A recombinant yeast strain for producing D-limonene and its construction method

By constructing a recombinant yeast strain, knocking out the citrate synthase and glutamate dehydrogenase genes, increasing the copy number of limonene synthase and localizing it to the mitochondria, the problem of low yield in D-limonene production was solved, and efficient limonene synthesis was achieved, reaching a yield of 1392 mg/L.

CN115710557BActive Publication Date: 2025-10-31JIANGNAN UNIV +1
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202210820746.1
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2022-07-13
Publication Date
2025-10-31
Estimated Expiration
2042-07-13

AI Technical Summary

Technical Problem

Existing industrial production methods for D-limonene suffer from problems such as complex separation and purification, low yield, and high energy consumption. Chemical synthesis methods are hampered by complex equipment, low raw material utilization, and severe environmental pollution. Microbial heterologous synthesis of D-limonene has not yet met the requirements for industrial application.

Method used

A recombinant yeast strain was constructed, and by knocking out the citrate synthase gene CIT2 and the glutamate dehydrogenase gene GDH1 and increasing the copy number of limonene synthase tLimS, the enzymes of the limonene synthesis pathway were expressed using the inducible promoter GAL10. This allowed the enzymes to be localized to the mitochondria, achieving dual regulation to increase yield.

Benefits of technology

The efficient synthesis of D-limonene was achieved in Saccharomyces cerevisiae, increasing the yield from 657 mg/L to 1248 mg/L during shake-flask fermentation, and further achieving a yield of 1392 mg/L through mitochondrial localization enzymes. It has good growth rate and application and promotion value.

✦ Generated by Eureka AI based on patent content.
Patent Text Reader

Abstract

This invention discloses a recombinant yeast strain for producing D-limonene and its construction method. Based on the previously constructed strain MKL8, this invention further optimizes the levels of precursor acetyl-CoA and NADPH cofactors, creating better conditions for intracellular limonene synthesis, and increases the intracellular limonene synthase copy number from 2 to 8. The yield during shake-flask fermentation increased from 657 mg / L to 1248 mg / L, a 1.90-fold increase. Furthermore, compartmentalization engineering was used to localize the entire limonene synthesis pathway enzymes to the mitochondria, achieving simultaneous and efficient limonene synthesis within the mitochondria by the recombinant Saccharomyces cerevisiae strain. The combined use of cytoplasmic and mitochondrial dual regulation further increased the limonene yield to 1392 mg / L, ultimately achieving highly efficient limonene synthesis in Saccharomyces cerevisiae. The recombinant yeast strain exhibits a better growth rate than the original strain and has significant application and promotion value.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to a recombinant yeast strain for producing D-limonene and its construction method, belonging to the field of metabolic engineering technology. Background Technology

[0002] Terpenes, also known as isoprene-like compounds, are compounds composed of isoprene units and their derivatives, and are secondary metabolites of plants. Limonene belongs to the monocyclic monoterpenoid class of compounds and is a naturally occurring bioactive compound derived from plants, with the chemical formula C6H2O. 10 H 16 Limonene is volatile but relatively stable. The limonene molecule contains only one chiral carbon atom, resulting in two optical isomers: D-limonene and L-limonene, as well as a racemic D / L-limonene. Currently, D-limonene is more widely found in nature and has the most applications. In the food industry, D-limonene possesses preservative, antibacterial, and antioxidant properties. In the pharmaceutical industry, it can be used to prepare drugs with antitumor, expectorant, antiasthmatic, choleretic, and litholytic functions. In the fragrance and personal care industries, D-limonene can be used to make essential oils and mild detergents. In agriculture, D-limonene can be used to prepare natural pesticides and has the advantage of being easily biodegradable.

[0003] Currently, the industrial production of D-limonene mainly involves extraction from plant peels or pulps. However, extraction methods suffer from drawbacks such as complex separation and purification processes, low yields, and high energy consumption, limiting large-scale D-limonene extraction due to limitations in raw materials and processes. While limonene can also be synthesized chemically, chemical synthesis requires high temperatures, high pressures, and expensive catalysts, and involves complex equipment, low raw material utilization, and severe environmental pollution. The rise of synthetic biology at the beginning of this century has brought new concepts and tools for the heterologous synthesis of natural active compounds by microorganisms, breaking down species barriers and making the heterologous synthesis of D-limonene a reality. Constructing targeted and efficient microbial cell factories for the heterologous synthesis of D-limonene, and replacing traditional plant extraction and chemical synthesis methods with microbial fermentation, has significant economic and social benefits. Currently, metabolic engineering applied to limonene production mainly uses Saccharomyces cerevisiae and Escherichia coli as chassis cells. Saccharomyces cerevisiae, as a highly promising cell factory, is widely used in the synthesis of various biofuels, chemical products, and pharmaceuticals. It is also widely used in the production of terpenoids.

