Method for producing nucleic acid oligomer

Abstract

The present invention aims to provide a method for stabilizing a nucleic acid oligomer solution having a phosphorothioate bond and a method for producing a purified nucleic acid oligomer. The present invention provides a method for stabilizing a nucleic acid oligomer and a method for producing a purified nucleic acid oligomer from the following elution fraction, characterized in that the atmosphere in contact with the elution fraction obtained by subjecting a crude nucleic acid oligomer containing a nucleic acid oligomer represented by formula (1) (wherein the notations are the same as those described in the specification) to reverse phase column chromatography is an inert gas atmosphere having an oxygen concentration of 10% or less.

Description

Technical Field

[0001] This patent application claims priority and benefits under the Paris Convention based on Japanese Patent Application No. 2020-072233 (filed on April 14, 2020), and all the contents described in the above application are incorporated into this specification by reference.

[0002] The present invention relates to a method for producing a nucleic acid oligomer. The present invention further relates to a method for producing a nucleic acid oligomer containing phosphorothioate. Background Art

[0003] In recent years, there has been a growing interest in the use of nucleic acid oligomers in the medical field. Examples include antisense nucleic acids, aptamers, ribozymes, and nucleic acids that induce RNA interference (RNAi), such as siRNA, which are called nucleic acid drugs.

[0004] Nucleic acid oligomers can be synthesized by solid phase synthesis, and the nucleic acid oligomer synthesized by extending nucleic acid on a solid phase carrier is cut out from the solid phase carrier, and then, for example, for a nucleic acid oligomer containing ribose, the protecting group of the hydroxyl group at the 2' position of the ribose is deprotected and removed, thereby producing the target nucleic acid oligomer. Nucleic acid oligomers having phosphorothioate bonds are also known as useful compounds (Patent Document 1).

[0005] Prior art literature

[0006] Patent Literature

[0007] Patent Document 1: International Publication No. 2017 / 068377 Summary of the invention

[0008] Problems to be solved by the invention

[0009] Compared with nucleic acid oligomers containing only phosphodiester bonds, nucleic acid oligomers containing phosphorothioate bonds sometimes have stability problems. The present invention aims to provide a method for stabilizing nucleic acid oligomers containing phosphorothioate bonds, and an efficient method for producing the aforementioned nucleic acid oligomers comprising a step of separating the nucleic acid oligomers stabilized by the method.

[0010] Means for solving problems

[0011] The inventors of the present application have repeatedly conducted earnest studies to achieve the above-mentioned purpose, and as a result, have found that the nucleic acid oligomer having a phosphorothioate bond can be stabilized by subjecting a crude product of a nucleic acid oligomer having a phosphorothioate bond generated by the phosphoramidite method to reverse phase column chromatography to obtain a purified elution fraction containing the nucleic acid oligomer, and then setting the atmosphere in contact with the obtained elution fraction to an inert gas atmosphere of a certain concentration or less. The present invention provides a method for stabilizing a nucleic acid oligomer having a phosphorothioate bond, and an efficient method for producing a nucleic acid oligomer having a phosphorothioate bond, comprising a step of separating the nucleic acid oligomer stabilized by the method.

[0012] The present invention includes the following aspects, but is not limited thereto.

[0013] Item 1. A method for stabilizing a nucleic acid oligomer, characterized in that the atmosphere in contact with a solution containing the nucleic acid oligomer represented by formula (1) is set to an inert gas atmosphere having an oxygen concentration of 10% or less, wherein the solution is a fraction eluted from a reverse phase column chromatography,

[0014] [Chemical formula 1]

[0015]

[0016] In formula (1),

[0017] B C Each independently represents the same or different nucleic acid bases,

[0018] R are the same or different from each other, and each independently represents a hydrogen atom, a fluorine atom or an OQ group,

[0019] Q are the same or different and each independently represents a hydrogen atom, a methyl group, a 2-methoxyethyl group, a methylene group bonded to the carbon atom at the 4' position of ribose, an ethylene group bonded to the carbon atom at the 4' position of ribose, or an ethylidene group bonded to the carbon atom at the 4' position of ribose,

[0020] X are the same or different from each other and each independently represents an oxygen atom or a sulfur atom,

[0021] Y represents a hydrogen atom or a protective group for a hydroxyl group,

[0022] G represents an ammonium ion, an alkylammonium ion, an alkali metal ion, a hydrogen ion or a hydroxyalkylammonium ion,

[0023] n is an integer satisfying formula (2), and at most 20% of the n Xs are sulfur atoms,

[0024] 60≤n (2).

[0025] Item 2. A method for producing a stabilized purified nucleic acid oligomer solution, comprising:

[0026] A step of subjecting a crude product of the nucleic acid oligomer represented by the aforementioned formula (1) generated by the phosphoramidite method to reverse phase column chromatography to obtain a purified elution fraction containing the nucleic acid oligomer of formula (1); and a step of setting the atmosphere in contact with the aforementioned elution fraction described in the preceding item 1 to an inert gas atmosphere having an oxygen concentration of less than 10%.

[0027] Item 3. A method for producing a purified nucleic acid oligomer, further comprising:

[0028] A step of preparing a purified nucleic acid oligomer solution by the step described in the above item 2; and a step of separating the purified nucleic acid oligomer from the purified nucleic acid oligomer solution.

[0029] Item 4. The method according to any one of Items 1 to 3 above, wherein the oxygen concentration is 5% or less.

[0030] Item 5. The method according to any one of Items 1 to 4 above, wherein the oxygen concentration is 2.5% or less.

[0031] Item 6. The method according to any one of Items 2 to 5 above, wherein the reverse phase column chromatography is a reverse phase column chromatography using a mobile phase containing at least one ammonium salt selected from the group consisting of monoalkylammonium salts and dialkylammonium salts.

[0032] Item 7. The method according to any one of Items 2 to 6 above, wherein the reverse phase column chromatography is a reverse phase column chromatography using a mobile phase containing at least one ammonium salt selected from the group consisting of dialkylammonium salts as a mobile phase.

[0033] Item 8. The method according to any one of Items 2 to 7 above, wherein the reverse phase column chromatography is a reverse phase column chromatography using a mobile phase containing at least one water-soluble organic solvent selected from the group consisting of alcoholic water-soluble organic solvents and nitrile water-soluble organic solvents as a mobile phase.

[0034] Item 9. The method as described in Item 3 above, comprising: mixing the aforementioned stabilized purified nucleic acid oligomer solution with a C1-C4 organic solvent having at least one oxygen atom, and separating the precipitated nucleic acid oligomer.

[0035] Item 10. The method according to any one of Items 1 to 9 above, wherein in the formula (1), each R independently represents a hydroxyl group or a methoxy group.

