Collagenase agents and uses thereof

By using collagenase produced by Bacillus spinulosus, the problems of insufficient safety and stability of collagenase in CTP production in the existing technology are solved, and the efficient production of CTP and tenderization effect of edible meat are achieved.

CN115397992BActive Publication Date: 2025-10-24AMANO ENZYME INC
View PDF 7 Cites 0 Cited by

Patent Information

Application Number
CN202180025486.2
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Priority Date
2020-03-31
Filing Date
2021-03-30
Publication Date
2025-10-24
Estimated Expiration
2041-03-30

AI Technical Summary

Technical Problem

Existing collagenase has problems with safety, stability and activity when producing collagen tripeptide (CTP), making it particularly unsuitable for food and medical use.

Method used

Collagenase produced from a specific strain of Lysinibacillus fusiformis has high CTP production ability, high safety, and is stable under alkaline conditions. It is used to produce CTP.

Benefits of technology

It achieves efficient production of collagen tripeptides, suitable for food and medical use, and remains stable under alkaline conditions, making it suitable for tenderizing edible meat.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN115397992B_ABST
    Figure CN115397992B_ABST
Patent Text Reader

Abstract

Disclosed is a collagenase which is useful for food or medical use and has high safety. An enzyme agent containing a collagenase having an amino acid sequence having 90% or more homology with the amino acid sequence of SEQ ID NO: 1 as an effective ingredient is useful for the production of collagen tripeptides and the tenderization of edible meat.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application relates to an enzyme agent (collagenase agent) having collagenase as an effective ingredient and use thereof. BACKGROUND

[0002] The global market for collagen peptides, which are known as functional peptides, is expected to grow. Among collagen peptides, a tripeptide Gly-X-Y (collagen tripeptide. Hereinafter, sometimes abbreviated as "CTP"), which is the smallest unit of collagen, has high absorbability in the body and various functionalities, and is thus considered to have high utilization value.

[0003] In order to efficiently produce CTP, a protease (collagenase) that can specifically cleave at the Gly residue position of collagen or gelatin and decompose to a tripeptide is useful. As examples of collagenase, collagenases from Clostridium, Vibrio, and Bacillus cereus (belonging to microbial collagenase (EC.3.4.24.3)) are known, but collagenase-producing bacteria are biosafety level 2 (BSL2), and there are concerns about their safety, and thus it can be said that they are not suitable for producing CTP for food use, medical use, and the like.

[0004] As collagenases that can be used for food use, collagenases from Streptomyces are known (patent literature 1), but it is not clear whether they can be used for producing CTP. In addition, existing collagenases generally have poor stability. As collagenases from microorganisms that are considered to have excellent stability and also have high specific activity, collagenases from Vibrio hollisae are known (collagenase from Vibrio sp 1706B strain in patent literature 2) (patent literature 2, patent literature 3). However, the thermal stability of collagenases from Vibrio hollisae is 30°C or lower, which is not sufficient in practical use.

[0005] In addition, various collagenases that differ in properties are known. For example, collagenases from Clostridium histolyticum are known to have two different collagenase types (I, II), and collagenase I has higher activity against collagen and gelatin and lower activity against short-chain peptides than collagenase II (patent literature 4). Furthermore, collagenases from Clostridium histolyticum are known to have low degradation rates of CTP cleaved from collagen-like sequences (patent literature 5).

[0006] A collagenase suitable for use in food applications produced from collagen requires that the collagenase-producing bacterium be a safe bacterium, have collagen-reducing ability or gelatin-reducing ability, and have CTP-producing ability, and in addition, it is preferable to also require high stability, but a collagenase satisfying such conditions and being practical has not yet been known.

[0007] On the other hand, a collagenase suitable for use in edible meat tenderization requires that the collagenase-producing bacterium be a safe bacterium, have collagen specificity (not acting on lean meat), and in addition, it is preferable to also require high stability.

[0008] Prior art documents

[0009] Patent documents

[0010] Patent Document 1: Japanese Patent No. 5-16832

[0011] Patent Document 2: Japanese Patent No. 8-70853

[0012] Patent Document 3: Japanese Patent No. 2010-263880

[0013] Patent Document 4: Japanese Patent No. 2001-510331

[0014] Patent Document 5: Japanese Patent No. 2018-183106 SUMMARY

[0015] In the above-described background, the present application aims to provide a proteinase (collagenase) having high safety useful for food or medical applications such as the production of CTP, and uses thereof.

[0016] The present inventors and others have conducted extensive screening of enzymes from microorganisms in order to obtain a collagenase having high CTP-producing ability and also high safety. As a result, it was determined that a specific strain of Lysinibacillus fusiformis produces a collagenase in line with the objective. This collagenase exhibits collagenase-degrading ability, gelatin-degrading ability, and CTP-producing ability, and can be expected to specifically act on collagen and gelatin, and to have high industrial value. On the other hand, as a result of further research, a gene encoding this collagenase was successfully identified and obtained, and the properties of this collagenase were clarified. Note that this collagenase exhibits the properties of showing high thermal stability and having stable activity even in an alkaline region, which are preferred properties for tenderizers containing an alkaline pH adjuster such as sodium bicarbonate.

[0017] [1] An enzyme agent, with a collagenase composed of an amino acid sequence having 90% or more homology with the amino acid sequence of SEQ ID NO: 1 as an effective ingredient.

[0018] [2] The enzyme agent according to [1], wherein the collagenase is derived from Lysinibacillus fusiformis.

[0019] [3] The enzyme agent according to [1] or [2], for use in the manufacture of a collagen tripeptide.

[0020] [4] The enzyme agent according to [1] or [2], for use in tenderizing an edible meat.

[0021] [5] A method for manufacturing a collagen tripeptide, characterized by allowing the enzyme agent according to [3] to act on collagen or gelatin.

[0022] [6] A method for tenderizing an edible meat, characterized by allowing the enzyme agent according to [4] to act on the edible meat.

[0023] [7] A collagenase composed of an amino acid sequence having 99% or more homology with the amino acid sequence of SEQ ID NO: 1.

[0024] [8] A gene encoding the collagenase according to [7].

[0025] [9] The gene according to [8], composed of the base sequence of SEQ ID NO: 3 or 4. BRIEF DESCRIPTION OF DRAWINGS

[0026] Figure 1 Indicates the amino acid sequence of collagenase derived from Lysinibacillus fusiformis 57413 strain. The boxed indicates the predicted signal sequence. The underlined indicates the pro sequence.

[0027] Figure 2 Indicates the optimum temperature of collagenase derived from Lysinibacillus fusiformis 57413 strain.

[0028] Figure 3 Indicates the temperature stability of collagenase derived from Lysinibacillus fusiformis 57413 strain.

[0029] Figure 4 Indicates the optimum pH of collagenase derived from Lysinibacillus fusiformis 57413 strain.

[0030] Figure 5pH stability of the collagenase from Lysinibacillus fusiformis strain 57413.

[0031] Figure 6 Low temperature reactivity of the collagenase.

[0032] Figure 7 Results of confirming the production ability of Gly-Glu-Arg as a collagen tripeptide.

[0033] Figure 8 Results of confirming the production ability of Gly-Pro-Hyp as a collagen tripeptide.

[0034] Figure 9 Results of confirming the production ability of Gly-Pro-Ala as a collagen tripeptide.

[0035] Figure 10 Results of measuring the tenderizing effect on pork belly.

[0036] Figure 11 Results of measuring the tenderizing effect on beef chuck. DETAILED DESCRIPTION

[0037] 1. A collagenase agent and an effective component thereof (collagenase)

[0038] A first aspect of the present application relates to an enzyme agent (collagenase agent). The enzyme agent of the present application (hereinafter, also referred to as "the present enzyme agent") contains a collagenase (hereinafter, also referred to as "the present enzyme") as an effective component. The enzyme agent of the present application is useful for the production of collagen tripeptide, tenderization of meat, and the like (details will be described later). The collagenase as the effective component, i.e., the present enzyme is composed of the amino acid sequence shown in SEQ ID NO: 1 or an amino acid sequence equivalent thereto. The "equivalent amino acid sequence" herein means an amino acid sequence which is different from a part of the reference amino acid sequence (the amino acid sequence of SEQ ID NO: 1), but the difference does not substantially affect the function of the protein (here, the collagen degradation ability). Therefore, the enzyme having the equivalent amino acid sequence catalyzes the degradation reaction of collagen. The degree of activity is not particularly limited as long as it can exert the function as a collagenase. Among them, it is preferable to be the same degree or higher than that of the enzyme composed of the amino acid sequence as the reference (having the amino acid sequence of SEQ ID NO: 1).

[0039] The amino acid sequence of SEQ ID NO: 1 is that of a collagenase from Lysinibacillus fusiformis (mature). Note that the amino acid sequence of a collagenase from Lysinibacillus fusiformis including a signal peptide and a prosequence is shown in SEQ ID NO: 2.

[0040] The "part of the amino acid sequence is different" is produced, for example, by deletion, substitution, addition to, insertion of one or more amino acids in the amino acids constituting the amino acid sequence, or any combination thereof. The part of the amino acid sequence that is different can be allowed as long as the collagen-degrading activity is maintained (the activity can be slightly changed). The position where the amino acid sequence is different is not particularly limited as long as this condition is satisfied. In addition, the difference in the amino acid sequence can be produced at multiple positions (places).

[0041] The number of amino acids that cause the part of the amino acid sequence to be different is, for example, about less than 10% of the total number of amino acids constituting the amino acid sequence, preferably about less than 8%, more preferably about 6%, further preferably about less than 4%, more further preferably about less than 2%, most preferably about less than 1%. Thus, the equivalent protein has, for example, about 90% or more, preferably about 92% or more, more preferably about 94% or more, further preferably about 96% or more, more further preferably about 98% or more, most preferably about 99% or more homology with the amino acid sequence of the reference.

[0042] One of the typical examples of the "part of the amino acid sequence is different" is that the amino acid sequence is mutated (changed) by deletion, substitution, addition to, insertion of one to forty (preferably one to thirty, more preferably one to ten, further preferably one to seven, more further preferably one to five, further preferably one to three) amino acids in the amino acids constituting the amino acid sequence, or a combination thereof.

