invention includes but is not limited to conversion using a commercial kit, or conversion using homemade or purchased bisulfite. The bisulfite conversion kit is composed of CT Conversion Reagent dry powder, M-Dissolving Buffer, M-Dilution Buffer, M-Binding Buffer, M-Wash Buffer, M-DesμLphonation Buffer, M-Elution Buffer, and MagBinding Beads, and the preparation method of the bisulfite conversion reagent comprises the following steps: adding CT Conversion Reagent dry powder to water, M-Dissolving Buffer, and M-Dilution Buffer, mixing until the dry powder is completely dissolved, and storing at -20°C for use.

[0015] In some embodiments of the present invention, the water is sterile enzyme-free water.

[0016] In some embodiments of the present invention, the NELL1 gene methylation detection reagent is used to detect a sequence modified by bisulfite.

[0017] In some embodiments of the present invention, the detection region of the NELL1 gene targeted by the detection reagent for NELL1 gene methylation is the NELL1 gene or its promoter region.

[0018] In some embodiments of the present invention, the detection region of the NELL1 gene targeted by the detection reagent for NELL1 gene methylation is a CG-enriched region or a non-CG-enriched region of the NELL1 gene.

[0019] In some embodiments of the present invention, the detection region targeted by the NELL1 gene methylation detection reagent is a CG-enriched region of the NELL1 gene.

[0020] In some embodiments of the present invention, the detection region of the NELL1 gene targeted by the NELL1 gene methylation detection reagent is a sequence as shown in SEQ ID NO: 10 or SEQ ID NO: 11. The selection of the NELL1 gene detection region will affect the detection efficiency of tumors, and the detection results of primers designed according to different CG-enriched regions of the NELL1 gene are significantly different.

[0021] In some embodiments of the present invention, the detection reagent for NELL1 gene methylation further comprises a detection reagent for an internal reference gene.

[0022] In some embodiments of the present invention, the internal reference gene is ACTB or GAPDH gene.

[0023] In some embodiments of the present invention, the internal reference gene is ACTB.

[0024] In some embodiments of the present invention, the detection reagent containing the internal reference gene contains the primer pair shown in SEQ ID NO:7 and SEQ ID NO:8, and the probe of SEQ ID NO:9.

[0025] In some embodiments of the present invention, the detection sample of the NELL1 gene methylation detection reagent is selected from cervical cancer tissue, blood, serum or plasma.

[0026] In a second aspect of the present invention, a kit is provided, wherein the kit contains the above-mentioned NELL1 gene methylation detection reagent.

[0027] In some embodiments of the present invention, the kit further comprises a PCR reaction solution, wherein the PCR reaction solution is 1×Hieff TaqMan mμLtiplex qPCR master mix.

[0028] In some embodiments of the present invention, the kit also includes a positive control and a negative control, the positive control is gDNA of SiHa cell strain, Caski cell strain, ME-180 cell strain, etc. (the cell strain is a cell strain that is highly methylated in the gene region detected by the present invention as verified by Sanger sequencing), and the negative control is gDNA of C-33A cell strain, etc. (a cell strain that is not methylated or has a very low degree of methylation in the gene region detected by the present invention as verified by Sanger sequencing).

[0029] In some embodiments of the present invention, the positive control is gDNA of ME-180 cell line, and the negative control is gDNA of C-33A cell line.

[0030] In a third aspect of the present invention, there is provided an application of the above-mentioned NELL1 gene methylation detection reagent, wherein the application is an application in preparing a cervical cancer diagnostic reagent or kit.

[0031] In some embodiments of the present invention, the cervical cancer diagnostic reagent or kit is used to detect the sequence of the NELL1 gene modified by a conversion reagent; the conversion reagent refers to a reagent that converts unmethylated cytosine in DNA into uracil while leaving 5-MeC substantially unaffected.

[0032] In some embodiments of the present invention, the conversion reagent includes a hydrazine salt, a bisulfite (such as sodium bisulfite, etc.), a bisulfite (such as sodium metabisulfite, potassium bisulfite, cesium bisulfite, ammonium bisulfite, etc.) or a reagent that can produce one or more of the compounds of a hydrazine salt, a bisulfite, and a bisulfite under appropriate reaction conditions.