[0036] Item 11. The method according to any one of Items 2 to 9 above, wherein R is a hydroxyl group.

[0037] The present invention also includes the following aspects, but is not limited thereto.

[0038] Item 1A. A method for producing a nucleic acid oligomer, comprising:

[0039] A step of subjecting a crude product of a nucleic acid oligomer represented by formula (1) produced by the phosphoramidite method to reverse phase column chromatography to obtain a purified eluted fraction containing the nucleic acid oligomer represented by formula (1); and

[0040] The step of obtaining a stabilized purified nucleic acid oligomer solution by making the atmosphere in contact with the eluted fraction an inert gas atmosphere having an oxygen concentration of 10% or less.

[0041] [Chemical formula 2]

[0042]

[0043] In formula (1),

[0044] B C Each independently represents the same or different nucleic acid bases,

[0045] R are the same or different from each other, and each independently represents a hydrogen atom, a fluorine atom or an OQ group,

[0046] Q are the same or different and each independently represents a hydrogen atom, a methyl group, a 2-methoxyethyl group, a methylene group bonded to the carbon atom at the 4' position of ribose, an ethylene group bonded to the carbon atom at the 4' position of ribose, or an ethylidene group bonded to the carbon atom at the 4' position of ribose,

[0047] X are the same or different from each other and each independently represents an oxygen atom or a sulfur atom,

[0048] Y represents a hydrogen atom or a protective group for a hydroxyl group,

[0049] G represents an ammonium ion, an alkylammonium ion, an alkali metal ion, a hydrogen ion or a hydroxyalkylammonium ion,

[0050] n is an integer satisfying formula (2), and at most 20% of the n Xs are sulfur atoms,

[0051] 60≤n (2).

[0052] Item 2A. The method for producing a nucleic acid oligomer according to Item 1A, further comprising: a step of separating the purified nucleic acid oligomer from the stabilized purified nucleic acid oligomer solution.

[0053] Item 3A. The method for producing a nucleic acid oligomer according to Item 1A or Item 2A, wherein the oxygen concentration is 5% or less.

[0054] Item 4A. The method for producing a nucleic acid oligomer according to Item 1A or Item 2A, wherein the oxygen concentration is 2.5% or less.

[0055] Item 5A. The production method according to any one of Items 1A to 4A above, wherein the mobile phase of the reverse phase column chromatography is a mobile phase containing at least one ammonium salt selected from the group consisting of monoalkylammonium salts and dialkylammonium salts.

[0056] Item 6A. The production method according to any one of Items 1A to 4A above, wherein the mobile phase of the reverse phase column chromatography is a mobile phase containing at least one ammonium salt selected from the group consisting of dialkylammonium salts.

[0057] Item 7A. The production method according to any one of Items 1A to 6A above, wherein the reverse phase column chromatography is a reverse phase column chromatography using a mobile phase comprising at least one water-soluble organic solvent selected from the group consisting of alcoholic water-soluble organic solvents and nitrile water-soluble organic solvents as the mobile phase.

[0058] Item 8A. The production method as described in Item 2A, comprising: mixing the aforementioned stabilized purified nucleic acid oligomer solution with a C1-C4 organic solvent having at least one oxygen atom, and separating the precipitated nucleic acid oligomer.

[0059] Item 9A. The production method according to any one of Items 1A to 8A above, wherein in the formula (1), each R independently represents a hydroxyl group or a methoxy group.

[0060] Item 10A. The production method according to any one of Items 1A to 8A above, wherein R is a hydroxyl group.

[0061] Item 11A. A method for stabilizing a nucleic acid oligomer, characterized in that the atmosphere in contact with a solution containing the nucleic acid oligomer represented by formula (1) is set to an inert gas atmosphere having an oxygen concentration of 10% or less, wherein the solution is a fraction eluted from a reverse phase column chromatography,

[0062] [Chemical formula 3]

[0063]

[0064] In formula (1),

[0065] The definition of each group is the same as in the item [1A].

[0066] Effects of the Invention

[0067] According to the present invention, a nucleic acid oligomer having a phosphorothioate bond is stabilized, and an efficient method for producing the same can be provided. BRIEF DESCRIPTION OF THE DRAWINGS

[0068] [ Figure 1 ] Figure 1 This is a diagram showing an example of synthesizing a nucleic acid oligomer using the phosphoramidite method. DETAILED DESCRIPTION

[0069] A method for stabilizing a nucleic acid oligomer is described, wherein the atmosphere in contact with a solution containing the nucleic acid oligomer represented by the above formula (1) is set to an inert gas atmosphere with an oxygen concentration of 10% or less, and the above solution is a fraction eluted from a reverse phase column chromatography.

[0070] In the above formula (1), B C The nucleic acid base represented (hereinafter also referred to as "base") can be a natural or non-natural nucleic acid base. As the non-natural nucleic acid base, a modified analog of a natural or non-natural nucleic acid base can be exemplified. As a nucleic acid base, a purine compound and a pyrimidine compound can be exemplified, for example, U.S. Patent No. 3,687,808, "Concise Encyclopedia Of Polymer Science And Engineering", 858-859 pages, Kroschwitz JI, John Wiley & Sons, 1990 and Englisch et al., Angewandte Chemie, International Edition, 1991, 30 volumes, p.613 disclosed nucleic acid bases can be exemplified.

[0071] Specific examples thereof include purine bases such as adenine, isoguanine, xanthine, hypoxanthine, and guanine; and pyrimidine bases such as cytosine, uracil, and thymine.

[0072] In addition, as B CThe nucleic acid base represented by the present invention includes, for example, amino derivatives such as 2-aminoadenine, 2-aminopurine, and 2,6-diaminopurine; alkyl derivatives such as 5-methyluracil, 5-methylcytosine, 7-methylguanine, 6-methylpurine, and 2-propylpurine; 5-halouracil and 5-halocytosine; 5-propynyluracil and 5-propynylcytosine; 6-azauracil, 6-azacytosine, and 6- Azathymine; 5-uracil (pseudouracil), 4-thiouracil, 5-(2-aminopropyl)uracil, 5-aminoallyluracil; 8-halogenated, aminated, thiolated, thioalkylated, hydroxylated and other 8-substituted purines; 5-trifluoromethylated and other 5-substituted pyrimidines; 6-azapyrimidine; N-2, N-6 and O-6 substituted purines (including 2-aminopropyladenine); dihydrouracil uracil; 3-deaza-5-azacytosine; 7-deazaadenine; N6-methyladenine, N6, N6-dimethyladenine; 5-amino-allyl-uracil; N3-methyluracil; substituted 1,2,4-triazole; 2-hydroxypyridine; 5-nitroindole; 3-nitropyrrole; 5-methoxyuracil; uracil-5-oxyacetic acid; 5-methoxycarbonylmethyluracil; 2-thiouracil, 5-methyl 5-Methoxycarbonylmethyl-2-thiouracil; 5-methylaminomethyl-2-thiouracil; 3-(3-amino-3-carboxypropyl)uracil; 3-methylcytosine; N4-acetylcytosine; 2-thiocytosine; N6-methyladenine; N6-isopentyladenine; 2-methylthio-N6-isopentenyladenine; N-methylguanine; O-alkylated bases, etc.