[0043] Preferably, equivalent amino acid sequences are obtained by making conservative amino acid substitutions to amino acid residues that are not essential for the ability to degrade collagen. A "conservative amino acid substitution" herein means the substitution of an amino acid residue for another with a side chain of similar properties. Amino acid residues are classified according to their side chains as follows: aliphatic side chains (e.g., glycine, alanine, valine, isoleucine, leucine); hydroxyl side chains (e.g., serine, threonine); amide side chains (e.g., asparagine, glutamine); sulfur containing side chains (e.g., cysteine, methionine); aromatic side chains (e.g., phenylalanine, tyrosine, tryptophan, histidine); and carboxylate side chains (e.g., aspartic acid, glutamic acid). Conservative amino acid substitutions are preferably substitutions between amino acid residues within the same family.

[0044] However, the homology (%) between two amino acid sequences can be determined, for example, as follows. First, the two sequences are aligned for optimal comparison purposes (e.g., gaps can be introduced in the first sequence for optimal alignment with the second sequence). The molecules at a particular position in the first sequence are identical to the molecules at the corresponding position in the second sequence when the molecules are identical. The homology between two sequences is a function of the number of positions in which the sequences share identity (i.e., homology (%) = number of shared positions / total number of positions x 100), preferably taking into account the number and size of gaps in the alignment.

[0045] Comparison of two sequences and determination of homology can be performed using a mathematical algorithm. As a specific example of a mathematical algorithm that can be used for comparison of sequences, there is an algorithm described in Karlin and Altschul (1990) Proc. Natl. Acad. Sci. USA 87: 2264-68, modified in Karlin and Altschul (1993) Proc. Natl. Acad. Sci. USA 90: 5873-77, but not limited thereto. Such an algorithm has been incorporated in the NBLAST program and the XBLAST program (version 2.0) described in Altschul et al. (1990) J. Mol. Biol. 215: 403-10. To obtain amino acid sequences equivalent to the amino acid sequence of the reference, for example, BLAST polypeptide search can be performed using the XBLAST program with score = 50, word length = 3. To obtain a gap alignment for comparison, Gapped BLAST described in Altschul et al. (1997) Amino Acids Research 25(17): 3389-3402 can be used. In the case of using BLAST and Gapped BLAST, the default parameters of the corresponding program (e.g., XBLAST and NBLAST) can be used. For details, refer to http: / / www.ncbi.nlm.nih.gov. As an example of other mathematical algorithms that can be used for comparison of sequences, there is an algorithm described in Myers and Miller (1988) Comput Appl Biosci. 4: 11-17. Such an algorithm has been incorporated in the ALIGN program available in the GENESTREAM network server (IGH Montpellier, France) or the ISREC server, for example. In the case of using the ALIGN program in comparison of amino acid sequences, for example, PAM120 weight residue table can be used, gap length penalty = 12, and gap penalty = 4.

[0046] Homology of two amino acid sequences can be determined using the GAP program of the GCG software package, using the Blossom 62 matrix or the PAM250 matrix, with gap weight = 12, 10, 8, 6, or 4, and gap length weight = 2, 3, or 4.

[0047] The collagenase as an effective ingredient of the present enzyme agent, i.e., the present enzyme can be a part of a larger protein (e.g., a fusion protein). As an additional sequence in the fusion protein, for example, there are sequences that facilitate purification such as multiple recombinant methionine residues, additional sequences that ensure stability during recombinant production, and the like.

[0048] The enzyme can be obtained by culturing a microorganism that produces the collagenase, a collagenase-producing strain, such as Lysinibacillus fusiformis. The collagenase-producing strain can be a wild strain or a mutant strain (e.g., a mutant strain obtained by irradiation with ultraviolet rays). A specific example of the collagenase-producing strain is Lysinibacillus fusiformis IFO 3528 (NBRC 15717). Lysinibacillus fusiformis IFO 3528 (NBRC 15717) is a strain deposited with the NBRC (National Institute of Technology and Evaluation Biological Resource Center), and its distribution product can be obtained by going through the prescribed procedures.

[0049] The enzyme can be prepared from a culture solution and / or a cell of a microorganism that produces the enzyme. The culture conditions and culture method are not particularly limited as long as the enzyme can be produced. That is, the method and culture conditions suitable for the microorganism to be cultured can be appropriately set as long as the enzyme can be produced. As the culture method, either of liquid culture and solid culture can be used, and liquid culture is preferred. The culture conditions are described below with reference to liquid culture.

[0050] As the culture medium, any medium in which the microorganism to be used can grow is acceptable. For example, a medium to which a carbon source such as glucose, sucrose, gentio-biose, soluble starch, glycerol, dextrin, molasses, an organic acid, and the like, further a nitrogen source such as ammonium sulfate, ammonium carbonate, ammonium phosphate, ammonium acetate, or gelatin, peptone, yeast extract, corn steep liquor, casein hydrolysate, bran, meat extract, and the like, further inorganic salts such as potassium salt, magnesium salt, sodium salt, phosphate salt, manganese salt, iron salt, zinc salt, and the like, are added can be used. In order to promote the growth of the microorganism to be used, vitamins, amino acids, and the like can be added. The pH of the culture medium is adjusted to about 3 to 8, preferably about 4 to 7, for example, and the culture temperature is usually about 20 to 40°C, preferably about 25 to 35°C. The culture is performed under aerobic conditions for 1 to 20 days, preferably about 3 to 10 days. As the culture method, for example, a shaking culture method, an aerobic deep culture method using a fermenter can be used.

[0051] After the cultivation under the above conditions, the target enzyme is recovered from the culture solution or the bacterial cells. When recovered from the culture solution, the enzyme can be obtained by, for example, removing insoluble matter from the culture supernatant by filtration, centrifugal treatment, or the like, and then appropriately combining concentration based on an ultrafiltration membrane, salting-out such as ammonium sulfate precipitation, dialysis, various chromatography methods such as ion exchange resin, and the like to separate and purify the enzyme. On the other hand, when recovered from the bacterial cells, the enzyme can be obtained by, for example, crushing the bacterial cells by pressurization treatment, ultrasonic treatment, or the like, and then separating and purifying the enzyme in the same manner as described above. Note that the bacterial cells can also be recovered from the culture solution in advance by filtration, centrifugal treatment, or the like, and then the above series of processes (crushing of the bacterial cells, separation, purification) can be performed.

[0052] The present enzyme can also be easily produced by genetic engineering methods. For example, it can be produced by transforming a suitable host cell (e.g., Escherichia coli) with DNA encoding the present enzyme, recovering the protein expressed in the transformant, and purifying the recovered protein as appropriate. As long as the target enzyme is obtained in the form of a recombinant protein in this way, various modifications can be performed. For example, if DNA encoding the present enzyme and other appropriate DNA are inserted into the same vector and the vector is used to produce a recombinant protein, the present enzyme composed of a recombinant protein having any peptide or protein attached thereto can be obtained. In addition, modifications such as the addition of sugar chains and / or lipids, or the processing of the N terminus or C terminus can also be performed. Through such modifications, the extraction and purification of the recombinant protein can be simplified, or the biological function can be added, and the like.

[0053] Generally, the expression of the gene - recovery of the expression product (the present enzyme) is performed using a suitable host-vector system as described above, but a cell-free synthesis system can also be used. Here, the "cell-free synthesis system (cell-free transcription system, cell-free transcription / translation system)" refers to a system in which, instead of using living cells, ribosomes, transcription / translation factors, and the like derived from living cells (or obtained by genetic engineering methods) are used to synthesize mRNA, proteins encoded by nucleic acids (DNA, mRNA) as templates in vitro. In the cell-free synthesis system, a cell extract obtained by purifying cell lysate as needed is generally used. The cell extract generally contains various factors such as ribosomes, initiation factors, and the like required for protein synthesis, various enzymes such as tRNA, and the like. When protein synthesis is performed, various amino acids, energy sources such as ATP, GTP, and the like, creatine phosphate, and other substances required for protein synthesis are added to the cell extract. Of course, when protein synthesis is performed, ribosomes, various factors, and / or various enzymes, and the like prepared separately can also be supplemented as needed.

[0054] Development of the transcription / translation system of each molecule (factor) required for reconstituting protein synthesis has also been reported (Shimizu, Y. et al.: Nature Biotech., 19, 751-755, 2001). In this synthesis system, genes of 31 factors consisting of 3 initiation factors, 3 elongation factors, 4 factors involved in termination, 20 aminoacyl tRNA synthetases that bind each amino acid to tRNA, and methionyl tRNA formyltransferase that constitute the protein synthesis system of bacteria are amplified from the genome of Escherichia coli, and a protein synthesis system is reconstituted in vitro using them. Such a reconstituted synthesis system can also be utilized in the present application.

[0055] The term "cell-free transcription / translation system" can be used interchangeably with cell-free protein synthesis system, in vitro translation system, or in vitro transcription / translation system. In the in vitro translation system, RNA is used as a template to synthesize a protein. Total RNA, mRNA, in vitro transcription product, etc. can be used as the template RNA. In other in vitro transcription / translation systems, DNA can be used as a template. The template DNA should contain a ribosome binding region, and preferably also contain an appropriate terminator sequence. It should be noted that in the in vitro transcription / translation system, conditions are set to add factors required for each reaction so that the transcription reaction and the translation reaction proceed consecutively.

[0056] The purified enzyme obtained as described above can also be provided in the form of a powder by, for example, freeze-drying, vacuum-drying, or spray-drying, etc. At this time, the purified enzyme can be previously dissolved in an acetic acid buffer, a phosphoric acid buffer, a triethanolamine buffer, a Tris-hydrochloric acid buffer, a buffer of GOOD. Preferably, an acetic acid buffer, a phosphoric acid buffer, a triethanolamine buffer can be used. It should be noted that, here, as the buffer of GOOD, PIPES, MES, or MOPS can be cited.

[0057] The degree of purification of the enzyme is not particularly limited, and, for example, the enzyme can be purified to a state where the Pz-peptide degrading activity is 2 to 20 (U / g). In addition, the final form can be in a liquid state, or in a solid state (including a powder state).

[0058] According to the research by the present inventors, etc., each property of the collagenase from Lysinibacillus fusiformis consisting of the amino acid sequence of SEQ ID NO: 1 was determined as follows (for details, refer to the Examples described later). Therefore, the present enzyme can also be determined in terms of the following enzymatic properties. It should be noted that the details of the measurement conditions, measurement procedures, etc. of the collagenase activity when evaluating each enzymatic property are shown in the Examples described later.

[0059] (1) Action

[0060] The enzyme is a collagenase which acts on collagen and gelatin to produce collagen tripeptide.

[0061] (2) Optimum temperature

[0062] The optimum temperature of the enzyme is 40°C.

[0063] (3) Temperature stability

[0064] The substantial activity of the enzyme is not reduced even if the enzyme is treated for 30 minutes at 40°C or lower (0°C to 40°C) in Tris-hydrochloric acid buffer at pH 7.

