A high-xylanase-producing Trichoderma reesei strain and its application

Abstract

The present invention relates to the field of genetic engineering technology, and specifically provides a high-yield xylanase-producing Trichoderma reesei strain and its application. The applicant firstly isolates the strain from Penicillium decumbentum ( Penicillium reclining ) was overexpressed in a Trichoderma reesei host to construct a recombinant expression strain. This strain was then used as a starting strain for UV mutagenesis, resulting in a mutant strain that significantly increased xylanase expression. The mutant strain is deposited with CCTCC NO: M2021920. This mutant strain can be widely used in xylanase production, helping to reduce the production cost of the enzyme.

Description

Technical Field

[0001] The invention belongs to the technical field of genetic engineering, and particularly relates to a high-xylanase-producing Trichoderma reesei strain and application thereof. Technical Background

[0002] Xylan is the primary component of plant hemicellulose, accounting for approximately one-third of a plant's dry weight. Besides cellulose, it is the most abundant polysaccharide in nature and one of nature's most abundant renewable resources. The xylan backbone is composed of β-D-xylopyranose residues linked by β-1,4-glycosidic bonds, with a variety of side chain substituents. Natural xylans are found in plant cell walls and have a complex structure, with most being heterogeneous polysaccharides. Xylan degradation primarily relies on enzymatic degradation by xylanases. The complexity and diversity of xylanases indicate that xylanases are a combination of enzymes, rather than a single enzyme, that degrade xylanases. The most studied xylanases come from fungi and bacteria. Fungi only produce alkaline xylanases, while bacteria can produce both alkaline and acidic xylanases. Xylanases randomly cleave the xylan backbone, yielding degradation products such as xylooligosaccharides, xylose, and arabinose.

[0003] Xylanases are widely used in the food, feed, and papermaking sectors. Xylanases, as feed additives in animal feed, can degrade crude fiber, thereby promoting the animal's absorption of nutrients in the feed. Xylanases, in synergistic action with other enzymes in the pulp bleaching process, can reduce the addition of chemical reagents, improve bleaching quality, and mitigate environmental damage caused by the papermaking industry. Xylanases degrade agricultural waste such as straw and corn cobs into soluble pentoses, which are then used to produce products such as xylooligosaccharides and ethanol, achieving biomass resource regeneration. Xylanases can also be used as a dough improver, bread baking agent, and steamed bread improver in flour products.

[0004] Furthermore, xylanase hydrolysis products, xylo-oligosaccharides (XOS), are functional oligosaccharides. They are a mixture of xylobiose, xylotriose, xylotetrose, and xylotentaose, produced by hydrolyzing the β-1,4-glycosidic bonds of xylan using endo-xylanase. They have demonstrated significant effects in promoting the proliferation of intestinal probiotics such as Bifidobacterium, lowering serum cholesterol, regulating blood sugar, promoting intestinal calcium absorption, and alleviating constipation. The enzymatic production of XOS using xylanase is a relatively mild process with high enzyme specificity, resulting in a high purity of the XOS product. Currently, this is the most commonly used method for producing XOS. The research results of Sun Juntao et al. showed that under the conditions of ultrasonic temperature of 60 ℃, ultrasonic power of 300 W, xylanase and cellulase in a ratio of 3:2, compound enzyme addition of 1%, enzymatic hydrolysis time of 20 min, and solid-liquid ratio of 1:15 (g / mL), the content of soluble total sugar in the prepared enzymatic hydrolysate was 75.01 mg / g, the content of reducing sugar was 43.61 mg / g, and the average degree of polymerization of the product was 1.72. Tang Yanbin et al. reported that when thermophilic Talaromyces xylanase was added to the alkaline pretreatment liquid of soybean straw, the yield of oligomeric xylose could reach 24.2% under the experimental conditions of substrate concentration of 1.0%, enzyme addition of 30 U / mL, temperature of 60 ℃, and time of 240 min. The research results of Liu Guofeng et al. showed that neutral bacterial xylanase has the effect of significantly increasing the functional oligosaccharides in beer products, and when the enzymatic hydrolysis temperature is 50°C and the xylanase addition amount is 110 U / g, the yield of oligoxylose is the highest, which is 0.621 g / L.