[0073] When R represents an OQ group, and Q represents a methylene group bonded to the carbon atom at the 4' position of ribose, an ethylene group bonded to the carbon atom at the 4' position of ribose, or an ethylidene group bonded to the carbon atom at the 4' position of ribose, the structure is as shown in the structures of LNA-1, LNA-2, and LNA-3 shown in the following formula (3).

[0074] [Chemical formula 4]

[0075]

[0076] (Where B c represents the same nucleic acid base as above. )

[0077] As the protecting group of the hydroxyl group represented by Y, any protecting group can be used without particular limitation as long as it can function as a protecting group in the amide method, and for example, known protecting groups used for amide compounds can be widely used. The protecting group of the hydroxyl group represented by Y is preferably the following group.

[0078] [Chemical formula 5]

[0079]

[0080] (Where R 1 , R 2 and R 3 are the same or different from each other and each independently represents hydrogen or alkoxy. )

[0081] Examples of the alkoxy group include a methoxy group.

[0082] The chain length of the nucleic acid oligomer of formula (1) can be exemplified by n ≥ 60, n ≥ 80 or n ≥ 100. As the upper limit of the chain length, for example, n ≤ 200 can be exemplified. In the aforementioned nucleic acid oligomer, at most 20% (including 20%) of the n Xs are sulfur atoms. Preferably, the nucleic acid oligomer of formula (1) has one or more phosphorothioate bonds, and more preferably has three or more phosphorothioate bonds.

[0083] The nucleic acid oligomer of formula (1) may also be, for example, a DNA or RNA oligomer, or an oligomer containing non-natural nucleic acid bases in these oligomers. The aforementioned nucleic acid oligomer is typically a single-stranded DNA or RNA oligomer. In the nucleic acid oligomer of formula (1), the substituents R are preferably each independently a hydroxyl group or a methoxy group. The method of the present invention is suitable for RNA as a nucleic acid oligomer of formula (1) (the substituents R are each independently a hydroxyl group or a methoxy group). In further detail, it is suitable for manufacturing a nucleic acid oligomer containing both a nucleotide in which the substituent R is a hydroxyl group and a nucleotide in which the substituent R is a methoxy group.

[0084] <Method for purifying nucleic acid oligomers using reverse phase column chromatography>

[0085] Separation using reverse phase column chromatography is carried out in the following manner: a mobile phase containing an alkylammonium salt is passed through a chromatographic column containing a filler, and then a solution containing a reaction product containing a nucleic acid oligomer synthesized using the phosphoramidite method is passed through the mobile phase containing an alkylammonium salt, so that the aforementioned nucleic acid oligomer is adsorbed and bonded to the chromatographic column, and impurities contained in the aforementioned nucleic acid oligomer are separated and eluted from the target nucleic acid molecule by a gradient in which the organic solvent concentration in the mobile phase increases successively.

[0086] For the eluted fraction obtained by reverse phase column chromatography, the composition is analyzed with the UV absorption of wavelength 260nm under the condition of the chromatography for separation analysis of nucleic acid, and selected and collected. From the collected fraction, the purified target is obtained, i.e., the nucleic acid oligomer with the thiophosphate bond of a specified amount. As the aforementioned analytical method, for example, the method of recording in non-patent literature (Handbook of Analysis of Oligonucleotides and Related Products, CRC Press) can be used.

[0087] As the packing material for the reverse phase column chromatography, for example, silica or polymers serving as a hydrophobic stationary phase may be silica or polymers to which at least one selected from a phenyl group, an alkyl group having 1 to 20 carbon atoms, and a cyanopropyl group is immobilized. For example, silica or polymers serving as the packing material may have a particle size of 2 μm or more, or 5 μm or more.

[0088] In reverse phase column chromatography, elution is performed and a water-soluble mobile phase is obtained as a fraction liquid. As a solvent system that becomes a mobile phase, alcohol organic solvents (e.g., methanol, ethanol, 2-propanol or n-propanol), nitrile organic solvents (e.g., acetonitrile) and water can be exemplified. As an alcohol organic solvent, C1-C3 alcohol is preferred, and methanol is more preferred. As a nitrile organic solvent, acetonitrile is preferred. Each organic solvent can be used alone or in combination of two or more.

[0089] The mobile phase of the reverse phase column chromatography generally uses a mobile phase containing an alkylammonium salt, and the eluent also contains these alkylammonium salts. As the alkylammonium salt, monoalkylammonium salts, dialkylammonium salts and trialkylammonium salts are generally used, preferably monoalkylammonium salts and dialkylammonium salts, more preferably dialkylammonium salts. The number of carbon atoms of the monoalkylamine forming the monoalkylammonium salt is preferably 3 to 10, more preferably 4 to 6, and more preferably hexylamine. The number of carbon atoms of the dialkylamine forming the dialkylammonium salt is preferably 4 to 10, more preferably 5 to 9. The preferred dialkylamine is dibutylamine. The number of carbon atoms of the trialkylamine forming the trialkylammonium salt is preferably 6 to 12, more preferably 6 to 9, and specifically, triethylamine can be exemplified.

[0090] Examples of the acid that forms the monoalkylammonium salt, dialkylammonium salt, and trialkylammonium salt include carbonic acid, acetic acid, formic acid, trifluoroacetic acid, and propionic acid.

[0091] The concentration of the ammonium salt is usually 1 to 200 mM, preferably 5 to 150 mM, and more preferably 20 to 100 mM.

[0092] The pH range of the mobile phase is usually pH: 6 to 8, preferably 6.5 to 7.5.

[0093] The temperature of the reverse phase column chromatography is usually 20 to 100°C, preferably 30 to 80°C, and more preferably 40 to 70°C.

[0094] The eluate fraction obtained by reverse phase column chromatography usually contains water, an alcoholic organic solvent, a nitrile organic solvent, the alkyl ammonium salt and the nucleic acid oligomer of formula (1). The amount of water in the eluate is usually 90% to 30%, preferably 80% to 40%, and more preferably 70% to 40%. The amount of the alcoholic organic solvent in the eluate is usually 0% to 20%, preferably 0% to 15%, and more preferably 0% to 10%. The amount of the nitrile organic solvent in the eluate is usually 10% to 70%, preferably 20% to 60%, and more preferably 30% to 50% (the above % all represent mass %).