[0065] (4) Optimum pH

[0066] The optimum pH of the enzyme is about 7. For the optimum pH, for example, the result determined in acetic acid buffer is used for the pH region of pH 4 to 6, the result determined in PIPES buffer is used for the pH region of pH 6 to 7, and the result determined in Tris-hydrochloric acid buffer (Tris-HCl) is used for the pH region of pH 7 to 9.

[0067] (5) pH stability

[0068] The enzyme exhibits stable activity in the pH region of pH 5 to 9.5. For example, if the pH of the enzyme solution to be treated is within the range, the activity of 85% or more of the maximum activity is shown after treatment at 30°C for 30 minutes. For the pH stability, for example, the result determined in acetic acid buffer is used for the pH region of pH 4 to 6, the result determined in PIPES buffer is used for the pH region of pH 6 to 7, the result determined in Tris-hydrochloric acid buffer (Tris-HCl) is used for the pH region of pH 7 to 9, and the result determined in glycine buffer is used for the pH region of pH 9 to 11.

[0069] (6) Low-temperature reactivity

[0070] When the enzyme activity at a reaction temperature of 40°C is taken as 100%, the relative activity of the enzyme at a reaction temperature of 30°C is 40% or more, and the relative activity of the enzyme at a reaction temperature of 20°C is 10% or more.

[0071] By allowing the present enzyme to act on collagen or gelatin, a collagen tripeptide Gly-X-Y (CTP) having Gly (glycine) at the N terminus, such as Gly-Glu-Arg, Gly-Pro-Hyp, Gly-Pro-Ala, Gly-Ala-Hyp (Pro: proline, Hyp: hydroxyproline, Ala: alanine) can be obtained. The present enzyme is characterized in that the amount of Gly-Glu-Arg, which is a functional peptide, produced is particularly high when acting on collagen or gelatin.

[0072] The content of the effective component (the present enzyme) in the present enzyme agent is not particularly limited, and for example, the content of the effective component can be set or adjusted so as to be 1 U to 500 U, preferably 10 U to 300 U, of Pz-peptide degrading activity per 1 g of the present enzyme agent. The present enzyme agent is generally provided in a solid form (for example, an immobilized enzyme obtained by immobilizing the enzyme on a raw material capable of immobilizing the enzyme on the surface or inside of a particle, a powder, silica, a porous polymer, or the like) or a liquid form. The present enzyme agent can contain, in addition to the effective component (the present enzyme), an excipient, a buffer, a suspending agent, a stabilizer, a preservative, a preservative, physiological saline, or the like. As the excipient, lactose, sorbitol, D-mannitol, maltodextrin, white sugar, or the like can be used. As the buffer, a phosphate, a citrate, an acetate, or the like can be used. As the stabilizer, propylene glycol, ascorbic acid, or the like can be used. As the preservative, phenol, benzalkonium chloride, benzyl alcohol, chlorobutanol, methyl parahydroxybenzoate, or the like can be used. As the preservative, benzalkonium chloride, parahydroxybenzoic acid, chlorobutanol, or the like can be used.

[0073] 2. Gene

[0074] The present application provides a nucleic acid related to the present enzyme. That is, a gene encoding the present enzyme, a nucleic acid that can be used as a probe for identifying a nucleic acid encoding the present enzyme, and a nucleic acid that can be used as a primer for amplifying or mutating the nucleic acid of the present enzyme, or the like are provided. In one embodiment, the gene of the present application is composed of a DNA encoding the amino acid sequence of SEQ ID NO: 1. Specific examples of this embodiment are a DNA composed of the base sequence shown in SEQ ID NO: 3 and a DNA composed of the base sequence shown in SEQ ID NO: 4. The former DNA (SEQ ID NO: 3) encodes only the amino acid sequence of the mature body (SEQ ID NO: 1), and the latter DNA (SEQ ID NO: 4) encodes a signal peptide and a pre-sequence in addition to the amino acid sequence of the mature body (SEQ ID NO: 1).

[0075] The gene encoding the present enzyme is typically used for the production of the present enzyme. According to a genetic engineering production method using the gene encoding the present enzyme, the present enzyme can be obtained in a more homogeneous state. In addition, this method can be said to be a preferred method in the case of producing a large amount of the present enzyme. Note that the use of the gene encoding the present enzyme is not limited to the production of the present enzyme. For example, the nucleic acid can also be used as a tool for experiments aimed at elucidating the mechanism of action of the present enzyme and the like, or for designing or producing a variant of the present enzyme.

[0076] The "gene encoding the present enzyme" in the present specification refers to a nucleic acid that can obtain the present enzyme when expressed, and naturally includes a nucleic acid of a base sequence corresponding to the amino acid sequence of the present enzyme, and also includes a nucleic acid in which such a nucleic acid is additionally provided with a sequence that does not encode an amino acid sequence. In addition, the degeneracy of codons is also taken into consideration.

[0077] The nucleic acid of the present application can be produced in an isolated state using standard genetic engineering methods, molecular biological methods, biochemical methods, chemical synthesis, PCR methods (e.g., overlap PCR), or a combination thereof, with reference to the sequence information disclosed in the present specification or the attached sequence listing.

[0078] In another aspect of the present application, there is provided a nucleic acid that differs in a part of the base sequence when compared with the base sequence of the gene encoding the present enzyme, although it is equivalent in function and the like to the protein encoded thereby (hereinafter, also referred to as "equivalent nucleic acid". In addition, the base sequence that defines the equivalent nucleic acid is also referred to as "equivalent base sequence"). As an example of the equivalent nucleic acid, there can be mentioned a DNA that is composed of a base sequence in which one or a plurality of substitutions, deletions, insertions, additions, or inversions of bases are included with reference to the base sequence of the nucleic acid encoding the present enzyme of the present application, and that encodes a protein having an enzyme activity characteristic of the present enzyme (i.e., collagenase activity). The substitutions, deletions, and the like of bases can occur at a plurality of sites. The "plurality" here varies depending on the position and kind of the amino acid residue in the three-dimensional structure of the protein encoded by the nucleic acid, and is, for example, 2 to 40 bases, preferably 2 to 20 bases, more preferably 2 to 10 bases. The equivalent nucleic acid has, for example, 90% or more, preferably 92% or more, more preferably 94% or more, further preferably 96% or more, still further preferably about 98% or more, most preferably 99% or more homology with the base sequence serving as the reference (SEQ ID NO: 3 or SEQ ID NO: 4).

[0079] The equivalent nucleic acid as described above can be introduced by, for example, treatment with a restriction enzyme, treatment with an exonuclease, DNA ligase, and the like, introduction of a mutation based on a site-directed mutation introduction method (Molecular Cloning, Third Edition, Chapter 13, Cold Spring Harbor Laboratory Press, New York), a random mutation introduction method (Molecular Cloning, Third Edition, Chapter 13, Cold Spring Harbor Laboratory Press, New York), and the like. Alternatively, the equivalent nucleic acid can be obtained by other methods such as ultraviolet irradiation.

[0080] Other aspects of the application relate to a nucleic acid having a base sequence complementary to the base sequence of a gene encoding the present enzyme. Yet other aspects of the application provide a nucleic acid having a base sequence that is at least about 90%, 92%, 94%, 96%, 98%, or 99% identical to the base sequence of a gene encoding the present enzyme or a base sequence complementary thereto.

[0081] Still another aspect of the present application relates to a nucleic acid having a base sequence which hybridizes under stringent conditions to a base sequence of a gene encoding the present enzyme of the present application or a complementary base sequence thereof. The "stringent conditions" herein refer to conditions under which a so-called specific hybridizer is formed without a non-specific hybridizer. Such stringent conditions are well known to those skilled in the art, and can be set, for example, with reference to Molecular Cloning (Molecular Cloning (Third Edition, Cold Spring Harbor Laboratory Press, New York), Current protocols in molecular biology (Frederick M. Ausubel et al., 1987). As the stringent conditions, for example, conditions using a hybridization solution (50% formamide, 10 x SSC (0.15 M NaCl, 15 mM sodium citrate, pH 7.0), 5 x Denhardt solution, 1% SDS, 10% dextran sulfate, 10 μg / ml of denatured salmon sperm DNA, 50 mM phosphate buffer (pH 7.5)) for incubation at about 50°C, followed by washing with 0.1 x SSC, 0.1% SDS at about 65°C can be given. As further preferred stringent conditions, for example, conditions using 50% formamide, 5 x SSC (0.15 M NaCl, 15 mM sodium citrate, pH 7.0), 1 x Denhardt solution, 1% SDS, 10% dextran sulfate, 10 μg / ml of denatured salmon sperm DNA, 50 mM phosphate buffer (pH 7.5)) as a hybridization solution can be given.

[0082] Still another aspect of the present application provides a nucleic acid (nucleic acid fragment) having a part of a base sequence of a gene encoding the present enzyme of the present application or a complementary base sequence thereof. Such a nucleic acid fragment can be used for detection, identification and / or amplification, etc. of a nucleic acid having a base sequence of a gene encoding the present enzyme of the present application, etc. The nucleic acid fragment is designed, for example, in a manner so as to comprise at least a part which hybridizes with a part of nucleotides which are continuous in the base sequence of a gene encoding the present enzyme of the present application (e.g., about 10 to about 100 bases, preferably about 20 to about 100 bases, further preferably about 30 to about 100 bases). In the case of use as a probe, the nucleic acid fragment can be labeled. The labeling can be performed, for example, using a fluorescent substance, an enzyme, a radioisotope.

[0083] Still another aspect of the present application relates to a recombinant DNA comprising the gene of the present application (gene encoding the present enzyme). The recombinant DNA of the present application is provided, for example, in the form of a vector. The term "vector" in the present specification refers to a nucleic acid molecule which is capable of delivering a nucleic acid inserted into the vector into a target such as a cell.

[0084] The appropriate vector can be selected depending on the purpose of use (cloning, expression of the protein), and taking into consideration the kind of host cell. As the vector for the host of Escherichia coli, M13 phage or its variant, lambda phage or its variant, pBR322 or its variant (pB325, pAT153, pUC8, etc.) can be exemplified, as the vector for the host of yeast, pYepSec1, pMFa, pYES2, etc. can be exemplified, as the vector for the host of insect cells, pAc, pVL, etc. can be exemplified, and as the vector for the host of mammal cells, pCDM8, pMT2PC, etc. can be exemplified.