[0005] Currently, the production cost of xylanase is generally high, which seriously limits the widespread application of xylanase in the production of xylo-oligosaccharides. Therefore, how to increase the production of xylanase is a current research focus in this field. Summary of the Invention

[0006] The present invention solves the problems of the prior art and provides a high-yield xylanase-producing Trichoderma reesei and its application. Penicillium decumbens ) was overexpressed in a Trichoderma reesei host to construct a recombinant expression strain. This strain was then used as a starting strain for UV mutagenesis, resulting in a mutant strain that significantly increased xylanase expression. This mutant strain can be widely used in xylanase production, helping to reduce the production cost of the enzyme.

[0007] On one hand, the present invention provides an engineered strain of Trichoderma reesei carrying an expression vector for recombinantly expressing a xylanase gene.

[0008] The amino acid sequence of the xylanase is SEQ ID NO: 1, and the encoding nucleotide sequence is SEQ ID NO: 2.

[0009] On one hand, the present invention provides a mutant strain of Trichoderma reesei, which is obtained by ultraviolet mutagenesis using the above-mentioned engineered Trichoderma reesei as a starting strain.

[0010] The mutant strain was named Trichoderma reesei MQ20 ​​and was deposited in the China Type Culture Collection of Wuhan University, Wuhan, China on July 21, 2021, with the deposit number CCTCC NO: M2021920.

[0011] The present invention also provides the use of the mutant strain of Trichoderma reesei in the production of xylanase.

[0012] The present invention will be derived from Penicillium decumbentum ( Penicillium decumbens ) of the xylanase gene in Trichoderma reesei ( Trichoderma reesei ) host, and the recombinant expression strain Trichoderma reesei MQ1 was constructed. After 160h of fermentation in a 30L tank, the xylanase activity reached 7610u / ml.

[0013] Using Trichoderma reesei MQ1 as the starting strain, a mutant strain, Trichoderma reesei MQ20, was obtained through ultraviolet mutagenesis. After 160 hours of fermentation in a 30L tank, the xylanase activity reached 16,429 u / ml, a 116% increase compared to the starting strain, achieving unexpected technical results. This mutant strain can be widely used in the production of xylanase, thereby reducing the production cost of xylanase and promoting its widespread application in the production of xylo-oligosaccharides. BRIEF DESCRIPTION OF THE DRAWINGS

[0014] Figure 1 is the map of plasmid pTG;

[0015] Figure 2 This is the fermentation curve of 30L tank. DETAILED DESCRIPTION

[0016] The present invention has used the conventional techniques and methods that genetic engineering and molecular biology field use, for example the method of putting down in writing in MOLECULAR CLONING:A LABORATORY MANUAL, 3rd Ed. (Sambrook, 2001) and CURRENTPROTOCOLS IN MOLECULAR BIOLOGY (Ausubel, 2003).These general references provide definition and method well known to those skilled in the art.But those skilled in the art can, on the basis of the technical scheme put down in writing in the present invention, adopt other conventional methods, experimental scheme and reagent of this area, and are not limited to the limitation of specific embodiments of the present invention.

[0017] The present invention is described in detail below with reference to specific embodiments.

[0018] Example 1 Cloning of xylanase gene and construction of recombinant vector

[0019] The applicant will be derived from Penicillium decumbentum ( Penicillium decumbens The xylanase gene from Trichoderma reesei was codon-optimized based on the codon preference of Trichoderma reesei. Six bases of TCTAGA (an Xba I restriction site) were added before the first amino acid codon and after the stop codon TAA. The optimized nucleotide sequence was synthesized by Shanghai Jierui Bioengineering Co., Ltd. The amino acid sequence of the xylanase is shown in SEQ ID NO: 1, and the encoding nucleotide sequence is shown in SEQ ID NO: 2.

[0020] PCR amplified the above xylanase gene. The primer sequences are as follows:

[0021] Primer 1 (F): GC TCTAGA ATGGTTCATCTGTCTGCCACC;

[0022] Primer 2 (R): GC TCTAGA TTACAAGCACTGAGAGTACCA.