[0033] In some embodiments of the present invention, the conversion reagent is a bisulfite reagent.

[0034] In some embodiments of the present invention, the bisulfite conversion in the embodiments of the present invention includes but is not limited to conversion using a commercial kit, or conversion using homemade or purchased bisulfite. The bisulfite commercial kit consists of CT Conversion Reagent dry powder, M-Dissolving Buffer, M-Dilution Buffer, M-Binding Buffer, M-Wash Buffer, M-DesμLphonation Buffer, M-Elution Buffer, and MagBinding Beads; the preparation method of the bisulfite conversion reagent comprises the following steps: adding CT Conversion Reagent dry powder to water, M-Dissolving Buffer, and M-Dilution Buffer, mixing until the dry powder is completely dissolved, and storing at -20°C for later use.

[0035] In some embodiments of the present invention, the cervical cancer diagnostic reagent or kit is used to detect sequences modified by bisulfite.

[0036] In some embodiments of the present invention, the detection region of the NELL1 gene targeted by the cervical cancer diagnostic reagent or kit is the NELL1 gene or its promoter region.

[0037] In some embodiments of the present invention, the detection region of the NELL1 gene targeted by the cervical cancer diagnostic reagent or kit is a CG-enriched region or a non-CG-enriched region or a CTCF (CTCF-binding sites) region of the NELL1 gene.

[0038] In some embodiments of the present invention, the detection region targeted by the cervical cancer diagnostic reagent or kit is the CG-enriched region or CTCF (CTCF-binding sites) region of the NELL1 gene.

[0039] In some embodiments of the present invention, the detection region of the NELL1 gene targeted by the cervical cancer diagnostic reagent or kit is a sequence as shown in SEQ ID NO: 10 or SEQ ID NO: 11. The selection of the detection region of the NELL1 gene will affect the detection efficiency of the tumor, and the detection results of primers designed according to different CG-enriched regions of the NELL1 gene will be significantly different.

[0040] In some embodiments of the present invention, the method for using the cervical cancer diagnostic reagent or kit comprises the following steps:

[0041] S1, treating the sample to be tested with bisulfite, bisulfite or hydrazine salt to obtain a modified sample to be tested;

[0042] S2. Using the above-mentioned detection reagent for detecting the methylation of the NELL1 gene, the modified sample in step S1 is subjected to detection of the methylation status of the NELL1 gene.

[0043] In some embodiments of the present invention, the detection in step S2 is performed using real-time fluorescent quantitative methylation-specific polymerase chain reaction.

[0044] In some embodiments of the present invention, the amplification procedure of the real-time fluorescent quantitative methylation-specific polymerase chain reaction is:

[0045] 92-97 ℃ 8-12min

[0046] 92-97 ℃ 13-17s 40-50cycles

[0047] 56-64℃(collect fluorescence) 0.5-1.5min 40-50cycles

[0048] 16-22℃ 0.5-1.5min.

[0049] According to the embodiments of the present invention, at least the following beneficial effects are achieved: the NELL1 gene methylation detection reagent prepared by the scheme of the present invention has a short target sequence obtained by amplification, has a high amplification efficiency, can accurately detect a methylation ratio of 0.5% in a 200ng DNA background, is simple, fast, and low-cost to operate, and is suitable for clinical testing. BRIEF DESCRIPTION OF THE DRAWINGS

[0050] The present invention will be further described below with reference to the accompanying drawings and embodiments, wherein:

[0051] Figure 1 This is the PCR amplification diagram of the positive control (ME-180 cell line) in Example 3 of the present invention;

[0052] Figure 2This is the PCR amplification diagram of the negative control (C-33A cell line) in Example 3 of the present invention;

[0053] Figure 3 This is the PCR amplification diagram of the normal sample in Example 3 of the present invention;

[0054] Figure 4 This is the PCR amplification diagram of the cervical cancer positive sample in Example 3 of the present invention;

[0055] Figure 5 This is a diagram of methylation multiple dilution amplification under a 200 ng DNA background in Example 4 of the present invention. DETAILED DESCRIPTION

[0056] The following will be combined with the embodiments to clearly and completely describe the concept of the present invention and the technical effects produced, so as to fully understand the purpose, characteristics and effects of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of them. Based on the embodiments of the present invention, other embodiments obtained by those skilled in the art without creative work are all within the scope of protection of the present invention.