[0085] The vector of the present application is preferably an expression vector. The "expression vector" means a vector which is capable of introducing the nucleic acid inserted into the vector into the target cell (host cell) and is capable of expressing in the cell. The expression vector generally contains the promoter sequence, enhancer sequence, etc. required for the expression of the inserted nucleic acid, and promotes the expression. The expression vector containing a selection marker can also be used. When the above-described expression vector is used, the introduction of the expression vector (and the degree thereof) can be confirmed using the selection marker.

[0086] The insertion of the nucleic acid of the present application into the vector, the insertion of the selection marker gene (if necessary), the insertion of the promoter (if necessary), etc. can be performed using the standard recombinant DNA techniques (for example, refer to Molecular Cloning, Third Edition, 1.84, Cold Spring Harbor Laboratory Press, New York, the well-known method using restriction enzymes and DNA ligase).

[0087] As the host cell, from the aspect of easiness of operation, it is preferable to use microorganisms such as Escherichia coli, Bacillus subtilis, Saccharomyces cerevisiae, and the like, as long as the host cell is one in which the recombinant DNA can be replicated and the gene of the enzyme of the present application can be expressed. As the example of Escherichia coli, in the case of using the T7 system promoter, Escherichia coli BL21 (DE3) pLysS can be exemplified, and in the case of not using the T7 system promoter, Escherichia coli JM109 can be exemplified. In addition, as the example of Saccharomyces cerevisiae, Saccharomyces cerevisiae SHY2, Saccharomyces cerevisiae AH22, or Saccharomyces cerevisiae INVSc1 (Invitrogen Corporation) can be exemplified.

[0088] Yet another aspect of the present application relates to a microorganism (i.e., transformant) harboring the recombinant DNA of the present application. The microorganism of the present application can be obtained by transfection or transformation using the above-described vector of the present application. For example, the calcium chloride method (Journal of Molecular Biology (J. Mol. Biol.), Vol. 53, p. 159 (1970)), the Hanahan method (Journal of Molecular Biology, Vol. 166, p. 557 (1983)), the SEM method (Gene, Vol. 96, p. 23 (1990)), the method of Chung et al. (Proceedings of the National Academy of Sciences of the USA, Vol. 86, p. 2172 (1989)), calcium phosphate coprecipitation, electroporation (Potter, H. et al., Proc. Natl. Acad. Sci. U.S.A. 81, 7161-7165 (1984)), lipofection (Felgner, P. L. et al., Proc. Natl. Acad. Sci. U.S.A. 84, 7413-7417 (1984)), and the like can be utilized. It should be noted that the microorganism of the present application can be utilized for the production of the present enzyme.

[0089] 3. Use of the present enzyme agent

[0090] Still another aspect of the present application relates to the use of the present enzyme agent. As the first use, a method for producing collagen tripeptide (CTP) (hereinafter, referred to as "CTP production method") is provided. In the CTP production method of the present application, the present enzyme agent is allowed to act on collagen or gelatin (denatured collagen). For example, the present enzyme agent is added to a solution of collagen or gelatin, and allowed to react under conditions of, for example, 20 to 50°C, preferably 30 to 40°C, for a prescribed period of time (for example, 1 hour to 12 hours). The reduction reaction is carried out by the collagenase as an effective component of the present enzyme agent, and as a result, collagen tripeptide is produced. The composition, ratio, and the like of CTP in the product vary depending on the kind, source, and the like of the substrate (collagen or gelatin) used, and according to the production method of the present application, a composition containing tripeptide having Gly at the N terminus (for example, Gly-Glu-Arg, Gly-Pro-Hyp, Gly-Pro-Ala, Gly-Ala-Hyp) (i.e., a substance containing CTP) can be obtained. It is also one of the features of the present application that CTP can be produced by using the present enzyme agent alone. In this regard, other collagenases, proteases, or peptidases can be used in combination to achieve an improvement in production efficiency, and the like.

[0091] The origin of the collagen / gelatin used is not particularly limited, and examples thereof include fish, pig, cow, and chicken. Commercially available collagen or gelatin can also be used. The method for preparing the collagen or gelatin is also not particularly limited. For example, the raw material (animal skin, bone, tendon, fish scales, or the like) is washed with water and dried, and then deashed as needed using hydrochloric acid or the like, washed, and then subjected to a treatment with sodium hydroxide, hydrochloric acid, or the like to obtain crude collagen. Alternatively, gelatin can be extracted by subjecting the crude collagen to heat treatment.

[0092] After the enzyme reaction by the enzyme agent, purification treatment (for example, filtration, ion exchange, activated carbon treatment) can be performed as needed in order to achieve removal of insoluble components, improvement of purity, or decoloration, deodorization, or the like.

[0093] The second use of the enzyme agent is the improvement of the quality of edible meat. More specifically, the enzyme agent of the present application is used for the tenderization of edible meat. That is, a meat tenderization method is provided. If the enzyme agent of the present application is used, collagen in edible meat can be specifically cleaved, and edible meat with improved mouthfeel (typically, edible meat with suppressed dry woodiness and soft mouthfeel) can be obtained. The edible meat subjected to the enzyme reaction is not particularly limited, and edible meat rich in collagen (for example, shank meat, fascia meat) is an ideal treatment target. As shown in the examples described later, it was confirmed that the enzyme agent has the effect of not tenderizing red meat of pork ribs but tenderizing fat meat containing a large amount of collagen, and further has the effect of tenderizing fascia meat of beef shoulder. The term "edible meat" is used as a meaning including edible meat processed products. Therefore, the meat tenderization method of the present application can also be applied to improve the mouthfeel of formed meat, ham, and sausage, or the like. In the meat tenderization method of the present application, the enzyme agent is allowed to act on edible meat. The enzyme agent can be allowed to act on edible meat by a method in which edible meat is immersed in an enzyme solution (a solution of the enzyme agent), a method in which pressure treatment is performed to allow the enzyme solution to permeate into edible meat, a method in which the enzyme solution is injected into edible meat, a method in which the enzyme solution is injected into edible meat and tumbling (treatment for mechanically permeating the enzyme solution) is performed, or the like. The temperature conditions at the time of the action are, for example, 4 to 40°C, preferably 4 to 30°C, more preferably 4 to 25°C, and further preferably 4 to 20°C, and the action time (reaction time) is, for example, 1 hour to 1 day.

[0094] Example

[0095] 1. Screening of collagenase-producing strains

[0096] In order to find a collagenase that can be used in food, first, as a primary screening, 113 biosafety level 1 (BSL1) producing strains showing high activity were selected from a library of TAKARA BIO INC. by using collagenase activity as an index.

[0097] Next, as the second screening, the culture supernatant of the selected 113 strains of producing bacteria was allowed to react with gelatin, and the content of the peptide having Gly at the N terminus in the reaction product was evaluated, and 19 strains of producing bacteria were selected. The total peptide amount was quantified using the ninhydrin reagent. On the other hand, the amount of the peptide having Gly at the N terminus was quantified using a collagen quantification kit (manufactured by Cosmo Bio).

[0098] As the third screening, the culture supernatant of the 19 strains of producing bacteria and the reaction product with gelatin were subjected to partial purification of the tripeptide using gel filtration chromatography, and then analyzed by reverse phase chromatography. Based on the analysis results, the culture supernatant of the producing bacteria considered to be promising was subjected to partial purification, and the CTP production ability of the collagenase was evaluated, and thus the collagenase-producing bacterium Lysinibacillus fusiformis 57413 strain was finally selected.

[0099] 2. Preparation and purification of crude enzyme solution of collagenase of 57413 strain

[0100] The 57413 strain was cultured in a medium containing gelatin (5% fish gelatin, 0.5% yeast extract, 2% NaCl) at 30°C for 2 days with aeration and stirring. The obtained culture solution was centrifuged, and the supernatant was subjected to diatomite filtration to obtain a crude enzyme solution. The enzyme was further purified using hydrophobic chromatography (Pheny HP, manufactured by GE Healthcare Life Science), anion exchange chromatography (DEAE FF, manufactured by GE Healthcare Life Science).

[0101] 3. Confirmation of gene sequence of collagenase of 57413 strain

[0102] The 57413 strain was cultured in an SCD liquid medium at 30°C overnight, and the bacterial cells were recovered by centrifugation. The recovered bacterial cells were suspended in a TE buffer, and DNA was extracted using NucleoSpin (registered trademark) Microbial DNA (manufactured by Takara Bio Co., Ltd.). The extracted DNA was used as a template, and PCR was performed using the following upstream and downstream primers and PrimeSTAR (registered trademark) Max DNA Polymerase (manufactured by Takara Bio Co., Ltd.). The amplified PCR product was subjected to base sequence analysis using primers having homology with the inside and outside of the structural gene, and thus the sequence of the structural gene was confirmed. Figure 1

[0103] Upstream: Forward primer: GGAAACAATCTAAATGTGTCT (SEQ ID NO: 5)

[0104] ​Downstream: Reverse primer: CCGCCTTTAAAGGCTCTCCGA (SEQ ID NO: 6)

[0105] 4. Recombinant expression of collagenase

[0106] An expression plasmid was constructed by introducing the 57413 strain collagenase gene (SEQ ID NO: 2) into pCold III (manufactured by Takara Bio Inc.). Using the constructed expression plasmid, E. coli BL21 was transformed using a conventional method. The transformant was cultured overnight at 37°C using an LB medium (to which ampicillin was added), and then 1% of the culture solution was inoculated into an LB medium (to which ampicillin was added) and cultured at 37°C for 2 hours, after which IPTG was added and the culture was incubated overnight at 15°C. The bacterial cells were recovered from the culture solution by centrifugal separation, the bacterial cells were disrupted by ultrasonic disruption, and the supernatant was recovered by centrifugal separation to prepare a recombinant crude enzyme solution. The enzyme activity of the crude enzyme solution was confirmed by the following assay method, and as a result, it was found to have collagen degradation activity, Pz-peptide degradation activity, and CTP production ability. In addition, it did not have casein degradation activity, and it was highly likely to specifically act on collagen and gelatin.