[0095] The molar concentration of the alkylammonium salt in the eluted fraction is usually 1 mM to 200 mM, preferably 10 mM to 100 mM.

[0096] The concentration of the nucleic acid oligomer in the eluted fraction is usually 0.05 mg / mL to 5 mg / mL, preferably 0.05 mg / mL to 1 mg / mL, and more preferably 0.1 mg / mL to 0.5 mg / mL.

[0097] <Step of stabilizing the eluted fraction containing nucleic acid oligomers obtained by reverse phase chromatography>

[0098] The inert gas atmosphere with an oxygen concentration of 10% or less can be adjusted by, for example, supplying an inert gas with a predetermined oxygen concentration or less to a container containing nucleic acid oligomers, and measuring and confirming that the oxygen concentration in the atmosphere in the container is within the aforementioned set concentration range. Specifically, it can be adjusted by: allowing a high-purity inert gas such as argon or nitrogen to flow through the atmosphere in the container, or by adjusting the oxygen concentration to a predetermined concentration of an inert gas; or by replacing the atmosphere in the container with the aforementioned inert gas or an inert gas with an adjusted concentration.

[0099] The preparation of the inert gas atmosphere having an oxygen concentration of 10% or less may be performed at any of the following stages: before, during, or after the eluted fraction is supplied to the container. Alternatively, these steps may be combined.

[0100] Examples of the inert gas include nitrogen, argon, and helium, but are not limited thereto.

[0101] The method of replacing the atmosphere in the container may be replacement by reduced pressure, replacement by pressurization, flow replacement, replacement by bubbling, or replacement by freeze degassing, and ultrasonic waves may be applied or heating may be performed. A more preferred method is flow replacement.

[0102] The oxygen concentration in the inert gas atmosphere is preferably 10% or less, more preferably 5.0% or less, further preferably 2.5% or less, and further preferably 0.1% or less.

[0103] The obtained eluted fraction can be stored under the aforementioned inert gas atmosphere at usually 0°C to 80°C, preferably 10°C to 70°C, more preferably 20°C to 60°C.

[0104] The eluted fraction containing nucleic acid oligomers obtained by reverse phase chromatography may be subjected to one or more post-treatment steps selected from reprecipitation step, liquid separation step, ultrafiltration step, deprotection step and freeze-drying step for isolating nucleic acid oligomers after storage.

[0105] In the reprecipitation process, the stabilized solution is contacted with a poor solvent, so that the nucleic acid oligomer can be precipitated and separated. If necessary, the liquid portion can also be removed from the state of solid-liquid separation, and then, the precipitated nucleic acid oligomer is collected and separated by filtering. As the poor solvent of the reprecipitation process, organic solvents (for example, C1-C4 alcohols, tetrahydrofuran, dioxane) having at least one oxygen atom can be enumerated. As the solvent, preferably ethanol or isopropanol.

[0106] In the liquid separation step, at least one of an acidic aqueous solution such as an aqueous sodium acetate solution, water, and saline solution is mixed with the stabilized solution, and an organic solvent that is not miscible with water is further added to separate the solution into an aqueous layer and an organic layer, thereby obtaining an aqueous layer containing the desired nucleic acid oligomer.

[0107] In the ultrafiltration step, the nucleic acid oligomers present in the solution after the storage step can be separated from low molecular weight components having a desired molecular weight or less using an ultrafiltration membrane.

[0108] When there is a protecting group at the 5' end of the nucleic acid oligomer, the protecting group of the nucleic acid oligomer can be deprotected by mixing an acidic aqueous solution such as an acetic acid aqueous solution or a solution prepared by dissolving an acidic substance such as acetic acid in an organic solvent with the solution after the storage step.

[0109] In the freeze-drying step, the frozen aqueous solution of the nucleic acid oligomer is depressurized to sublime water, thereby separating the nucleic acid oligomer and water.

[0110] The synthesis of nucleic acid oligomers by the phosphoramidite method can be carried out by nucleic acid extension reaction according to a known method (for example, the method described in the aforementioned Japanese Patent No. 5157168 or Japanese Patent No. 5554881). Figure 1The method for producing a nucleic acid oligomer is described below with reference to the reaction pathway (condensation reaction, oxidation, deprotection) shown below, taking the synthesis of RNA according to the route shown in as an example.

[0111] In the above chemical formula representing the reaction pathway, B a represents a nucleic acid base that can be protected; Tr represents a protecting group; X is the same as defined above; and SP represents a portion other than the nucleoside structure of the inorganic porous carrier.

[0112] The inorganic porous carrier (Sp-Nu) having a nucleoside structure and the nucleic acid base of the nucleoside constituting the amide monomer (Am-1) are the same nucleic acid bases as described above or nucleic acid bases protected by a protecting group.

[0113] As examples of preferred amide monomers (Am-1), in the compound represented by the following chemical formula (Am-1'), when R represents a protected hydroxyl group, specific protecting groups include tert-butyldimethylsilyl (TBDMS group), bis(2-acetoxy)methyl (ACE group), (triisopropylsilyloxy)methyl (TOM group), (2-cyanoethoxy)ethyl (CEE group), (2-cyanoethoxy)methyl (CEM group), p-toluenesulfonylethoxymethyl (TEM group), (2-cyanoethoxy)methoxymethyl (EMM group), TBDMS amide (TBDMS RNA Amidites, trade name, ChemGenes Corporation), ACE amide, TOM amide, CEE amide, CEM amide, TEM amide (Chakhmakhcheva's General Review: Protective Groups in the Chemical Synthesis of Oligoribonucleotides, Russian Journal of Bioorganic Chemistry, 2013, Vol. 39, No. 1, pp. 1-21.), EMM amide (described in International Publication No. 2013 / 027843), etc.

[0114] [Chemical formula 6]

[0115]

[0116] (wherein, R represents the same group as above, B a Indicates a nucleic acid base that can be protected. )

[0117] [Solid Phase Synthesis of RNA]

[0118] The Tr group of the inorganic porous carrier (Sp-Nu) is deprotected to obtain a solid phase carrier (Am-2). Then, the amide monomer (Am-1) and the solid phase carrier (Am-2) are subjected to a condensation reaction to obtain a reaction product (Am-3). Then, the reaction product (Am-3) is oxidized to obtain a product (Am-4). Then, the product (Am-4) is deprotected (-Tr) to obtain a product (Am-5). Next, the amide monomer (Am-1) and the product (Am-5) are further subjected to a condensation reaction to extend the phosphodiester bond. In this way, the hydroxyl group at the 5' position at the end of the extended oligonucleotide chain is repeatedly subjected to a series of necessary deprotection, condensation reaction, and oxidation cycles in order to obtain the desired sequence, and then, it is cut out from the solid phase carrier, thereby being able to manufacture a nucleic acid molecule of the desired sequence. The synthesis can also be carried out using an automatic nucleic acid synthesizer using the phosphoramidite method, etc. RNA is used as an example here for illustration, but it can also be applied to nucleic acid compounds containing nucleotides other than ribonucleotides.