[0057] Example 1 Detection reagent for NELL1 gene methylation

[0058] The preparation method of the detection reagent for NELL1 gene methylation is as follows: by performing bioinformatics analysis and mining on the methylation data and gene expression data of cervical cancer in the Cancer Genome Atlas (TCGA), setting the methylation Beta Value of 90% cervical cancer tissues to be greater than 0.5 and the methylation Beta Value of normal tissues to be greater than 0.5. Value<0.2 was used for initial data screening, and then sites with large differences between cervical cancer tissues and normal tissues were selected to find CpG sites with significant differences in methylation levels between cervical cancer tissues and normal tissues. After analysis and screening, multiple methylation sites with significant differences were selected; Sanger sequencing technology after sulfite treatment was used to verify these methylation sites in the cervical cancer cell line ME-180, 10 cervical cancer positive samples and 10 normal population samples, and it was found that the CpG site of the NELL1 gene located in the region chr11:20690588-20690857 was highly methylated in cervical cancer positive cell lines or samples, but in samples of normal populations, the above CpG sites were not methylated or a small number of CpG sites were lowly methylated.

[0059] The original sequence of region chr11:20690588-20690857 is as follows:

[0060] GAGTAATTGTTTTCCGAGGGGGTCCGTGCGCGCTCGGTGGCGCCGCCTCGGTCTG

[0061] GGTTCCCCCGAGGAAAAATACCCACCCGCGAGGGCTCGGCGGCTTTTCGACTCGG

[0062] CGGGGATGAACTGTGGCAACTTCGGCAGCCCCCACCGCGGTGCGGAAGTAAAGA

[0063] GGGCAACATTGGCGACTGCGGCTCGGAGGGGCTGGAGCGCGTGAAGCCGTGGGG

[0064] GCGCCGTGCGCCTCCCGCTCTCTCGTTTCGGCCGCAGGTCCTGGGACTCCGA (SEQ ID NO: 12).

[0065] 1. Selection of detection area

[0066] Since the methylation status and distribution of the same gene are not uniform, for the same gene, the diagnostic detection efficiency of methylation primers and probe detection systems designed in different regions is different for the same sample and the same tumor. Sometimes, an inappropriate selected region may result in no diagnostic effect on the tumor. After repeated research and comparison, the inventors screened the NELL1 gene region chr11:20690588-20690857, and then screened the two target region sequences (region 1 and region 2) with the best methylation detection of NELL1 gene from the NELL1 gene region chr11:20690588-20690857. The nucleotide sequences of region 1 and region 2 are shown in Table 1.

[0067] Table 1

[0068]

[0069] 2. Design primer and probe sequences for the two regions respectively:

[0070] For region 1, forward primer NELL1-MF1, reverse primer NELL1-MR1, and probe sequence NELL1-MP1 were designed and screened. For region 2, forward primer NELL1-MF2, reverse primer NELL1-MR2, and probe sequence NELL1-MP2 were designed and screened. For the internal reference gene ACTB, forward primer BS-ACT-F, reverse primer BS-ACT-R, and probe BS-ACT-P were designed and screened. The sequences are shown in Table 2.

[0071] Table 2

[0072]

[0073] The cell line ME-180 (purchased from the cell bank of the Chinese Academy of Sciences in Shanghai, China) and gDNA of exfoliated cells collected from 5 cases of clinical cervical cancer positive patients from Changsha Maternal and Child Health Hospital were used as templates, and primer probe combinations designed for two different regions were used for amplification (gDNA was extracted using a nucleic acid extraction and purification kit purchased from Renhe Future Biotechnology (Changsha) Co., Ltd.). The amplification system was: 1×Hieff TaqMan mμLtiplex qPCR master mix (purchased from Shanghai Yisheng Bio) 12.5μL, the final concentration of the primer probe of the target gene (the primer probe combination designed for two different regions) is 0.2μM, the final concentration of the primer probe group BS-ACT-F, BS-ACT-R and BS-ACT-P of the internal reference gene is 0.2μM, 25ng of gDNA to be tested, and sterile water is added to the total volume of 25μL. The amplification program is: 95℃, 10min; 95℃, 15sec, 60℃, 1min (collecting fluorescence), 45cycles; 20℃, 1min. The screening test was carried out with sterile water as the negative reference (NTC). The specific results of the test are shown in Table 3. It can be seen from Table 3 that although the primer probe combination designed for region 2 can also distinguish cervical cancer samples to a certain extent, the primer probe combination designed for region 1 is more sensitive to positive samples. Therefore, the primer probe combination designed for region 1 is preferred for subsequent research.