[0107] <Pz-peptide degradation activity>

[0108] To 900 μL of 1 mg / mL Pz-peptide (Pz-Pro-Leu-Gly-Pro-D-Arg-OH, manufactured by BACHEM), 20 mM CaCl2, 200 mM Tris-HCl buffer solution, 100 μL of enzyme solution was added, and the reaction was started at 37°C. At 10 minutes and 20 minutes after the start of the reaction, 100 μL of the reaction solution was sampled and added to 200 μL of 25 mM citric acid solution to thereby prepare a reaction termination solution. To the reaction termination solution, 1 mL of ethyl acetate was added, and after stirring for 10 seconds, centrifugal separation was performed (12000 x g for 10 minutes), and the ethyl acetate layer of the supernatant was recovered. The absorbance at 320 nm of the recovered ethyl acetate layer of the supernatant was measured, and the amount of Pz-Pro-Leu released by the collagenase was calculated. The enzyme activity was evaluated by calculating the Pz-Pro-Leu production rate per 1 minute from the Pz-Pro-Leu production amount after 10 minutes and 20 minutes. The amount of enzyme that decomposes 1 μmol of Pz peptide (releases 1 μmol of Pz-Pro-Leu) per 1 minute was defined as 1 U.

[0109] <Collagenase activity>

[0110] Collagenase activity was measured using PROTAZYME OL TABLETS (Megazyme). One tablet of OL was suspended in 10 mM CaCl2 200 mM Tris buffer, and the resulting substrate solution was dispensed 300 μL into a 1.5 mL tube while stirring and placed on ice. To the dispensed substrate solution, 100 μL of a mixed enzyme solution was added, and the mixture was stirred for 30 minutes at 40°C to allow the reaction to proceed. After 30 minutes of reaction, 1 mL of 2% trisodium phosphate solution was added to terminate the enzyme reaction, and centrifugal separation was performed (13000 g, 10 minutes). The supernatant 200 μL was transferred to a microtiter plate, and the absorbance at 590 nm was measured. The intensity of collagenase activity was determined from the increase in the absorbance at 590 nm over 30 minutes.

[0111] <Casein degradation activity>

[0112] Casein degradation activity was measured using PROTAZYME AK TABLETS (Megazyme). One tablet of AK was suspended in 10 mM CaCl2 200 mM Tris buffer, and the resulting substrate solution was dispensed 300 μL into a 1.5 mL tube while stirring and placed on ice. To the dispensed substrate solution, 100 μL of a mixed enzyme solution was added, and the mixture was stirred for 30 minutes at 40°C to allow the reaction to proceed. After 30 minutes of reaction, 1 mL of 2% trisodium phosphate solution was added to terminate the enzyme reaction, and centrifugal separation was performed (13000 g, 10 minutes). The supernatant 200 μL was transferred to a microtiter plate, and the absorbance at 590 nm was measured. The intensity of casein degradation activity was determined from the increase in the absorbance at 590 nm over 30 minutes.

[0113] <Confirmation of CTP production ability>

[0114] After the reaction of the diluted enzyme solution with gelatin (final concentration 2% gelatin) was allowed to proceed for 12 hours, the reaction was terminated by boiling for 10 minutes. The reaction termination solution was diluted 10-fold with ultrapure water, and gel filtration analysis was performed using Superdex peptide 7.5 / 300 to confirm the amount of CTP produced. The conditions for gel filtration were as follows.

[0115] Superdex_peptide 7.5 / 300

[0116] Buffer: 0.02 M phosphate buffer containing 0.25 M NaCl, pH 7

[0117] Flow rate: 0.28 mL / min

[0118] Apply amount: 100 μL

[0119] Detection: 214nm

[0120] System: AKTA / Low Temperature Cabinet

[0121] 5. Enzymatic properties of 57413 collagenases

[0122] (1) Optimum temperature

[0123] The effect of temperature on the reactivity of this enzyme was confirmed. The activity was measured by changing the reaction temperature from 30°C to 60°C using a Pz-peptide substrate assay. The relative activity was evaluated by setting the maximum activity (highest activity value) as 100%. Figure 2 As shown, the optimum temperature is around 40°C.

[0124] (2) Temperature stability

[0125] To investigate the temperature stability of the enzyme, the enzyme solution was diluted 5-fold with 20mM CaCl2 and 200mM Tris hydrochloride buffer. The resulting samples were treated at various temperatures (0°C, 30°C, 40°C, 50°C, and 60°C) for 30 minutes, and then the activity was measured using a method using Pz-peptide as a substrate. Figure 3 As shown, it was found that the activity did not decrease from the treatment at 0°C (on ice) to the treatment at 40°C and was stable up to 40°C.

[0126] (3) Optimum pH

[0127] The effect of pH on the reactivity of this enzyme was investigated. The buffer for dissolving the Pz-peptide was changed from 20mM CaCl2, 200mM Tris hydrochloride buffer to 20mM CaCl2, 200mM buffer (acetic acid buffer for pH 4, 5, and 6, PIPES buffer for pH 6 and 7, Tris hydrochloride buffer for pH 7, 8, and 9, and glycine buffer for pH 9, 10, and 11), and the activity was measured. The relative activity was evaluated with the maximum activity set as 100%. Figure 4 As shown, it can be seen that the optimum pH is around 7.

[0128] (4) pH stability

[0129] The pH stability of the enzyme was investigated. The enzyme solution was diluted 5-fold with 20 mM CaCl2, 200 mM of each buffer (acetic acid buffer for pH 4, 5, 6, PIPES buffer for pH 6, 7, Tris hydrochloride buffer for pH 7, 8, 9, and glycine buffer for pH 9, 10, 11), and the activity was measured using the Pz-peptide substrate assay after treatment at 30°C for 30 minutes. The enzyme activity was evaluated as the relative activity, with the enzyme activity after 5-fold dilution with 20 mM CaCl2, 200 mM Tris hydrochloride buffer, pH 7, and storage at 0°C (on ice) taken as 100%. As shown in Table 1, it was found that the enzyme maintained high activity (85% or more) in the range of about pH 5 to about pH 9.5, and was stable in this pH region. Figure 5

[0130] 6. Low-temperature reactivity of the collagenase

[0131] <Method>

[0132] The low-temperature reactivity of the above-described collagenase 57413 (enzyme of the present application) and a collagenase from Streptomyces used for comparison was investigated. The collagenase activity was measured using PROTAZYME OL TABLETS (Megazyme, Inc., substrate: AZCL-collagen). One tablet of OL was suspended in 10 mM CaCl2, 200 mM Tris buffer, and 150 μL of the resulting substrate solution was dispensed into a 1.5 mL tube while stirring and placed on ice. To the dispensed substrate solution, 50 μL of a mixed enzyme solution was added, and the reaction was performed while stirring with a biological shaker set to an arbitrary temperature. The reaction was terminated by adding 500 μL of 2% trisodium phosphate solution, and then centrifuged (13000 g, 10 minutes). 200 μL of the supernatant was transferred to a microtiter plate, and the absorbance at 590 nm was measured. The intensity of the collagenase activity was evaluated from the increase in absorbance at 590 nm.

[0133] <Results>

[0134] The results are shown in Table 1 and Figure 6 The relative activity of the collagenase of the present application at 20 to 30°C was higher than that of the enzyme used for comparison.

[0135] [Table 1]

[0136]

[0137] 7. Confirmation of collagen tripeptide production ability

[0138] <Method>

[0139] ​The following experiments were performed using 57413 collagenase (enzyme of the present application) and collagenase from Streptomyces as a comparative enzyme.

[0140] (Native collagen degradation activity assay)

[0141] To 5 mL of 50 mM TES buffer (pH 7.4) containing 25 mg of insoluble type I collagen from bovine Achilles tendon (SIGMA) and 0.36 mM CaCl2, 0.1 mL of enzyme solution was added to react for 5 hours at 37°C, and the reaction solution was subjected to filter paper filtration. After 100 μL of the filtrate was added with 1 mL of ninhydrin reagent containing 0.1 M citric acid (pH 5.0), heated at 100°C for 20 minutes and cooled, 5 mL of 50% 1-propanol was added, and the increase in absorbance at 570 nm was measured. One collagen degradation unit (CDU) was defined as the amount of enzyme that liberates peptides equivalent to 1.0 μmol of leucine from collagen in the presence of Ca ions when incubated at 37°C, pH 7.4 for 5 hours.

[0142] (Collagen tripeptide production confirmation)

[0143] After the enzyme solution after the stage dilution was reacted with 5% fish gelatin type A (Nitta Gelatin Corporation) for 20 hours, the reaction was terminated by boiling for 10 minutes. After the reaction termination solution was diluted 4-fold with ethanol, the precipitate was removed by centrifugal separation, and the supernatant was diluted with ultrapure water to 50 ppm in terms of gelatin, subjected to MF (0.45 μm) treatment, and evaluated for the peak areas of Gly-Pro-Hyp Gly-Pro-Ala, Gly-Glu-Arg in CTP by LC-MS analysis. The CTP production ability of the present enzyme was compared with that of collagenase from Streptomyces.

[0144] (LC-MS analysis)

[0145] Column: TSK gel ODS-80™ 150 mm

[0146] Solvent: ultrapure water + 0.1% formic acid

[0147] Flow rate: 1 mL / min

[0148] Injection amount: 1 μL

[0149] Detection: positive ion mode, SIM method

[0150] <Results>

[0151] The results are shown in Figures 7-9 .

[0152] It was found that the enzyme showed the same amount of Gly-Pro-Hyp and Gly-Pro-Ala production as collagenase from Streptomyces, and further, the Gly-Glu-Arg production ability was superior to that of collagenase from Streptomyces.

[0153] 8. Confirmation of meat tenderizing effect

[0154] The following experiment was performed using 57413 strain collagenase (enzyme of the present application) and collagenase from Streptomyces as a comparison.

[0155] 8-1. Tenderizing effect on pork belly

[0156] <Method>

[0157] The curing solution (sodium chloride 1.5 w / v%, sodium bicarbonate 1.5 w / v%, calcium lactate 0.7 w / v%) containing 30 CDU / mL of collagenase was randomly injected into 140 g of pork belly 13.5 mL, and after kneading by hand, it was stored in a refrigerator (about 5°C) for 3 days. Then, the pork belly was divided into 4 portions and treated by stewing for 10 minutes, and then divided into fat and lean, and the physical properties were evaluated using a rheometer (TOKI SCIENCE) for each. The results obtained by measuring the load at a depth of 3 mm are shown below. The lower the value of the load, the softer it is.

[0158] <Results>

[0159] The results are shown in Figure 10 .

[0160] It was shown that the enzyme had an effect of tenderizing fat without tenderizing lean, unlike collagenase from Streptomyces.

[0161] 8-2. Tenderizing effect on beef chuck

[0162] <Method>

[0163] After cutting the fascia portion of beef chuck into cubes of 1 cm on a side, it was immersed in an enzyme solution (30 CDU / mL) 30 mL, and stored in a refrigerator (about 5°C) for 3 days. After the treatment, the physical properties (breaking strength and load at a depth of 3 mm) were evaluated using a rheometer without heating. Both the breaking strength and the load were used as indices of the degree of tenderization, and the lower the value, the softer it was.