[0119] In the step of deprotecting the Tr group, the protecting group of the hydroxyl group at the 5' position of the RNA chain end supported on the solid phase carrier is deprotected. As the protecting group, a trityl protecting group (typically, a DMTr group) is used. The deprotection can be carried out using an acid. Examples of the acid used for deprotection include trifluoroacetic acid, trichloroacetic acid, dichloroacetic acid, trifluoromethanesulfonic acid, methanesulfonic acid, hydrochloric acid, acetic acid, p-toluenesulfonic acid, and the like.

[0120] In the condensation step, the 5'-hydroxyl group at the end of the RNA chain deprotected in the deprotection step is bonded to a nucleoside phosphoramidite to generate a phosphite. As the nucleoside phosphoramidite, a nucleoside phosphoramidite in which the 5'-hydroxyl group is protected by a protecting group (eg, DMTr group) is used.

[0121] In addition, the condensation step can be performed using an activator that activates the nucleoside phosphoramidite. Examples of the activator include 5-benzylthio-1H-tetrazolyl (BTT), 1H-tetrazolyl, 4,5-dicyanoimidazole (DCI), 5-ethylthio-1H-tetrazolyl (ETT), N-methylbenzimidazolium trifluoromethanesulfonate (N-MeBIT), benzimidazolium trifluoromethanesulfonate (BIT), N-phenylimidazolium trifluoromethanesulfonate (N-PhIMT), imidazolium trifluoromethanesulfonate (IMT), 5-nitrobenzimidazolium trifluoromethanesulfonate (NBT), 1-hydroxybenzotriazole (HOBT), and 5-(bis-3,5-trifluoromethylphenyl)-1H-tetrazolyl (Activator-42).

[0122] After the condensation step, the unreacted hydroxyl group at the 5' position may be capped as appropriate. The capping can be performed using a known capping solution such as an acetic anhydride-tetrahydrofuran solution or a phenoxyacetic anhydride / N-methylimidazole solution.

[0123] The oxidation step is a step of oxidizing the phosphite formed by the above-mentioned condensation step. The oxidation step can be carried out using an oxidizing agent. Examples of the oxidizing agent include iodine, m-chloroperbenzoic acid, tert-butyl hydroperoxide, 2-methyl ethyl peroxide, bis(trimethylsilyl) peroxide, 1,1-dihydroperoxycyclododecane, and hydrogen peroxide.

[0124] When converting a phosphite triester group into a thiophosphoric acid triester group, as an "oxidant", for example, sulfur, 3H-1,2-benzodithiol-3-one-1,1-dioxide (Beaucage reagent), 3-amino-1,2,4-dithiazole-5-thione (ADTT), 5-phenyl-3H-1,2,4-dithiazole-3-one (POS), [(N,N-dimethylaminomethylene)amino]-3H-1,2,4-dithiazoline-3-thione (DDTT) and phenylacetyl disulfide (PADS) can be used. The oxidant can be used by diluting it with a suitable solvent in a concentration of 0.001 to 2M. The solvent used in the reaction is not particularly limited as long as it does not participate in the reaction, and examples thereof include dichloromethane, acetonitrile, pyridine, or a mixed solvent of any ratio thereof.

[0125] The oxidation step may be performed after the aforementioned capping operation, or vice versa, the capping operation may be performed after the oxidation step, and the order is not limited.

[0126] RNA having a desired sequence can be synthesized by returning to the deprotection step after the oxidation step and repeating the above-mentioned series of steps of condensation reaction, oxidation, and deprotection according to the nucleotide sequence of the nucleic acid oligomer to be synthesized.

[0127] After the synthesis of the nucleic acid oligomer having the desired sequence is completed, the RNA chain is cleaved and recovered from the solid phase support using ammonia or an amine compound.

[0128] Examples of the amine compound include methylamine, ethylamine, isopropylamine, ethylenediamine, diethylamine, and triethylamine.

[0129] The chain length of the nucleic acid oligomer thus obtained can be exemplified by n≥60, n≥80, or n≥100, and n≤200.

[0130] The step of deprotecting the phosphate protecting group is to allow an amine compound to act after the synthesis of the nucleic acid having the desired sequence is completed to deprotect the protecting group of the phosphate moiety. Examples of the amine compound include the diethylamine described above.

[0131] When there is a protecting group for the hydroxyl group at the 2' or 3' position of ribose, it can be removed according to the method described in International Publication No. 2006 / 022323), International Publication No. 2013 / 027843, or International Publication No. 2019 / 208571.

[0132] Example

[0133] Hereinafter, the present invention will be described in further detail using examples, but the present invention is not limited thereto.

[0134] Determination method

[0135] The respective measurement methods used in the following tests are as follows.

[0136] (Measurement method 1: Method for measuring RNA purity)

[0137] The purity of RNA in the fraction solution eluted by reverse phase chromatography was determined by HPLC. The fractionated RNA was separated into components by HPLC (wavelength 260 nm, chromatographic column DNAPacTM PA200, 4.0 mm × 250 mm, 8.0 μm), and the purity of RNA was calculated from the area value of the main product in the total area value of the obtained chromatogram. The HPLC measurement conditions are shown in Table 1 below.

[0138] [Table 1]

[0139]

[0140] (Measurement method 2: measurement of oxygen concentration)

[0141] The oxygen concentration of the atmosphere in contact with the fraction solution eluted by reverse phase chromatography was measured using PACK KEEPER (Residual Oxygen Meter) manufactured by IIJIMA ELECTRONICSCORP. Before measuring the oxygen concentration, the device was calibrated by measuring the oxygen concentration in air and pure nitrogen, and then the needle attached to the device was inserted into a container such as a flask covered with a septum to measure the oxygen concentration of the gas phase in the system. The measured value of the oxygen concentration was displayed in real time, and the value at which the measured value stabilized was taken as the oxygen concentration of the atmosphere.

[0142] [Reference Example 1]

[0143] Solid-phase synthesis of RNA based on the amide method

[0144] RNA having the nucleic acid sequence of I shown below was synthesized. This chain consists of 103 bases in length.

[0145] Chain I: A*U*A*ACUCAAUUUGUAAAAAAGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU*U*U*U(5'-3')(SEQ ID NO:1)

[0146] In the above sequence notation, in the description of the sequence, U represents uridine, C represents cytidine, A represents adenosine, or G represents guanosine. The mark * between nucleotides indicates that the phosphate bond connecting the nucleotides is phosphorothioate.