[0074] Table 3

[0075]

[0076] Note: When the FAM channel test result is NoCt, it means △Ct>9, which is judged as negative.

[0077] Example 2

[0078] In this example, a multiplex fluorescent PCR kit for detecting methylation of the cervical cancer molecular marker NELL1 gene was prepared, including the primer probe sets NELL1-MF1, NELL1-MR1 and NELL1-MP1 prepared in Example 1, the primer probe sets BS-ACT-F, BS-ACT-R and BS-ACT-P of the internal reference gene, a PCR reaction solution, a positive control and a negative control.

[0079] The final concentration of the primer probe in the final reaction system was 0.2 μM. The PCR reaction solution of the NELL1 gene also included: enzyme-free sterile water (purchased from Beijing Solebow Technology Co., Ltd.), 2×Hieff TaqMan mμLtiplex qPCR master mix (purchased from Shanghai Yisheng Biotechnology); 2×Hieff The final concentration of TaqMan mμLtiplex qPCR master mix in the final reaction system was 1×; the positive control was cell line ME-180 gDNA (purchased from the Cell Bank of the Chinese Academy of Sciences, Shanghai, China), and the negative control was cell line C-33A gDNA (purchased from the Cell Bank of the Chinese Academy of Sciences, Shanghai, China), both at a concentration of 10 ng / μL.

[0080] Example 3 Application of multiplex fluorescent PCR kit in diagnosis of cervical cancer

[0081] This example tests the application of the multiplex fluorescent PCR kit prepared in Example 2 in the diagnosis of cervical cancer. The specific process is as follows:

[0082] 1. Acquisition of biological samples

[0083] All samples in the present invention are 96 cervical exfoliated cell specimens collected in Changsha Maternal and Child Health Hospital from April 2021 to October 2021, including 30 healthy people, 22 high-grade squamous intraepithelial lesion (HSIL) specimens, 20 low-grade squamous intraepithelial lesion (LSIL) specimens, 20 cervical cancer CA specimens, and 4 samples of other cancers (including 1 ovarian cancer sample and 3 endometrial cancer samples).

[0084] 2. Sample extraction

[0085] All cervical exfoliated cells in the present invention were extracted using a nucleic acid extraction and purification kit purchased from Renhe Future Biotechnology (Changsha) Co., Ltd. The specific operation steps are as follows.

[0086] (1) Take 1 mL of cervical exfoliated cell preservation solution and put it into 1.5 mL centrifuge medium. Centrifuge at 16000 rpm for 3 min and discard the supernatant.

[0087] (2) Add 200 μL of deionized water, 300 μL of Lysis buffer, and 10 μL of Proteinase K, vortex thoroughly to mix, and place in a 55°C water bath for 60 min, mixing every 15 min.

[0088] (3) Remove the centrifuge tube, add 300 μL Binding buffer and 20 μL magnetic beads, mix by inversion for 10 min, and centrifuge briefly;

[0089] (4) Place the centrifuge tube on a magnetic rack to allow the magnetic beads in the tube to be adsorbed and discard the liquid in the tube;

[0090] (5) Add 500 μL Wash buffer I, vortex to mix, place on a magnetic stand for 1 min, discard the supernatant, and remove the centrifuge tube;

[0091] (6) Add 500 μL Wash buffer II, vortex to mix, place on a magnetic stand for 1 min, remove the supernatant, and take out the centrifuge tube;

[0092] (7) Add 500 μL Wash buffer II, vortex to mix, place on a magnetic stand for 1 min, and remove the supernatant;

[0093] (8) Remove the remaining supernatant in the tube with a pipette, add 50 μL of Elution buffer, resuspend, and place in a 55°C metal bath for 10 min, shaking gently;

[0094] (9) Place on the magnetic rack for 1 min and transfer the supernatant to a new centrifuge tube, which is the sample DNA to be tested.