[0164] <Results>

[0165] The results are shown in Figure 11 .

[0166] It was found that the enzyme has low breaking strength and load compared to collagenase from Streptomyces, and has an effect of easily breaking and softening the fascia portion of beef shoulder meat.

[0167] Industrial applicability

[0168] The enzyme agent of the present application has collagenase from a microorganism with high safety as an effective ingredient. Therefore, it is suitable for use in the field of food, medical use, and has high industrial applicability.

[0169] The present application is not limited to the above-described embodiments and examples. Various modifications that can be easily conceived by those skilled in the art without departing from the scope of the patent claims are also included in the present application. The entire contents of the articles, Japanese Published Patent Publications, Japanese Patent Publications, and the like described in the specification are incorporated by reference.

[0170] [Sequence Listing Free Text]

[0171] SEQ ID NO: 5: Explanation of artificial sequence: forward primer

[0172] SEQ ID NO: 6: Explanation of artificial sequence: reverse primer SEQUENCE LISTING <110> Amano Enzyme Inc. <120> Collagenase agent and use thereof <130> F21605A-WO <160> 6 <170> PatentIn version 3.5 <210> 1 <211> 987 <212> PRT <213> Bacillus fusiformis <400> 1 Asp Thr Gln Gln Leu Gln Glu Gln Tyr Ser Met Ala Glu Leu Asn Asn 1 5 10 15 Met Ser Asn Arg Glu Leu Ile His Thr Leu Gly Ser Ile Arg Trp Tyr 20 25 30 Gln Ile Thr Asp Leu Phe Gln Phe Asn Asp Asp Thr Lys Ala Phe Tyr 35 40 45 Gln Asn Glu Glu Arg Met Gln Val Ile Ile Asn Glu Leu Gly Asn Arg 50 55 60 Gly Asn Ser Phe Thr Lys Glu Asp Ser Lys Gly Ile Glu Thr Phe Val 65 70 75 80 Glu Val Leu Arg Ser Ala Phe Tyr Val Ala Phe Tyr Asn Asn Glu Leu 85 90 95 Gly Tyr Leu Asn Glu Arg Ser Phe Gln Asp Lys Cys Leu Pro Ala Leu 100 105 110 Asn Glu Ile Ala Lys Asn Pro Asn Phe Lys Leu Gly Thr Asp Glu Gln 115 120 125 Asp Lys Val Val Ser Ala Tyr Gly Lys Leu Ile Gly Asn Ala Ser Ser 130 135 140 Asp Val Glu Thr Val Gln His Ala Thr Asn Ile Leu Lys Gln Tyr Asn 145 150 155 160 Glu Asn Leu Ser Thr Tyr Glu Ser Glu Asn Ser Lys Gly Gln Ala Ile 165 170 175 Tyr Asp Ile Ile His Gly Ile Asp Tyr Asp Leu Gln Ser Tyr Leu Tyr 180 185 190 Asp Thr Arg Lys Glu Ala Asn Thr Thr Met Trp Tyr Gly Lys Ile Asp 195 200 205 Ser Phe Ile Glu Glu Val Asn Asn Ile Ala Leu Ile His Asn Val Thr 210 215 220 Asp Ser Asn Ser Trp Leu Ile Asn Asn Gly Ile Tyr Tyr Ala Gly Arg 225 230 235 240 Leu Gly Gln Phe His Ser Asn Pro Asn Lys Gly Leu Glu Val Val Thr 245 250 255 Gln Ala Met His Met Tyr Pro Tyr Leu Ser Glu Ala Tyr Phe Val Ala 260 265 270 Val Glu Gln Ile Thr Thr Asn Tyr Gly Gly Arg Asp Leu Asn Gly Asn 275 280 285 Thr Val Asp Leu Gln Lys Val Arg Glu Glu Gly Lys Lys Gln Tyr Leu 290 295 300 Pro Lys Thr Tyr Thr Phe Asp Asp Gly Ser Ile Val Phe Lys Thr Gly 305 310 315 320 Asp Gln Val Thr Glu Asp Lys Ile Gln Arg Leu Tyr Trp Ala Ala Lys 325 330 335 Glu Val Lys Ala Gln Tyr His Arg Val Ile Gly Asn Asp Gln Ala Leu 340 345 350 Glu Pro Gly Asn Ala Asp Asp lie Leu Thr Val Val lie Tyr Asn Ser 355 360 365 Pro Asp Gin Tyr Arg Leu Asn Arg Gin Leu Tyr Gly Tyr Glu Thr Asn 370 375 380 Asn Gly Gly lie Tyr lie Glu Glu Thr Gly Thr Phe Phe Thr Tyr Glu 385 390 395 400 Arg Thr Pro Glu Gin Ser lie Tyr Ser Leu Glu Glu Leu Phe Arg His 405 410 415 Glu Tyr Thr His Phe Leu Gin Gly Arg Phe Glu Val Pro Gly Leu Phe 420 425 430 Gly Thr Gly Asp Met Tyr Gin Asn Glu Arg Leu Thr Trp Phe Gin Glu 435 440 445 Gly Asn Ala Glu Phe Phe Ala Gly Ser Thr Arg Thr Asn Asp Val Val 450 455 460 Pro Arg Lys Ser lie lie Ser Gly Leu Ser Gin Asp Pro Ser Gin Arg 465 470 475 480 Tyr Thr Ala Glu Gin Thr Met Phe Ala Thr Tyr Gly Ser Trp Asp Phe 485 490 495 Tyr Asn Tyr Ser Phe Ala Leu Gin Ser Tyr Met Tyr Thr His Gin Phe 500 505 510 Asp Met Phe Asp Arg Ile Gin Asp Leu Ile Arg Ala Asn Asp Val Lys 515 520 525 Asn Tyr Asp Ala Tyr Arg Asp Thr Leu Ser Lys Asp Ser Gin Leu Asn 530 535 540 Met Glu Tyr Gin Ala Tyr Met Gin Gin Leu Ile Asp Asn Gin Gin Thr 545 550 555 560 Tyr Gin Val Pro Gin Val Ala Gin Asp Tyr Leu Met Pro His Gin Pro 565 570 575 Lys Ala Leu Asn Gin Val Gin Gin Gin Ile Val Asp Ile Ala His Val 580 585 590 Lys Asp Ala Asn Met Thr Lys His Gin Ser Gin Phe Phe Asn Thr Phe 595 600 605 Thr Leu Gin Gin Thr Tyr Val Gly Ser Ala Thr Gin Gin Gin Gin Gin Gin 610 615 620 Asp Trp Lys Thr Met Ser Lys Gin Val Asn Gin Met Leu Gin Gin Leu 625 630 635 640 Ser Gin Lys Gin Trp Ser Gly Tyr Lys Thr Met Thr Ala Tyr Phe Val 645 650 655 Asn Tyr Arg Val Asn Ala Ala Asn Gin Phe Gin Tyr Asp Val Val Phe 660 665 670 His Gly Val Ser Thr Asp Asp Gly Glu Thr Gln Ala Pro Ile Val Gln 675 680 685 Val Asn Gly Pro Tyr Thr Gly Met Ile Asn Glu Lys Ile Gln Phe Asn 690 695 700 Ser Asp Gly Ser Lys Asp Thr Asp Gly Glu Ile Val Ser Tyr Leu Trp 705 710 715 720 Asp Phe Gly Asp Gly Ala Thr Ser Glu Ala Ala Asn Pro Thr His Val 725 730 735 Tyr Glu Asn Glu Gly Thr Tyr Lys Val Thr Leu Thr Val Lys Asn Asn 740 745 750 Lys Gly Gln Glu Ser Lys Gly Gln Thr Thr Ala Thr Val Gln Lys Gly 755 760 765 Gly Gln Thr Gly Gln Glu His Ala Met Ile Ile Pro Phe Asn Lys Pro 770 775 780 Leu Lys Gly Ser Leu Ile Glu Asn Asp Thr Asn Val Tyr Gln Phe Asp 785 790 795 800 Ile Thr Ser Pro Glu Glu Ile Asp Ile Ser Val Val Asn Glu Asn Gln 805 810 815 Ile Gly Met Thr Trp Val Leu Tyr His Glu Ser Asp Lys Glu Asn Tyr 820 825 830 Val Ala Tyr Gly Gin Glu Asp Gly Gin Thr He Lys Gly Lys Tyr Asn 835 840 845 Ala Lys Pro Gly Lys Tyr Tyr Leu Tyr Val Tyr Lys Phe Asp Asp Glu 850 855 860 Asp Gly Thr Tyr Thr Val Gin Val Gin Asn Ser Thr Lys Thr Glu He 865 870 875 880 Glu Pro Asn Asn Arg Pro Glu Glu Ala Thr Met Leu Pro Phe His Thr 885 890 895 Pro Leu Ser Gly Ser Leu Met Glu Asp Asp His Thr Asp Val Tyr Glu 900 905 910 Phe Asn Val Thr Ser Pro Lys Glu He Asp He Ser Val Leu Asn Glu 915 920 925 Asn Gin He Gly Met Thr Trp Val Leu Tyr His Glu Ser Asp Ser Gin 930 935 940 Asn Tyr Ala Ser Phe Gly Gin Glu Asp Gly Asn Met He Asn Gly Lys 945 950 955 960 Leu Asn Ala Lys Pro Gly Lys Tyr Tyr Leu Tyr Val Tyr Lys Phe Glu 965 970 975 Asn Glu Asn Gly Thr Tyr Thr Val His Val Gin 980 985 <210> 2 <211> 1072 <212> PRT <213> Fusiform lysine bacillus <400> 2 Met Lys Lys Lys Phe Thr Phe Asn Gln Leu Leu Ile Gly Val Ser Thr 1 5 10 15 Met Ala Ile Ser Leu Gly Gly Leu Gln Ala Glu Ala Ser Ala Ala Glu 20 25 30 Lys Thr Pro Tyr Asn Val Leu Gln Met Lys Pro Ile Gly Ile Glu Met 35 40 45 Ser Lys Asp Glu Met Val His Ser Thr Met Ala Glu Glu Thr Leu Ser 50 55 60 Tyr Glu Glu Arg Leu Glu Met Gly Asp Phe Ser Gln Arg Pro Ala Pro 65 70 75 80 Ile Met Glu Gln Met Asp Thr Gln Gln Leu Gln Glu Gln Tyr Ser Met 85 90 95 Ala Glu Leu Asn