[0147] The RNA was synthesized from the 3' side to the 5' side using a nucleic acid synthesizer (AKTA oligopilot plus100, GE Healthcare) based on the phosphoramidite method. The synthesis was carried out on a 63 μmol scale. In addition, the synthesis was performed using the following reagents: as RNA amide, uridine EMM amide (described in Example 2 of International Publication No. 2013 / 027843), cytidine EMM amide (described in Example 3 of International Publication No. 2013 / 027843), adenosine EMM amide (described in Example 4 of International Publication No. 2013 / 027843), and guanosine EMM amide (described in Example 5 of International Publication No. 2013 / 027843) of the following formula were used, porous glass was used as a solid phase support, dichloroacetic acid toluene solution was used as a deprotection solution, 5-benzylthio-1H-tetrazole was used as a condensation agent, iodine solution was used as an oxidizing agent, 3-amino-1,2,4-dithiazole-5-thione was used as a sulfurizing agent, and phenoxyacetic anhydride solution and N-methylimidazole solution were used as capping solutions. After the nucleic acid extension was completed, the cyanoethyl protecting group of the phosphate moiety was selectively deprotected by allowing a diethylamine solution to act on the nucleic acid on the support. Here, EMM is an abbreviation for (2-cyanoethoxy)methoxymethyl.

[0148] [Chemical formula 7]

[0149]

[0150] The excision and deprotection of the solid phase support after solid phase synthesis are in accordance with the method described in International Publication No. 2013 / 027843. That is, an aqueous ammonia solution and ethanol are added, and after standing for a period of time, the solid phase support is filtered and the solvent is distilled off. Then, tetrabutylammonium fluoride is used to deprotect the hydroxyl group. The obtained RNA is dissolved in distilled water for injection to a desired concentration.

[0151] RNA extraction and purification

[0152] The synthesized RNA was purified by column chromatography under the conditions of Table 2 below. Before purification, the mobile phase A was passed through the chromatographic column at a flow rate of 4.7 mL / min for 12.5 minutes, and then the sample was added. The fraction was taken at a retention time of 94.2 minutes to 95.8 minutes, and the obtained solution was analyzed by HPLC. It should be noted that the purity was calculated by the method described in the aforementioned determination method 1. As a result, the purity of the RNA in the fraction was 94%.

[0153] [Table 2]

[0154]

[0155] Confirmation of storage stability of aliquoted solution

[0156] [Example 1]

[0157] 0.5 mL of the solution of the purified fraction containing RNA in the aforementioned reference example 1 was placed in a glass headspace injection bottle with a capacity of 10 mL (GL Sciences), and sealed with a septum and a screw cap (crimp cap) (GL Sciences). Further, in the sealed system, a needle for blowing out nitrogen from a nitrogen bottle, a needle for extracting the blown nitrogen, and a measuring needle of an oxygen measuring instrument were inserted into the septum, and the atmosphere in the system was replaced with nitrogen by flowing nitrogen, so that the oxygen concentration in the atmosphere was 0.0%. Here, the oxygen concentration was determined using the method described in the aforementioned determination method 2. Then, the glass headspace injection bottle with the solution was placed in a thermostat (Kenis) adjusted to 60°C and allowed to stand for 8 hours. After standing, the headspace injection bottle taken out from the thermostat was cooled to room temperature, and the purity of the RNA was calculated using the method described in the aforementioned determination method 1, which was 83%.

[0158] [Example 2]

[0159] 0.5 mL of the solution of the purified fraction containing RNA in the aforementioned reference example 1 was placed in a glass headspace injection bottle (GL Sciences) with a capacity of 10 mL and sealed with a septum and a screw cap (GL Sciences). Further, in the sealed system, a needle for blowing out nitrogen from a nitrogen bottle, a needle for extracting the blown nitrogen, and a measuring needle of an oxygen measuring instrument were inserted into the septum, and the atmosphere in the system was replaced with nitrogen by flowing nitrogen, so that the oxygen concentration in the atmosphere was 2.1%. Here, the oxygen concentration was determined using the method described in the aforementioned determination method 2. Then, the glass headspace injection bottle with the solution was placed in a thermostat (Kenis) adjusted to 60°C and allowed to stand for 8 hours. After standing, the headspace injection bottle taken out from the thermostat was cooled to room temperature, and the purity of the RNA was calculated by the method described in the aforementioned determination method 1, which was 77%.

[0160] [Example 3]

[0161] 0.5 mL of the solution containing the purified RNA fraction in the aforementioned reference example 1 was placed in a glass headspace injection bottle (GL Sciences) with a capacity of 10 mL and sealed with a septum and a screw cap (GL Sciences). Further, in the sealed system, a needle for blowing out nitrogen from a nitrogen bottle, a needle for extracting the blown-out nitrogen, and a measuring needle of an oxygen measuring instrument were inserted into the septum, and the atmosphere in the system was replaced with nitrogen by flowing nitrogen, so that the oxygen concentration in the atmosphere was 7.3%. Here, the oxygen concentration was determined using the method described in the aforementioned determination method 2. Then, the glass headspace injection bottle with the solution was placed in a thermostat (Kenis) adjusted to 60°C and allowed to stand for 8 hours. After standing, the headspace injection bottle taken out from the thermostat was cooled to room temperature, and the purity of the RNA was calculated using the method described in the aforementioned determination method 1, which was 73%.

[0162] [Comparative Example 1]

[0163] 0.5 mL of the solution of the fraction containing RNA extracted and purified in the aforementioned Reference Example 1 was placed in a glass headspace injection bottle with a capacity of 10 mL (GL Sciences), and the atmosphere was not replaced with nitrogen, and sealed with a septum and a screw cap (GL Sciences). Then, the glass headspace injection bottle containing the extracted solution was placed in a thermostat (Kenis) adjusted to 60° C. and allowed to stand for 8 hours. After standing, the headspace injection bottle taken out of the thermostat was cooled to room temperature, and the purity of the RNA in the fraction was calculated by the method described in the aforementioned determination method 1, which was 60%.

[0164] [Table 3]

[0165] <![CDATA[O2 concentration [%]]]> <![CDATA[HPLC determination of purity 1) > <![CDATA[Retention rate of nucleic acid 2) > Example 1 0 83％ 88％ Example 2 2.1 77％ 82％ Example 3 7.3 73％ 77％ Comparative Example 1 20.9 60％ 64％

[0166] 1) The nucleic acid (RNA) purified in Reference Example 1 was stored at 60°C under a predetermined oxygen concentration for 8 hours, and the purity (%) of the nucleic acid was measured by HPLC.