[0023] The PCR reaction conditions were: denaturation at 94°C for 5 minutes, followed by 30 cycles of denaturation at 94°C for 30 seconds, annealing at 56°C for 30 seconds, and extension at 72°C for 70 seconds, followed by incubation at 72°C for 10 minutes. Agarose gel electrophoresis showed that the xylanase gene was a 1233-bp fragment.

[0024] The xylanase gene fragment obtained above and the expression vector pTG were digested with restriction endonuclease XbaI, respectively. The digestion conditions were as follows:

[0025] PCR fragment digestion system (50ul) Plasmid pTG enzyme digestion system (50ul) PCR fragment 20ul pTG plasmid 20ul 10*M 5ul 10*M 5ul BSA 5ul BSA 5ul XbaI 2ul XbaI 2ul <![CDATA[ddH2O 18ul]]> <![CDATA[ddH2O 18ul]]>

[0026] Digest the fragments in a 37°C water bath for 2 hours. After electrophoresis, recover the two target fragments and dissolve them in 20 μl of ddH2O. Ligate the fragments using T4 DNA ligase. The ligation system is as follows:

[0027] PCR fragment 2ul pTG 2ul 10*Buffer 1ul T4 DNA ligase 1ul <![CDATA[ddH2O]]> 4ul Total volume 10ul

[0028] Ligate at 22°C for 1 hour, transform competent E. coli DH5a cells, plate on LB+AMP plates, and grow single colonies at 37°C overnight. Verify correct ligation by colony PCR, extract the plasmid, and send it for sequencing. Once sequencing is correct, the recombinant vector pTG-MQ containing the xylanase gene is obtained.

[0029] Example 2 Construction of recombinant xylanase expression strain

[0030] 1. Protoplast preparation:

[0031] Inoculate the host strain, Trichoderma reesei 4Q, onto PDA+U (200 g / L potato, boiled for 20-30 minutes, filtered, and decanted; 2% glucose; 1% uridine; 1.5% agar powder) plates and incubate at 30°C for 5-7 days. A 2 cm × 2 cm piece of bacterial growth was excised and inoculated into 100 ml of liquid PDA+U (200 g / L potato, boiled for 20-30 minutes, filtered, and decanted; 2% glucose; 1% uridine) medium and incubated at 30°C for 16 hours to grow mycelium for transformation. The grown mycelium was filtered and resuspended in 20 ml of 1.2 M magnesium sulfate solution. 0.2 g of lysozyme was added and incubated at 30°C and 100 rpm for 2-3 hours. The lysed mycelium was filtered through two layers of lens paper and centrifuged at 3000 rpm for 10 minutes to obtain protoplasts. The lysed mycelium was filtered through lens paper and centrifuged to obtain protoplasts. The protoplasts were then resuspended in an appropriate amount of sorbitol solution.

[0032] 2. Conversion:

[0033] The protoplasts of Trichoderma reesei 4Q obtained above were washed twice with 1.2M sorbitol solution and then resuspended with an appropriate amount of sorbitol solution to make the protoplast concentration reach 10 8 / ml; add 10ul of the prepared recombinant vector pTG-MQ and 50ul of 25% PEG6000 to each 200ul of protoplasts, incubate on ice for 20 minutes, then add 2ml of 25% PEG6000 and let it stand at room temperature for 5 minutes; add 4ml of sorbitol solution and mix by inversion, pour into 50ml of transformation upper layer medium, and then pour into 4 transformation lower layer plates. After the upper layer medium solidifies, incubate inverted in a 30℃ incubator for 5 days.

[0034] 3. Transformant screening:

[0035] After 5 days of culture, selected colonies were spotted onto the transformation lower plate for rescreening and incubated at 30°C for 3 days. Normally growing transformants were inoculated onto fresh PDA plates and incubated at 30°C for 5-7 days. A 2 cm x 2 cm colony was removed from each transformant and inoculated into 50 ml of liquid shake flask medium (1% glucose; 2% lactose; 1.5% corn steep liquor; 0.9% ammonium sulfate; 0.15% magnesium sulfate; 0.073% citric acid; 0.1125% calcium chloride; 0.1% trace elements) for fermentation at 28°C for 5 days. After 5 days of culture, the supernatant was centrifuged to obtain the crude enzyme solution for protein electrophoresis analysis and xylanase activity assay.