Asn Met Ser Asn Arg Glu Leu Ile His Thr Leu Gly 100 105 110 Ser Ile Arg Trp Tyr Gln Ile Thr Asp Leu Phe Gln Phe Asn Asp Asp 115 120 125 Thr Lys Ala Phe Tyr Gln Asn Glu Glu Arg Met Gln Val Ile Ile Asn 130 135 140 Glu Leu Gly Asn Arg Gly Asn Ser Phe Thr Lys Glu Asp Ser Lys Gly 145 150 155 160 Ile Glu Thr Phe Val Glu Val Leu Arg Ser Ala Phe Tyr Val Ala Phe 165 170 175 Tyr Asn Asn Glu Leu Gly Tyr Leu Asn Glu Arg Ser Phe Gln Asp Lys 180 185 190 Cys Leu Pro Ala Leu Asn Glu Ile Ala Lys Asn Pro Asn Phe Lys Leu 195 200 205 Gly Thr Asp Glu Gln Asp Lys Val Val Ser Ala Tyr Gly Lys Leu Ile 210 215 220 Gly Asn Ala Ser Ser Asp Val Glu Thr Val Gln His Ala Thr Asn Ile 225 230 235 240 Leu Lys Gln Tyr Asn Glu Asn Leu Ser Thr Tyr Glu Ser Glu Asn Ser 245 250 255 Lys Gly Gln Ala Ile Tyr Asp Ile Ile His Gly Ile Asp Tyr Asp Leu 260 265 270 Gln Ser Tyr Leu Tyr Asp Thr Arg Lys Glu Ala Asn Thr Thr Met Trp 275 280 285 Tyr Gly Lys Ile Asp Ser Phe Ile Glu Glu Val Asn Asn Ile Ala Leu 290 295 300 Ile His Asn Val Thr Asp Ser Asn Ser Trp Leu Ile Asn Asn Gly Ile 305 310 315 320 Tyr Tyr Ala Gly Arg Leu Gly Gln Phe His Ser Asn Pro Asn Lys Gly 325 330 335 Leu Glu Val Val Thr Gln Ala Met His Met Tyr Pro Tyr Leu Ser Glu 340 345 350 Ala Tyr Phe Val Ala Val Glu Gln Ile Thr Thr Asn Tyr Gly Gly Arg 355 360 365 Asp Leu Asn Gly Asn Thr Val Asp Leu Gln Lys Val Arg Glu Glu Gly 370 375 380 Lys Lys Gln Tyr Leu Pro Lys Thr Tyr Thr Phe Asp Asp Gly Ser Ile 385 390 395 400 Val Phe Lys Thr Gly Asp Gln Val Thr Glu Asp Lys Ile Gln Arg Leu 405 410 415 Tyr Trp Ala Ala Lys Glu Val Lys Ala Gln Tyr His Arg Val Ile Gly 420 425 430 Asn Asp Gln Ala Leu Glu Pro Gly Asn Ala Asp Asp Ile Leu Thr Val 435 440 445 Val Ile Tyr Asn Ser Pro Asp Gin Tyr Arg Leu Asn Arg Gin Leu Tyr 450 455 460 Gly Tyr Glu Thr Asn Asn Gly Gly Ile Tyr Ile Glu Glu Thr Gly Thr 465 470 475 480 Phe Phe Thr Tyr Glu Arg Thr Pro Glu Gin Ser Ile Tyr Ser Leu Glu 485 490 495 Glu Leu Phe Arg His Glu Tyr Thr His Phe Leu Gin Gly Arg Phe Glu 500 505 510 Val Pro Gly Leu Phe Gly Thr Gly Asp Met Tyr Gin Asn Glu Arg Leu 515 520 525 Thr Trp Phe Gin Gin Gly Asn Ala Gin Phe Phe Ala Gly Ser Thr Gin 530 535 540 Thr Asn Asp Val Val Pro Arg Lys Ser Ile Ile Ser Gly Leu Ser Gin 545 550 555 560 Asp Pro Ser Gin Arg Tyr Thr Ala Glu Gin Thr Met Phe Ala Thr Tyr 565 570 575 Gly Ser Trp Asp Phe Tyr Asn Tyr Ser Phe Ala Leu Gin Ser Tyr Met 580 585 590 Tyr Thr His Gin Phe Asp Met Phe Asp Arg Ile Gin Asp Leu Ile Arg 595 600 605 Ala Asn Asp Val Lys Asn Tyr Asp Ala Tyr Arg Asp Thr Leu Ser Lys 610 615 620 Asp Ser Gln Leu Asn Met Glu Tyr Gln Ala Tyr Met Gln Gln Leu Ile 625 630 635 640 Asp Asn Gln Glu Thr Tyr Glu Val Pro Gln Val Ala Glu Asp Tyr Leu 645 650 655 Met Pro His Glu Pro Lys Ala Leu Asn Glu Val Gln Gln Glu Ile Val 660 665 670 Asp Ile Ala His Val Lys Asp Ala Asn Met Thr Lys His Gln Ser Gln 675 680 685 Phe Phe Asn Thr Phe Thr Leu Glu Gly Thr Tyr Val Gly Ser Ala Thr 690 695 700 Gln Gly Glu Ser Gln Asp Trp Lys Thr Met Ser Lys Gln Val Asn Gln 705 710 715 720 Met Leu Glu Gln Leu Ser Gln Lys Glu Trp Ser Gly Tyr Lys Thr Met 725 730 735 Thr Ala Tyr Phe Val Asn Tyr Arg Val Asn Ala Ala Asn Gln Phe Glu 740 745 750 Tyr Asp Val Val Phe His Gly Val Ser Thr Asp Asp Gly Glu Thr Gln 755 760 765 Ala Pro Ile Val Gin Val Asn Gly Pro Tyr Thr Gly Met Ile Asn Glu 770 775 780 Lys Ile Gin Phe Asn Ser Asp Gly Ser Lys Asp Thr Asp Gly Glu Ile 785 790 795 800 Val Ser Tyr Leu Trp Asp Phe Gly Asp Gly Ala Thr Ser Glu Ala Ala 805 810 815 Asn Pro Thr His Val Tyr Glu Asn Glu Gly Thr Tyr Lys Val Thr Leu 820 825 830 Thr Val Lys Asn Asn Lys Gly Gin Glu Ser Lys Gly Gin Thr Thr Ala 835 840 845 Thr Val Gin Lys Gly Gly Gin Thr Gly Gin Glu His Ala Met Ile Ile 850 855 860 Pro Phe Asn Lys Pro Leu Lys Gly Ser Leu Ile Glu Asn Asp Thr Asn 865 870 875 880 Val Tyr Gin Phe Asp Ile Thr Ser Pro Glu Glu Ile Asp Ile Ser Val 885 890 895 Val Asn Glu Asn Gin Ile Gly Met Thr Trp Val Leu Tyr His Glu Ser 900 905 910 Asp Lys Glu Asn Tyr Val Ala Tyr Gly Gin Glu Asp Gly Gin Thr Ile 915 920 925 Lys Gly Lys Tyr Asn Ala Lys Pro Gly Lys Tyr Tyr Leu Tyr Val Tyr 930 935 940 Lys Phe Asp Asp Glu Asp Gly Thr Tyr Thr Val Gln Val Gln Asn Ser 945 950 955 960 Thr Lys Thr Glu Ile Glu Pro Asn Asn Arg Pro Glu Glu Ala Thr Met 965 970 975 Leu Pro Phe His Thr Pro Leu Ser Gly Ser Leu Met Glu Asp Asp His 980 985 990 Thr Asp Val Tyr Glu Phe Asn Val Thr Ser Pro Lys Glu Ile Asp Ile 995 1000 1005 Ser Val Leu Asn Glu Asn Gln Ile Gly Met Thr Trp Val Leu Tyr 1010 1015 1020 His Glu Ser Asp Ser Gln Asn Tyr Ala Ser Phe Gly Gln Glu Asp 1025 1030 1035 Gly Asn Met Ile Asn Gly Lys Leu Asn Ala Lys Pro Gly Lys Tyr 1040 1045 1050 Tyr Leu Tyr Val Tyr Lys Phe Glu Asn Glu Asn Gly Thr Tyr Thr 1055 1060 1065 Val His Val Gln 1070 <210> 3 <211> 2964 <212> DNA <213> Paenibacillus fusiformis <400> 3 gatacacagc aattgcagga gcagtactcg atggcagagc ttaataatat gagcaatcgt 60 gagcttatcc atacgcttgg cagtatccgt tggtaccaaa ttacagactt attccaattc 120 aatgatgaca caaaagcttt ttatcaaaat gaagagcgca tgcaagtaat catcaatgaa 180 ttagggaata gaggaaattc gtttacgaag gaagattcaa aggggatcga aacatttgtt 240 gaggtattgc gttctgcttt ttatgtagcg ttttataata atgaactagg ctatttaaat 300 gagagaagtt tccaagataa gtgtttacca gcattaaatg aaatagccaa aaatccaaac 360 tttaaacttg gtacagatga gcaagataaa gttgtatctg cctatggaaa attaataggt 420 aatgcttcta gtgatgtgga aaccgttcaa catgctacga acattttaaa acaatataat 480 gaaaatcttt ctacctatga aagtgagaat tcaaaaggac aagctattta cgatataata 540 cacggcattg attatgattt gcagtcttat ttatatgaca ctcgtaaaga ggccaataca 600 acgatgtggt atgggaagat tgatagcttc atagaggaag ttaataacat tgccctaata 660 cataatgtga cggatagcaa tagttggtta attaataatg gcatttatta tgcagggcgt 720 ttagggcagt tccatagcaa tcctaataag ggtttagaag tcgttacaca agcgatgcat 780 atgtatccct atttaagtga agcttatttt gtggcagtag agcaaattac gacaaattat 840 ggtggacgtg acttaaacgg aaatacggtt gatttacaaa aagtacgtga agaaggaaaa 900 aaacagtatc taccgaaaac atatacattt gatgatggat caattgtatt caaaacggga 960 gatcaagtaa cggaagataa aattcaaaga ttatactggg ctgcaaaaga ggtaaaggca 1020 caatatcatc gtgtaatcgg gaatgatcaa gcactagagc ctggtaatgc tgacgatatc 1080 ttaaccgttg tcatttataa ctctcccgat cagtaccgat taaaccgaca attgtacgga 1140 tatgaaacaa ataatggtgg tatttatatt gaagagactg gaacattctt tacatatgaa 1200 cgtacacctg agcaaagtat ttatagctta gaagagctgt tccgtcatga atatacgcac 1260 tttttacaag gtagatttga ggtgcctggt ctattcggga cgggtgatat gtatcaaaat 1320 gagcgactaa catggttcca ggaagggaat gcagaatttt ttgcagggtc aacacgtaca 1380 aatgacgttg tgcctcgtaa gagcattatt agtggattgt cacaggatcc atcacaacgc 1440 tatactgctg aacaaacaat gtttgccaca tatggttcct gggattttta taattattca 1500 tttgcattac agtcttatat gtatacgcat caattcgata tgtttgatag aattcaagat 1560 ttaatccgcg cgaacgatgt gaaaaattat gatgcctatc