[0167] 2) Nucleic acid retention rate (%) = HPLC purity of nucleic acid after storage / purity of nucleic acid during fractionation and purification in Reference Example 2

[0168] Recovery of RNA from the stored fraction solution

[0169] [Example 4]

[0170] 0.4 mL of the solution after the oxygen concentration of the atmosphere in Example 1 was set to 0.0% and allowed to stand for 8 hours was placed in a 15 mL polypropylene centrifuge tube (Corning Company), and 0.2 mL of sodium acetate aqueous solution (3M, pH = 5.2) and 1.2 mL of ethanol were added. The obtained slurry solution was centrifuged under the conditions of 10 minutes, 3000 g, and 25°C, and the supernatant was removed. Then, 1 mL of 70% ethanol aqueous solution was placed, and the operation of centrifuging under the conditions of 10 minutes, 3000 g, and 25°C and removing the supernatant was repeated twice to obtain RNA as a precipitate. The obtained RNA was dissolved in 0.4 mL of water, and when the purity of the RNA in the fraction was calculated by the method described in the aforementioned measurement method 1, the purity was 77%.

[0171] [Comparative Example 2]

[0172] 0.4 mL of the fractionated solution after standing for 8 hours in Comparative Example 1 was placed in a 15 mL polypropylene centrifuge tube (Corning), and 0.2 mL of sodium acetate aqueous solution (3M, pH = 5.2) and 1.2 mL of ethanol were added. The obtained slurry solution was centrifuged under the conditions of 10 minutes, 3000 g, and 25°C, and the supernatant was removed. Then, 1 mL of 70% ethanol aqueous solution was placed, and the operation of centrifuging under the conditions of 10 minutes, 3000 g, and 25°C and removing the supernatant was repeated twice to obtain RNA. The obtained RNA was dissolved in 0.4 mL of water, and when the purity of the RNA in the fraction was calculated by the method described in the aforementioned measurement method 1, the purity was 64%.

[0173] [Reference Example 2]

[0174] Solid-phase synthesis of RNA based on the amide method

[0175] RNA having the nucleic acid sequence II shown below was synthesized. This chain consists of 67 bases in length.

[0176] Chain II: Am*Gm*Cm*AmUmAmGmCAAGUUAmAAAUAAGGmC*U*AmG*U*C*CmGUUAUCAAmCmUmUmGmAmAmAmAmAmAmGmUmGGCACmCmGmAGUCGGmUmGmCm*Um*Um*U(5'-3')(SEQ ID NO:2)

[0177] In the annotation of the above sequence, the mark * between nucleotides indicates that the phosphate bond connecting the nucleotides is a thiophosphate. The letters Am, Um, Cm, and Gm represent nucleotides in which the 2' hydroxyl group is replaced by a methoxy group. The RNA was synthesized from the 3' side to the 5' side using a nucleic acid synthesizer (AKTA oligopi lot plus100 GE Healthcare) based on the phosphoramidite method. The synthesis was carried out on a 53 μmol scale. In addition, the synthesis was carried out using the following reagents: as RNA amides, uridine EMM amide (described in Example 2 of International Publication No. 2013 / 027843), cytidine EMM amide (described in Example 3 of International Publication No. 2013 / 027843), adenosine EMM amide (described in Example 4 of International Publication No. 2013 / 027843) and guanosine EMM amide (described in Example 5 of International Publication No. 2013 / 027843) were used; and uridine 2'OMe amide, cytidine 2'OMe amide, adenosine 2'OMe amide and guanosine 2'OMe amide of the following formulas were used, porous glass was used as a solid support, a dichloroacetic acid toluene solution was used as a deprotection solution, 5-benzylthio-1H-tetrazole was used as a condensation agent, an iodine solution was used as an oxidizing agent, 3-amino-1,2,4-dithiazole-5-thione was used as a sulfurizing agent, and a phenoxyacetic anhydride solution and an N-methylimidazole solution were used as capping solutions. After the nucleic acid extension is completed, a diethylamine solution is allowed to act on the nucleic acid on the carrier to selectively deprotect the cyanoethyl protecting group of the phosphate moiety. Here, EMM is an abbreviation for (2-cyanoethoxy)methoxymethyl.

[0178] [Chemical formula 8]

[0179]

[0180] The excision and deprotection of the solid phase support after solid phase synthesis are in accordance with the method described in International Publication No. 2013 / 027843. That is, an aqueous ammonia solution and ethanol are added, and after standing for a period of time, the solid phase support is filtered and the solvent is distilled off. Then, tetrabutylammonium fluoride is used to deprotect the hydroxyl group. The obtained RNA is dissolved in distilled water for injection to a desired concentration.

[0181] RNA extraction and purification

[0182] Column chromatography purification was performed under the conditions of Table 4 below. Before purification, the mobile phase A was passed through the chromatographic column at a flow rate of 4.7 mL / min for 12.5 minutes and then the sample was added. The fraction was taken at a retention time of 66.7 minutes to 70.9 minutes, and the obtained solution was analyzed by HPLC. It should be noted that the purity was calculated using the method described in the aforementioned determination method 1. As a result, the purity was 94%. The experiments of the following examples and comparative examples were performed using the fractionated purified RNA solution.

[0183] [Table 4]

[0184]

[0185] Confirmation of storage stability of aliquoted solution

[0186] [Example 5]

[0187] 0.5 mL of the solution of the fraction containing RNA purified in the aforementioned reference example 2 was placed in a glass headspace injection bottle (GL Sciences) with a capacity of 10 mL and sealed with a septum and a screw cap (GL Sciences). Further, in the sealed system, a needle for blowing out nitrogen from a nitrogen bottle, a needle for extracting the blown nitrogen, and a measuring needle of an oxygen measuring instrument were inserted into the septum, and the atmosphere in the system was replaced with nitrogen by flowing nitrogen so that the oxygen concentration in the atmosphere was 0.0%. Here, the oxygen concentration was determined using the method described in the aforementioned determination method 2. Then, the glass headspace injection bottle with the solution was placed in a thermostat (Kenis) adjusted to 60°C and allowed to stand for 8 hours. After standing, the headspace injection bottle taken out from the thermostat was cooled to room temperature, and the purity of the RNA was calculated using the method described in the aforementioned determination method 1, which was 87%.