[0036] (1) Definition of xylanase activity unit

[0037] Under the conditions of 37°C and pH 5.5, the amount of enzyme required to release 1 μmol of reducing sugar from a 5 mg / ml xylan solution per minute is one enzyme activity unit (U).

[0038] (2) Determination method

[0039] Take 2 ml of 1% xylan substrate (prepared in pH 5.5 acetic acid-sodium acetate buffer) and add it to a colorimetric tube. Equilibrate at 37°C for 10 minutes. Then add 2 ml of acid xylanase solution appropriately diluted with pH 5.5 acetic acid-sodium acetate buffer and equilibrated at 37°C. Mix well and react at 37°C for 30 minutes. After the reaction is completed, add 5 ml of DNS reagent and mix well to terminate the reaction. Then boil in a boiling water bath for 5 minutes, cool to room temperature with tap water, add distilled water to 25 ml, mix well, and measure the absorbance at 540 nm using a standard blank as a blank control. A E .

[0040] Enzyme activity calculation formula:

[0041] X D = .

[0042] Where: X D is the activity of xylanase in the diluted enzyme solution, U / ml; A E is the absorbance of the enzyme reaction solution; A B is the absorbance of the enzyme blank solution; K is the slope of the standard curve; C0 is the intercept of the standard curve; M is the molar mass of xylose, 150.2 g / mol; t is the enzymatic reaction time, min; N is the enzyme solution dilution multiple; 1000 is the conversion factor, 1 mmol=1000 μmol.

[0043] The test results showed that the xylanase activity in the fermentation supernatant of the positive transformant constructed above was as high as 356 U / ml. The applicant named the positive transformant with the highest fermentation enzyme activity Trichoderma reesei MQ1 ( Trichoderma reesei MQ1).

[0044] Example 3 Mutagenesis Screening

[0045] Mutations induced by UV mutagenesis are highly random, and the resulting effects are also random and difficult to predict. Therefore, to obtain effective positive mutations, technicians typically need to perform multiple rounds of UV mutagenesis, which is labor-intensive and can result in failure to obtain effective positive mutations. However, UV mutagenesis remains a commonly used mutagenesis breeding method because it requires simple equipment, is inexpensive, and can produce a large number of mutants in a short period of time.

[0046] The applicant used Trichoderma reesei MQ1 as the starting strain and genetically modified it through ultraviolet mutagenesis to further improve its xylanase production.

[0047] 1. Determine the fatality rate:

[0048] Inoculate the starting strain of Trichoderma reesei MQ1 onto a PDA plate and culture at 30°C for 5-7 days. When a large number of spores form on the surface of the colony, aspirate 5 ml of sterile water to elute the spores. After centrifugation, resuspend the spores in sterile water and count them using a hemocytometer. Take a 90 mm culture dish and add 5 ml of the diluted spore suspension (concentration of 1 × 10 7 The spore solution was homogenized using a rotor and stirred on a magnetic stirrer. In a sterile laminar flow hood, 9W UV light was used to irradiate the sample from a vertical distance of 20 cm for 30, 45, 60, 75, 90, 105, and 120 seconds. The irradiated spore solution was diluted 10-, 100-, and 1000-fold, and 100 μl of the solution was spread on a PDA plate. The spores were incubated at 30°C for 2-3 days and then counted. The lethality was calculated using unirradiated spore solution as a control. The lethality was 95% after 90 seconds of irradiation, and this irradiation time was selected for subsequent mutagenesis experiments.

[0049] 2. The first round of mutagenesis screening:

[0050] Take a 90mm culture dish and add 5ml of diluted spore suspension (concentration of 1×10 7 spores / ml), add a rotor, and stir on a magnetic stirrer to homogenize the spore solution. In a sterile laminar flow hood, irradiate the solution with a 9W UV lamp at a vertical distance of 20 cm. Irradiate for 90 seconds, then dilute 1000-fold. Apply 100 μl of the solution to a PDA plate and incubate at 30°C for 2-3 days.