gtgacacttt aagtaaagat 1620 tcacagctga atatggaata ccaagcatat atgcagcaat tgatcgataa ccaagaaaca 1680 tacgaagtac cacaagtagc agaggattat ttaatgccgc atgaaccaaa agcgttaaac 1740 gaagtacagc aagaaattgt cgatattgca catgtgaaag atgcaaatat gacgaaacac 1800 cagtctcaat tttttaatac gtttacactc gagggaacat atgtaggtag tgcaacacag 1860 ggtgaatctc aagattggaa aacgatgagt aagcaagtaa accaaatgct ggagcaactg 1920 tctcaaaaag agtggagcgg ctataaaaca atgactgcgt actttgtcaa ctatcgtgta 1980 aatgcggcaa accagttcga gtatgatgta gtcttccatg gcgtttccac tgatgacgga 2040 gaaacgcaag caccaattgt acaagtaaat ggtccatata ctggcatgat caatgaaaaa 2100 attcaattta atagtgatgg gtcaaaggat acggatggag aaatagtttc ttatctttgg 2160 gattttggtg atggcgcgac aagtgaagca gcaaatccta ctcatgtata cgaaaatgaa 2220 ggaacttaca aagtgacgtt aaccgtgaaa aataataagg gacaagaaag taaagggcaa 2280 acaactgcca ctgtacagaa aggaggacag acagggcaag aacatgcgat gattattcca 2340 tttaataaac cactaaaagg tagtttgata gaaaatgata caaatgtcta tcaatttgac 2400 attacatcgc cagaagaaat agatatttct gtcgtaaatg aaaatcaaat tggcatgaca 2460 tgggtgcttt atcatgaatc tgataaggaa aactatgtag cgtatggaca ggaagatgga 2520 cagacaataa aaggtaagta caatgcgaaa ccaggaaagt attatttata cgtttataag 2580 tttgatgatg aagatggaac atataccgtt caagtacaaa atagtacaaa aacggagata 2640 gaaccaaaca atcgtccaga agaagccact atgcttccat ttcatacacc actaagcggt 2700 agtttaatgg aggatgatca tacggatgta tacgaattca atgttacatc tcctaaagaa 2760 atagatatat ctgttttaaa tgaaaaccaa attggcatga catgggtgct ttatcatgaa 2820 tcagatagcc aaaattatgc gtcttttgga caggaagacg gaaacatgat aaacggtaaa 2880 ttgaatgcaa agcctggaaa gtattattta tatgtttata aatttgaaaa tgagaacgga 2940 acatataccg ttcatgtaca gtaa 2964 <210> 4 <211> 3219 <212> DNA <213> Spindle-shaped Lysinibacillus <400> 4 atgaagaaaa aatttacatt caatcagttg ttaattgggg ttagtacaat ggccatttcg 60 ttaggtggat tacaggcgga agcatcggca gcagaaaaaa cgccgtataa tgtattacaa 120 atgaaaccca ttggcataga aatgtcgaaa gatgaaatgg tgcattcgac aatggctgaa 180 gaaacattat cctatgaaga acgtttagaa atgggagatt tttcacaacg tccagcacca 240 attatggaac agatggatac acagcaattg caggagcagt actcgatggc agagcttaat 300 aatatgagca atcgtgagct tatccatacg cttggcagta tccgttggta ccaaattaca 360 gacttattcc aattcaatga tgacacaaaa gctttttatc aaaatgaaga gcgcatgcaa 420 gtaatcatca atgaattagg gaatagagga aattcgttta cgaaggaaga ttcaaagggg 480 GAGAATTCGAAACATTTGTTCGAGGTATTGCCTTCTGCTTTTTATGTAACGTTTTATAATAATGA A 540 CTAGGCTATTTAAATGAGAGAAGTTTCCAA GATAAGTGTTTACCAGCATTAAATGAAATA 600 GCCAAAAATCCAAGCTTTAAACTTGGTACAGATGAGCAAGAT AAGTTGTATCTGCCTAT 660 GGAAAATTAATAGGTAATGCTTCTAGTGATGTGGAAACCGTTCAACATGCTACGAACATT 720 TTAAAACAATATAATGAAAACTTTCTACCTATGAAAGTGAGAATTCAAAGGACAAGCT 780 ATTTACGATA TAATACAGGCATTGATTATGATTTGCAGTCTTATTTATATGACACTCGT 840 AAAGAGGCCAATACAACGATGTGGTATGGGAAGATTGATAGCTTCA TAGAGGAAGTTAAT 900 AACATTGCCCTAATACATATGTGACGGATAGCAATAGTTGGTAA TTAATATGGCATT 960 TATTATGCAGGGC GTTTAGGGCAGTTCCATAGCAATCCTAATAAGGTTTAGAAGTCGTT 1020 ACACAAGCGATG CATATGTATCCCTATTT AAGTGAAGCTTATTTTTGTGGCAGTAGAGCAA 1080 ATTACGACAATTATGGTGGACGTGACTTAAACGGAAATACG GTTGATTTACAAAAGTA 1140 CGTGAAGAAGGAAAAAAACAGTATCTACCGAAAACATATACATTTGATGATGGATCAATT 1200 gtattcaaaa cgggagatca agtaacggaa gataaaattc aaagattata ctgggctgca 1260 aaagaggtaa aggcacaata tcatcgtgta atcgggaatg atcaagcact agagcctggt 1320 aatgctgacg atatcttaac cgttgtcatt tataactctc ccgatcagta ccgattaaac 1380 cgacaattgt acggatatga aacaaataat ggtggtattt atattgaaga gactggaaca 1440 ttctttacat atgaacgtac acctgagcaa agtatttata gcttagaaga gctgttccgt 1500 catgaatata cgcacttttt acaaggtaga tttgaggtgc ctggtctatt cgggacgggt 1560 gatatgtatc aaaatgagcg actaacatgg ttccaggaag ggaatgcaga attttttgca 1620 gggtcaacac gtacaaatga cgttgtgcct cgtaagagca ttattagtgg attgtcacag 1680 gatccatcac aacgctatac tgctgaacaa acaatgtttg ccacatatgg ttcctgggat 1740 ttttataatt attcatttgc attacagtct tatatgtata cgcatcaatt cgatatgttt 1800 gatagaattc aagatttaat ccgcgcgaac gatgtgaaaa attatgatgc ctatcgtgac 1860 actttaagta aagattcaca gctgaatatg gaataccaag catatatgca gcaattgatc 1920 gataaccaag aaacatacga agtaccacaa gtagcagagg attatttaat gccgcatgaa 1980 ccaaaagcgt taaacgaagt acagcaagaa attgtcgata ttgcacatgt gaaagatgca 2040 aatatgacga aacaccagtc tcaatttttt aatacgttta cactcgaggg aacatatgta 2100 ggtagtgcaa cacagggtga atctcaagat tggaaaacga tgagtaagca agtaaaccaa 2160 atgctggagc aactgtctca aaaagagtgg agcggctata aaacaatgac tgcgtacttt 2220 gtcaactatc gtgtaaatgc ggcaaaccag ttcgagtatg atgtagtctt ccatggcgtt 2280 tccactgatg acggagaaac gcaagcacca attgtacaag taaatggtcc atatactggc 2340 atgatcaatg aaaaaattca atttaatagt gatgggtcaa aggatacgga tggagaaata 2400 gtttcttatc tttgggattt tggtgatggc gcgacaagtg aagcagcaaa tcctactcat 2460 gtatacgaaa atgaaggaac ttacaaagtg acgttaaccg tgaaaaataa taagggacaa 2520 gaaagtaaag ggcaaacaac tgccactgta cagaaaggag gacagacagg gcaagaacat 2580 gcgatgatta ttccatttaa taaaccacta aaaggtagtt tgatagaaaa tgatacaaat 2640 tttctgtcgt aaatgaaaat 2700 tttctgtcgt aaatgaaaat 2700 tttctgtcgt aaatgaaaat 2700 tttctgtcgt aaatgaaaat 2700 tttctgtcgt aaatgaaaat 2700 tttctgtcgt aaatgaaaat 2700 tttctgtcgt aaatgaaaat 2700 tttctgtcgt aaatgaaaat 2700 tttctgtcgt aaatgaaaat 2700 tttctgtcgt aaatgaaaat 2700 tttctgtcgt aaatgaaaat 2700 tttctgtcgt aaatgaaaat 2700 tttctgtcgt aaatgaaaat 2700 tttctgtcgt aaatgaaaat 2700 tttctgtcgt aaatgaaaat 2700 tttctgtcgt aaatgaaaat 2700 tttctgtcgt aaatgaaaat 2700 tttctgtcgt aaatgaaaat 2700 tttctgtcgt aaatgaaaat 2700 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer <400> 6 ccgcctttaa aggctctccg a 21

Claims

1. Use of a collagenase consisting of the amino acid sequence of SEQ ID NO: 1 for manufacturing Gly-Glu-Arg.

2. The use according to claim 1, wherein, The collagenase is from Lysinibacillus fusiformis.

3. The use according to claim 1, comprising subjecting the collagenase to edible meat.

4. A method for manufacturing Gly-Glu-Arg using a collagenase consisting of the amino acid sequence of SEQ ID NO:

1.

5. The manufacturing method according to claim 4, wherein, The collagenase is from Lysinibacillus fusiformis.

6. The method for manufacturing according to claim 4, comprising subjecting the collagenase to edible meat.

Citation Information

Patent Citations

  • Novel collagenase discolysin and its preparation

    JP1993016832B2

  • New microorganism belonging to genus vibrio, new collagenase produced by the microorganism and its application

    JP1996070853A

  • Recombinant collagenase type i from Clostridium histolyticum and its use for isolation of cells and cell populations.

    JP2001510331A

  • New collagenase gene of microorganism origin

    JP2010263880A

  • Method of measuring amount of gly-x-y sequences in collagen, gelatin and collagen hydrolysate, and method of measuring amount of x-y sequences

    JP2018183106A