[0095] 3 DNA bisulfite conversion and purification.

[0096] The methylation conversion kit used was EZ-96 DNA Methylation-Gold MagPrep (purchased from ZymoResearch). The operation was performed strictly in accordance with the kit instructions. The specific conversion and purification steps are as follows:

[0097] 1) Add 20 μL of the sample DNA prepared in step 2 to a 0.2 mL PCR 8-tube strip, then add 130 μL of CT Conversion Reagent, cover the PCR 8-tube strip and mark it, vortex to mix, and centrifuge instantly.

[0098] 2) Place the PCR 8 tube into the PCR instrument. The PCR program is as shown in Table 4:

[0099] Table 4

[0100] temperature time 98℃ 10min 64℃ 3h 4℃ Keep

[0101] 3) Prepare a 1.5mL centrifuge tube, add 600μL M-Binding Buffer and 10μL magnetic beads (M-BindingBeads) suspension (vortex thoroughly before use). Take out the sample from step 2) from the PCR instrument, and transfer the liquid in the tube to the corresponding 1.5mL centrifuge tube according to the number, vortex mix for 30s, and let it stand at room temperature for 5min.

[0102] 4) Briefly centrifuge, place on a magnetic rack and adsorb until clarified, discard the supernatant.

[0103] 5) Add 400 μL M-Wash Buffer (shake gently before use), vortex mix for 30 seconds, centrifuge. Place on a magnetic rack to adsorb until clear, and discard the supernatant.

[0104] 6) Add 200 μL M-DesμLphontion Buffer, vortex mix for 30 s, vortex mix for 30 s, leave at room temperature for 15 min (invert and mix during this period), centrifuge, place on a magnetic rack for adsorption until clear, and discard the supernatant.

[0105] 7) Add 400 μL M-Wash Buffer, vortex mix for 30 seconds, centrifuge, place on a magnetic rack and adsorb until clear, and discard the supernatant.

[0106] 8) Repeat step 7) once and discard the residual liquid.

[0107] 9) Incubate in a metal bath at 55°C for 5 min (with lid open) until dry.

[0108] 10) Add 25-60 μL M-Elution Buffer, suspend the magnetic beads, incubate in a metal bath at 55°C for 4 min (without opening the lid), centrifuge briefly, place on a magnetic rack for adsorption until clarified, transfer the supernatant to a new 1.5 mL centrifuge tube. The collected supernatant is BS-DNA, which is used for subsequent PCR detection. If long-term storage is required, place it at -80°C.

[0109] 4 PCR detection

[0110] The fluorescent quantitative PCR instrument used in the present invention is the Hongshi fully automatic medical PCR analysis system (SLAN-96S), and the PCR amplification system and procedure are as follows:

[0111] The PCR amplification system is shown in Table 5.

[0112] Table 5

[0113]

[0114] The on-machine detection was carried out according to the instructions of each fluorescent PCR and the PCR program was set.

[0115] The PCR reaction program is shown in Table 6.

[0116] Table 6

[0117]

[0118] The results are as follows Figure 1-4 As shown, Figure 1 This is the PCR amplification diagram of the positive control (ME-180 cell line). Figure 2 is the PCR amplification diagram of the negative control (C-33A cell line); Figure 3 This is the PCR amplification diagram of normal cervical cells; Figure 4 This is the PCR amplification diagram of cervical cancer cells. It can be seen from the figure that in the positive control and cervical cancer cells, the Ct of the internal reference gene ACTB is ≤35, and △Ct ≤9, which is positive. In the negative control and normal cervical tissue, Ct ≤35, △Ct>9, which is negative.

[0119] 5. Interpretation of results

[0120] Threshold setting: The thresholds for FAM and HEX were both set at 0.12.

[0121] The results (ΔCt=FAMCt-HEXCt) are shown in Table 7.

[0122] Table 7

[0123]

[0124]

[0125] 6 Distribution of methylation detection of NELL1 gene in cervical cancer samples and normal samples

[0126] The above method and primer probe set were used to detect cervical cancer samples and normal samples, and the results are shown in Table 8. The results showed that NELL1 gene methylation was not detected in 30 normal samples, but was detected in 20 of 20 cervical cancer samples. At the same time, the methylation ratio of NELL1 gene increased with the progression of cervical cancer, and was higher in CIN2. + (i.e. HSIL level) with a sensitivity of 83.33% and a specificity of 88.89%, which can provide useful guidance for early screening of clinical cervical cancer.