[0051] A total of 300 PDA plates were coated and cultured at 30°C for 2-3 days, with 30-50 colonies growing on each plate. First, the mutants with short branches were screened out based on colony morphology. A total of 89 mutants with smaller colony morphology, dense hyphae, and shorter villi around the colonies were selected and inoculated onto PDA plates respectively, and cultured at 30°C for 5-7 days. A 2cm×2cm bacterial block was cut from each transformant and inoculated into 50ml of liquid shake flask culture medium for fermentation, and cultured at 28°C for 5 days. After culturing for 5 days, the bacteria were centrifuged to obtain the supernatant, which was then subjected to protein electrophoresis and xylanase activity tests, respectively. The starting strain MQ1 was used as a control group.

[0052] The results showed that among the 89 mutant strains obtained in the first round of UV mutagenesis screening, none of the mutant strains had higher xylanase activity in the fermentation supernatant than that of the starting bacteria; among them, the enzyme activity of 85 mutant strains was basically equivalent to that of the starting bacteria, and the enzyme activity of the remaining 4 mutant strains was even lower than that of the starting bacteria.

[0053] The applicant continued to conduct 26 rounds of mutagenesis screening according to the above method, and finally obtained a mutant strain with a significantly higher xylanase production than the starting strain, which was named Trichoderma reesei MQ20 ​​( Trichoderma reesei The xylanase activity of the mutant strain in the shake flask fermentation supernatant reached 697 U / ml, which was 96% higher than that of the starting strain, achieving unexpected technical results.

[0054] Example 4 30L tank fermentation scale-up

[0055] The starting strain, Trichoderma reesei MQ1, and the mutant strain, Trichoderma reesei MQ20, were fermented in separate 30-liter fermenters using a medium containing: 10 g / L glucose, 20 g / L lactose, 9 g / L ammonium sulfate, 1.125 g / L calcium chloride, 1.5 g / L magnesium sulfate, 0.73 g / L citric acid, 20 g / L potassium dihydrogen phosphate, 4 g / L diammonium hydrogen phosphate, 15 ml / L corn steep liquor, and 0.05% defoamer. The feed medium contained 400 g / L of liquid sugar and the pH was adjusted to between 4.0 and 5.0.

[0056] Fermentation production process: pH 4.0, temperature 30°C, stirring rate 300-700rpm, ventilation volume 1.0-1.5 (v / v), dissolved oxygen controlled above 20%.

[0057] The entire fermentation process is divided into three stages: the first is the bacterial culture stage, in which seeds are inoculated at a 7% ratio and cultured at 30°C for 15-25 hours, marked by the recovery of dissolved oxygen. The second stage is the starvation stage. After the basal sugar is consumed, no carbon source is added, and this stage ends when the dissolved oxygen rises above 60%, lasting approximately 30-120 minutes. The third stage is the enzyme production stage, in which feed medium is added to maintain the dissolved oxygen level above 20% and the reducing sugar concentration in the fermentation broth at no less than 1g / L. The fermentation cycle lasts between 140-170 hours. After fermentation, the fermentation broth is filtered through a plate and frame filter to obtain a crude enzyme solution.

[0058] By measuring the enzyme activity of xylanase in the fermentation broth at different times, the fermentation process curve can be obtained ( Figure 2 ).

[0059] The results showed that after 160 hours of fermentation, the enzyme activity of xylanase in the fermentation supernatant of the starting strain Trichoderma reesei MQ1 reached 7610 u / ml, while the enzyme activity of the mutant strain Trichoderma reesei MQ20 ​​reached 16429 u / ml, which was 116% higher than that of the starting strain, achieving unexpected technical results.

[0060] On July 21, 2021, the applicant has introduced the mutant bacteria Trichoderma reesei MQ20 ​​( Trichoderma reesei MQ20) was deposited in the China Center for Type Culture Collection, Wuhan University, Wuhan, China, with the accession number CCTCC NO: M2021920.

[0061] Example 5 Application of xylanase in the production of xylo-oligosaccharides

[0062] Corncob cooking liquor was used as the reaction substrate, and the fermentation supernatant of Trichoderma reesei MQ20 ​​was added for enzymatic hydrolysis. The content of xylooligosaccharides in the hydrolysis product was detected by HPLC to evaluate the effect of xylanase application.