[0188] [Example 6]

[0189] 0.5 mL of the solution of the purified fraction containing RNA in the aforementioned reference example 2 was placed in a glass headspace injection bottle (GL Sciences) with a capacity of 10 mL and sealed with a septum and a screw cap (GL Sciences). Further, in the sealed system, a needle for blowing out nitrogen from a nitrogen bottle, a needle for extracting the blown nitrogen, and a measuring needle of an oxygen measuring instrument were inserted into the septum, and the atmosphere in the system was replaced with nitrogen by flowing nitrogen, so that the oxygen concentration in the atmosphere was 2.1%. Here, the oxygen concentration was determined using the method described in the aforementioned determination method 2. Then, the glass headspace injection bottle with the solution was placed in a thermostat (Kenis) adjusted to 60°C and allowed to stand for 8 hours. After standing, the headspace injection bottle taken out from the thermostat was cooled to room temperature, and the purity of the RNA was calculated using the method described in the aforementioned determination method 1, which was 84%.

[0190] [Example 7]

[0191] 0.5 mL of the solution of the purified fraction containing RNA in the aforementioned reference example 2 was placed in a glass headspace injection bottle with a capacity of 10 mL (GL Sciences), and sealed with a septum and a screw cap (GL Sciences). Further, in a sealed system, a needle for blowing out nitrogen from a nitrogen bottle, a needle for extracting the blown-out nitrogen, and a measuring needle of an oxygen measuring instrument were inserted into the septum, and the atmosphere in the system was replaced with nitrogen by flowing nitrogen, so that the oxygen concentration in the atmosphere was 4.5%. Here, the oxygen concentration was determined using the method described in the aforementioned determination method 2. Then, the glass headspace injection bottle with the solution was placed in a thermostat (Kenis) adjusted to 60°C and allowed to stand for 8 hours. After standing, the headspace injection bottle taken out from the thermostat was cooled to room temperature, and the purity of the RNA was calculated using the method described in the aforementioned determination method 1, which was 83%.

[0192] [Comparative Example 3]

[0193] 0.5 mL of the solution of the fraction containing RNA extracted and purified in the aforementioned Reference Example 2 was placed in a glass headspace injection bottle with a capacity of 10 mL (GL Sciences), and the atmosphere was not replaced with nitrogen, and sealed with a septum and a screw cap (GL Sciences). Then, the glass headspace injection bottle with the extracted solution was placed in a thermostat (Kenis) adjusted to 60° C. and allowed to stand for 8 hours. After standing, the headspace injection bottle taken out of the thermostat was cooled to room temperature, and the purity of the RNA in the fraction was calculated by the method described in the aforementioned determination method 1, and the purity was 79%.

[0194] [Table 5]

[0195] <![CDATA[O2 concentration [%]]]> <![CDATA[Purity determination by HPLC 1) > <![CDATA[Retention rate of nucleic acid 2) > Example 5 0 87％ 92％ Example 6 2.1 84％ 89％ Example 7 4.5 83％ 88％ Comparative Example 3 20.9 79％ 84％

[0196] 1) The nucleic acid (RNA) purified in Reference Example 2 was stored at 60°C under a predetermined oxygen concentration for 8 hours, and the purity (%) of the nucleic acid was measured by HPLC.

[0197] 2) Nucleic acid retention rate (%) = HPLC purity of nucleic acid after storage / purity of nucleic acid during fractionation and purification in Reference Example 2

[0198] Industrial Applicability

[0199] The nucleic acid oligomer having a phosphorothioate bond in the eluted fraction of the reverse phase chromatography can be stabilized, and a purified nucleic acid oligomer having a phosphorothioate bond (eg, RNA) can be efficiently produced.

[0200] [Sequence Listing Free Text]

[0201] Sequence numbers 1 and 2 in the sequence listing represent the base sequences of oligonucleotides produced according to the production method of the present invention.

Claims

1. A method for stabilizing a nucleic acid oligomer having a phosphorothioate bond, characterized in that: The atmosphere in contact with a solution containing a nucleic acid oligomer represented by formula (1) produced by the phosphoramidite method, wherein the solution is a fraction eluted from a reverse phase column chromatography, is set to an inert gas atmosphere having an oxygen concentration of 10% or less. In formula (1), B C Each independently represents the same or different nucleic acid bases, R are the same or different from each other, and each independently represents a hydrogen atom, a fluorine atom or an OQ group, Q are the same or different and each independently represents a hydrogen atom, a methyl group, a 2-methoxyethyl group, a methylene group bonded to the carbon atom at the 4' position of ribose, an ethylene group bonded to the carbon atom at the 4' position of ribose, or an ethylidene group bonded to the carbon atom at the 4' position of ribose, X are the same or different from each other and each independently represents an oxygen atom or a sulfur atom, Y represents a hydrogen atom or a protective group for a hydroxyl group, G represents an ammonium ion, an alkylammonium ion, an alkali metal ion, a hydrogen ion or a hydroxyalkylammonium ion, n is an integer satisfying formula (2), and at most 20% of the n Xs are sulfur atoms, 60≤n (2)。 2. A method for producing a stabilized purified nucleic acid oligomer solution, comprising: A step of subjecting a crude product of a nucleic acid oligomer represented by formula (1) described in claim 1 generated by the phosphoramidite method to reverse phase column chromatography to obtain a purified elution fraction containing the nucleic acid oligomer of formula (1); and a step of setting the atmosphere in contact with the elution fraction to an inert gas atmosphere having an oxygen concentration of less than 10%.

3. A method for producing a purified nucleic acid oligomer, which further comprises: A process for producing a purified nucleic acid oligomer solution using the process described in claim 2; and a step of separating the purified nucleic acid oligomer from the purified nucleic acid oligomer solution.

4. The method according to any one of claims 1 to 3, wherein: The oxygen concentration is 5% or less.

5. The method according to any one of claims 1 to 3, wherein The oxygen concentration is 2.5% or less.

6. The method according to claim 2 or 3, wherein: The reverse phase column chromatography is a reverse phase column chromatography using a mobile phase containing at least one ammonium salt selected from the group consisting of monoalkylammonium salts and dialkylammonium salts as a mobile phase.

7. The method according to claim 2 or 3, wherein: The reverse phase column chromatography is a reverse phase column chromatography using a mobile phase containing at least one ammonium salt selected from the group consisting of dialkylammonium salts as a mobile phase.

8. The method according to claim 2 or 3, wherein: The reverse phase column chromatography is a reverse phase column chromatography using a mobile phase containing at least one water-soluble organic solvent selected from the group consisting of alcoholic water-soluble organic solvents and nitrile water-soluble organic solvents as a mobile phase.

9. The method of claim 3, comprising: The stabilized purified nucleic acid oligomer solution is mixed with a C1-C4 organic solvent having at least one oxygen atom, and the precipitated nucleic acid oligomer is separated.

10. The method according to any one of claims 1 to 3, wherein: In the above formula (1), R each independently represents a hydroxyl group or a methoxy group.

11. The method according to any one of claims 1 to 3, wherein: In the formula (1), R is a hydroxyl group.

Images