[0127] Table 8 Statistical results of NELL1 methylation detection in cervical cancer samples and normal sample groups

[0128]

[0129] Example 4 Sensitivity Test

[0130] The kit of the present invention was used to detect methylation rates of different proportions in a 200 ng DNA background, and the methylation sensitivity of the kit of the present invention in a 200 ng DNA background was evaluated.

[0131] The present invention selects cell line ME-180 as a 100% methylation sample and cell line C-33A as a 0% methylation sample. Both cell lines were purchased from the cell bank of the Chinese Academy of Sciences in Shanghai, China. The extraction steps of cell line DNA are consistent with those in Example 3, and the extracted DNA is measured for DNA concentration by Qubit 2.0 fluorescence quantification instrument (purchased from Thermofisher Scientific). ME-180 and C-33A are first diluted to a concentration of 10 ng / μL, and then diluted in multiples according to different ratios to become reference products with different methylation ratios. The specific methylation ratio reference product preparation is shown in Table 9.

[0132] Table 9

[0133]

[0134]

[0135] The steps of bisulfite conversion of reference DNA with different methylation ratios were the same as step 3 of Example 3, and the amount of DNA input was 200 ng DNA.

[0136] The converted BS-DNA was used as a template and PCR detection was performed according to step 4 in Example 3. The amplification results were as follows: Figure 5 The result analysis and interpretation were performed with reference to the result interpretation method in Example 3, and the specific detection results are shown in Table 10. As can be seen from Table 10, the kit of the present invention can accurately detect a methylation ratio of 0.5% in a 200ng DNA background.

[0137] Table 10 Detection Ct values ​​and interpretation of reference substances with different methylation ratios

[0138] Reference methylation ratio HEX Ct FAM Ct △Ct Interpretation of results 50% methylation 32.26 31.39 -0.87 Positive 10% methylation 32.21 33.15 0.94 Positive 5% methylation 32.23 33.94 1.71 Positive 1% methylation 32.08 36.15 4.07 Positive 0.5% methylation 32.31 37.85 5.54 Positive 0.1% methylation 32.06 44.05 11.99 Negative 0% methylation 32.12 NoC ＞9 Negative

[0139] Note: When the FAM channel test result is NoCt, it means △Ct>9, which is judged as negative.

[0140] The embodiments of the present invention are described in detail above in conjunction with the accompanying drawings, but the present invention is not limited to the above embodiments. Various changes can be made within the knowledge of ordinary technicians in the relevant technical field without departing from the purpose of the present invention. In addition, the embodiments of the present invention and the features in the embodiments can be combined with each other without conflict. Sequence Listing <110> Renhe Future Biotechnology (Changsha) Co., Ltd. <120> A NELL1 gene methylation detection reagent and its application <160> 12 <170> SIPOSequenceListing 1.0 <210> 1 <211> 19 <212> DNA <213> Artificial Sequence <400> 1 cggtcgaaac gagagagcg 19 <210> 2 <211> 25 <212> DNA <213> Artificial Sequence <400> 2 aaactataac aacttcgaca acccc 25 <210> 3 <211> 26 <212> DNA <213> Artificial Sequence <400> 3 cgtacggcgt ttttacggtt ttacgc 26 <210> 4 <211> twenty three <212> DNA <213> Artificial Sequence <400> 4 cggggatgaa ttgtggtaat ttc 23 <210> 5 <211> twenty one <212> DNA <213> Artificial Sequence <400> 5 tacgaccgaa acgaaaaaac g 21 <210> 6 <211> 25 <212> DNA <213> Artificial Sequence <400> 6 aaaacgcacg acgccccccac gactt 25 <210> 7 <211> 26 <212> DNA <213> Artificial Sequence <400> 7 gagagaatta gtgagaaagg gtgtag 26 <210> 8 <211> 29 <212> DNA <213> Artificial Sequence <400> 8 aataacccaa ataaataacc cactacctc 29 <210> 9 <211> 31 <212> DNA <213> Artificial Sequence <400> 9 tctaataacc acctccctcc ttcctaacct c 31 <210> 10 <211> 135 <212> DNA <213> Artificial Sequence <400> 10 cggtcgaaac gagagagcgg gaggcgtacg gcgtttttac ggttttacgc gttttagttt 60 tttcgagtcg tagtcgttaa tgttgttttt tttattttcg tatcgcggtg ggggttgtcg 120 aagttgttat agttt 135 <210> 11 <211> 144 <212> DNA <213> Artificial Sequence <400> 11 cggggatgaa ttgtggtaat ttcggtagtt tttatcgcgg tgcggaagta aagagggtaa 60 tattggcgat tgcggttcgg aggggttgga gcgcgtgaag tcgtgggggc gtcgtgcgtt 120 tttcgttttt tcgtttcggt cgta 144 <210> 12 <211> 270 <212> DNA <213> Artificial Sequence <400> 12 gagtaattgt tttccgaggg ggtccgtgcg cgctcggtgg cgccgcctcg gtctgggttc 60 ccccgaggaa aaatacccac ccgcgagggc tcggcggctt ttcgactcgg cggggatgaa 120 ctgtggcaac ttcggcagcc cccaccgcgg tgcggaagta aagagggcaa cattggcgac 180 tgcggctcgg aggggctgga gcgcgtgaag ccgtgggggc gccgtgcgcc tcccgctctc 240 tcgtttcggc cgcaggtcct gggactccga 270