[0063] Take five test tubes and add 10 ml of corncob cooking liquid to each tube. Add the amount calculated based on the xylanase activity to achieve final xylanase activities of 0, 5, 10, 20, and 30 U, respectively. Mix thoroughly and incubate in a 55°C water bath for 8 hours. Boil to inactivate the enzyme, then perform HPLC analysis.

[0064] Instrument: Waters 2695;

[0065] Detector: differential detector;

[0066] Chromatographic column: calcium-based column;

[0067] Column temperature: 90°C;

[0068] Mobile phase: water;

[0069] Flow rate: 0.3ml / min.

[0070] Calculate the peak areas of monosaccharides and xylobiose-xyloheptaose separately, then sum them to calculate the peak area of ​​total sugars. The content of each sugar is equal to the peak area of ​​that sugar divided by the peak area of ​​total sugars. The results are shown in the table below.

[0071] serial number 1 2 3 4 5 Amount of enzyme added (U / ml) 0 0.5 1 2 3 Monosaccharide content (%) 43.99 34.04 21.62 20.12 20.60 Xylobiose content (%) 13.10 16.20 20.21 25.34 33.41 Xylobiose-xylotetrose content (%) 46.34 57.17 52.94 60.16 66.01 Xylobiose-xyloheptaose content (%) 46.34 57.17 78.38 79.88 79.40

[0072] The data in the table show that addition of the fermentation supernatant of Trichoderma reesei MQ20 ​​described herein increased the xylobiose content by 23.7%-155.0%, while the total xylobiose-xylotetrose content and the total xylobiose-xylotheptaose content increased by 23.4%-42.4% and 23.4%-71.3%, respectively. This demonstrates that the xylanase produced by fermentation of the mutant Trichoderma reesei MQ20 ​​provided herein can be widely applied to the production of xylooligosaccharides, achieving significant results. Sequence Listing <110> Weifang Kangdien Biotechnology Co., Ltd. Qingdao Weilan Kangcheng Biotechnology Co., Ltd. Qingdao Weilan Biotechnology Group Co., Ltd. <120> A high-xylanase-producing Trichoderma reesei strain and its application <160> 2 <170> SIPOSequenceListing 1.0 <210> 1 <211> 410 <212> PRT <213> Penicillium decumbens <400> 1 Met Val His Leu Ser Ala Thr Ser Leu Leu Leu Ala Ala Gly Ile Leu 1 5 10 15 Pro Asn Leu Ala Leu Gly Ala Gly Leu Asn Asp Ala Ala Lys Ala Ile 20 25 30 Gly Gln Val Tyr Phe Gly Ser Ala Thr Asp Asn Pro Glu Leu Ser Asp 35 40 45 Ser Ala Tyr Val Lys Gln Leu Ser Asn Thr Ala Asp Phe Gly Gln Ile 50 55 60 Thr Pro Gly Asn Ser Gln Lys Trp Asp Ala Thr Glu Pro Ser Arg Asn 65 70 75 80 Val Phe Thr Phe Ser Gly Gly Asp Thr Val Ala Lys Leu Ala Gln Ser 85 90 95 Asn Gly Gln Lys Leu Arg Cys His Asn Leu Val Trp His Ser Gln Leu 100 105 110 Pro Ser Trp Val Thr Asn Gly Asn Phe Asn Asn Ala Thr Leu Ile Ser 115 120 125 Ile Met Lys Asn His Ile Thr Asn Leu Val Gln His Tyr Lys Gly Gln 130 135 140 Cys Tyr Ala Trp Asp Val Val Asn Glu Ala Leu Asn Glu Asp Gly Ser 145 150 155 160 Tyr Arg Gln Ser Val Trp Tyr Asn Thr Ile Gly Pro Ala Tyr Leu Pro 165 170 175 Ile Ala Phe Ala Thr Ala Ala Ser Val Asp Pro Thr Val Lys Leu Tyr 180 185 190 Tyr Asn Asp Tyr Asn Ile Glu Tyr Ser Gly Ala Lys Ala Ala Gly Ala 195 200 205 Arg Arg Ile Val Glu Leu Val Gln Ser Tyr Gly Ala Lys Ile Asp Gly 210 215 220 Val Gly Leu Gln Ala His Phe Ile Val Gly Ser Thr Pro Ser Lys Asp 225 230 235 240 Asp Gln Lys Lys Val Met Ala Gly Tyr Thr Ala Tyr Gly Val Glu Val 245 250 255 Ala Ile Thr Glu Leu Asp Ile Arg Met Asn Leu Pro Ser Thr Asn Ala 260 265 270 Gln Leu Thr Gln Gln Ala Thr Asp Tyr Ser Asn Thr Val Ser Ala Cys 275 280 285 Val Glu Thr Lys Asn Cys Val Gly Ile Thr Ile Trp Asp Trp Thr Asp 290 295 300 Lys Tyr Ser Trp Val Pro Ser Thr Phe Ser Gly Gln Gly Ala Ala Cys 305 310 315 320 Pro Trp Asp Ser Asn Phe Gln Lys Lys Pro Ala Tyr Asn Ala Ile Leu 325 330 335 Asn Ala Leu Asn Ala Gly Ser Ser Thr Gly Gly Gly Ser Pro Thr Thr 340 345 350 Thr Thr Thr Thr Thr Ala Ala Ala Thr Thr Thr Thr Ala Pro Gly Gly 355 360 365 Ser Gly Ser Thr Gly Gly Met Ala Gln His Trp Gly Gln Cys Gly Gly 370 375 380 Asn Gly Trp Thr Gly Pro Thr Thr Cys Ala Ser Pro Tyr Thr Cys Gln 385 390 395 400 Ala Ser Asn Pro Trp Tyr Ser Gln Cys Leu 405 410 <210> 2 <211> 1233 <212> DNA <213> Penicillium decumbens <400> 2 atggttcatc tgtctgccac ctccctgctt ttggcagcgg gaatcttgcc caatcttgcc 60 ctcggtgccg gattgaacga cgctgccaaa gcaatcggac aggtctactt cggatccgct 120 accgacaatc ctgaactgag tgattctgcc tacgtcaagc agctcagcaa cacagccgat 180 tttggccaga tcacgcctgg aaactcccaa aagtgggatg ccacagagcc atcgcgaaat 240 gtcttcacct tctctggagg tgacactgtt gccaaattgg ctcagtccaa tggccaaaag 300 ctgcgatgcc acaacctggt ctggcacagc cagcttccta gctgggttac caacggcaac 360 ttcaacaatg cgacgttgat ttccatcatg aagaaccaca tcaccaacct ggtccagcac 420 tacaaagggc agtgctacgc gtgggacgtc gtgaacgagg ctctgaacga ggacggatca 480 tatcgccaga gtgtttggta taacaccatc ggcccggcct acctccccat cgcctttgcc 540 actgctgcta gtgtggaccc tactgtcaaa ctctactaca atgattacaa cattgagtac 600 tccggcgcca aggccgccgg tgcccgaaga attgtcgagc ttgttcagtc ctacggtgcc 660 aagatcgacg gagttggtct ccaggctcac ttcatcgtcg gcagcacccc cagcaaggac 720 gaccaaaaga aggtcatggc cggttacact gcctacggag ttgaggttgc catcacggaa 780 cttgacattc gtatgaactt gccctcgacc aatgcgcagc tcacccagca ggccaccgac 840 tacacaaca ccgtcagcgc ctgtgttgag accaagaact gcgtcggtat taccatctgg 900 gactggactg acaagtctc ctgggttcca agcactttct ctggacaagg cgcggcctgc 960 ccctgggact ccaacttcca gaaagcct gcctacaacg ctattctgaa cgccctgaac 1020 gctggcagca gcaccggcgg tggctcaccc actaccacca ccaccaccac tgccgccgcg 1080 acgaccacca ctgccccccgg tggaagcgga tctactggtg gcatggctca gcactgggga 1140 cagtgcggtg gtaacggctg gactggccct actacctgcg ccagccccta cacttgccag 1200 gcctccaacc cctggtactc tcagtgcttg taa 1233

Claims

1. A mutant of Trichoderma reesei, characterized in that The deposit number of the Trichoderma reesei mutant is CCTCC NO: M2021920.

2. Use of the Trichoderma reesei mutant according to claim 1 in producing xylanase.

Images