Claims

1. Use of a NELL1 gene methylation detection reagent in the preparation of a cervical cancer diagnostic reagent or kit, characterized in that: The NELL1 gene methylation detection reagent comprises: a forward primer having a sequence as shown in SEQ ID NO: 1 and a reverse primer having a sequence as shown in SEQ ID NO: 2; and / or a forward primer having a sequence as shown in SEQ ID NO: 4 and a reverse primer having a sequence as shown in SEQ ID NO:

5.

2. The use according to claim 1, characterized in that: The NELL1 gene methylation detection reagent also includes a fluorescent probe sequence with a nucleotide sequence such as SEQ ID NO: 3 and / or SEQ ID NO:

6.

3. The use according to claim 1, characterized in that: The NELL1 gene methylation detection reagent also includes a detection reagent for an internal reference gene.

4. The use according to claim 3, characterized in that: The internal reference gene is ACTB or GAPDH.

5. The use according to claim 3, characterized in that: The detection reagent of the internal reference gene contains primers and probes targeting the internal reference gene.

6. The use according to claim 1, characterized in that: The detection sample of the NELL1 gene methylation detection reagent is selected from cervical cancer tissue, cervical cancer exfoliated cells, blood, serum or plasma.

7. A kit, characterized in that: Contains the NELL1 gene methylation detection reagent as described in any one of claims 1 to 6.

8. The kit according to claim 7, characterized in that The kit also includes a positive control and a negative control, wherein the positive control is selected from one of the gDNAs of SiHa cell strain, Caski cell strain and ME-180 cell strain, and the negative control is the gDNA of C-33A cell strain.

9. The use according to any one of claims 1 to 6, characterized in that: The cervical cancer diagnostic reagent or kit is used to detect the sequence of the NELL1 gene modified by the conversion reagent.

10. The use according to claim 9, characterized in that: The conversion reagent is selected from one or more of hydrazine salts, bisulfite and bisulfite.

11. The use according to claim 10, characterized in that: The conversion reagent is bisulfite.

12. The use according to any one of claims 1 to 6, characterized in that: The detection region of the NELL1 gene targeted by the NELL1 gene methylation detection reagent is the sequence shown in SEQ ID NO: 10 or SEQ ID NO:

11.

13. The use according to any one of claims 1 to 6, characterized in that: The method for using the cervical cancer diagnostic reagent or kit comprises the following steps: S1, treating the sample to be tested with bisulfite, bisulfite or hydrazine salt to obtain a modified sample to be tested; S2. Using the NELL1 gene methylation detection reagent described in any one of claims 1 to 6 or the kit described in any one of claims 7 to 8, the modified sample in step S1 is subjected to NELL1 gene methylation detection.

Images