[0004] Si Cheng et al. achieved a limonene yield of 917.7 mg / L through fed-batch fermentation by engineering the glucose-sensing promoter HXT1 of the competitive gene ERG20 and introducing an OLB pathway composed of plant NPPS and plant LS utilizing substrate NPP. Hu Zhihui et al. achieved a limonene yield of 62.31 mg / L through continuous fermentation by overexpressing or co-overexpressing key MVA genes, optimizing key enzyme promoters, combining random point mutations of key enzymes, and expressing related transport proteins to increase tolerance. Xue Zhang et al. simplified the MVA pathway by designing a PDH bypass, weakened the competitive bypass, and increased cytoplasmic acetyl-CoA content, achieving a limonene yield of 1446.56 mg / L in shake-flask fed-batch fermentation after 120 h, and a yield of 2230 mg / L in on-board fed-batch fermentation, representing the highest yield reported domestically and internationally to date. Regarding synthetic biology techniques and methods, current domestic and international technologies cannot meet the requirements for industrial-scale limonene production. The applicant previously constructed a recombinant brewer's yeast engineered strain MKL8, which has achieved a D-limonene concentration of 657 mg / L through shake-flask fermentation. However, there is still considerable room for improvement in the ability of this strain to produce D-limonene. Summary of the Invention

[0005] To address the aforementioned technical problems, this invention provides a recombinant yeast strain for producing D-limonene, which comprehensively utilizes both cytoplasmic and mitochondrial regulation to further enhance limonene production.

[0006] The first objective of this invention is to provide a recombinant yeast strain that produces D-limonene, wherein the strain uses Saccharomyces cerevisiae MKL8 as a host, the citrate synthase gene CIT2 and the glutamate dehydrogenase (NADP(+)) gene GDH1 are knocked out, and the copy number of limonene synthase tLimS is increased.

[0007] Furthermore, the amino acid sequence of the limonene synthase tLimS is shown in SEQ ID NO.1.

[0008] The sequence shown in SEQ ID NO.1:

[0009] .

[0010] Furthermore, the limonene synthase tLimS gene is expressed via the inducible promoter GAL10.

[0011] Furthermore, the expression sites of the limonene synthase tLimS are at least two of the following sites in the Saccharomyces cerevisiae genome: site 1021b, site 208a, site 308a, site 720a, site YPRCδ15c, and site 1014a.

[0012] Furthermore, the copy number of the limonene synthase tLimS is increased from 2 to 6.

[0013] Furthermore, the NCBI number of the citrate synthase gene is NP 009931.1, the NCBI number of the glutamate dehydrogenase (NADP(+)) gene is NP_015020.3, and the NCBI number of the limonene synthase gene is AAC37366.1. Here, the limonene synthase gene is an untruncation sequence.

[0014] Furthermore, the recombinant yeast strain also includes the localization of limonene synthesis pathway enzymes to mitochondria for expression.

[0015] Furthermore, the enzymes in the limonene synthesis pathway include the mevalonate pyrophosphate decarboxylase gene IDI, the truncated 3-hydroxy-3-methylglutaryl-CoA reductase gene tHMG1, the acetyl-CoA thiolase gene ERG10, the β-hydroxy-β-methylglutaryl-CoA synthase gene ERG13, the mevalonate kinase gene ERG12, mevalonate phosphate ERG8 and mevalonate pyrophosphate decarboxylase ERG19, the farnesyl pyrophosphate synthase mutant gene ERG20ww, and the limonene synthase gene tLimS.

[0016] Furthermore, the nucleotide sequence of the truncated 3-hydroxy-3-methylglutaryl-CoA reductase gene tHMG1 is shown in SEQ ID NO.2.

[0017] The sequence shown in SEQ ID NO.2:

[0018]

[0019] Furthermore, the farnesyl pyrophosphate synthase mutant gene ERG20ww is obtained by mutating phenylalanine (Phe) at position 96 of the farnesyl pyrophosphate synthase gene ERG20 to tryptophan (Trp) and asparagine (Asn) at position 127 to tryptophan (Trp).

[0020] Furthermore, the NCBI number of the mevalonate pyrophosphate decarboxylase is NP_015208.1, the NCBI number of the 3-hydroxy-3-methylglutaryl-CoA reductase is NP_013636.1, the NCBI number of the acetyl-CoA thiolase gene is NP_015297.1, the NCBI number of β-hydroxy-β-methylglutaryl-CoA synthase is NP_013580.1, the NCBI number of mevalonate kinase is NP_013935.1, the NCBI number of mevalonate phosphate is NP_013947.1, the NCBI number of mevalonate pyrophosphate decarboxylase is NP_014441.1, and the NCBI number of limonene synthase is AAC37366.1.

[0021] A second objective of this invention is to provide the application of the recombinant yeast strain in the fermentation production of D-limonene.

[0022] The beneficial effects of this invention are:

[0023] This invention further optimizes the levels of precursor acetyl-CoA and NADPH cofactors based on the previously constructed strain MKL8, creating better conditions for intracellular limonene synthesis. Furthermore, the copy number of intracellular limonene synthase was increased from 2 to 8, and the optimal copy number was determined. Shake-flask fermentation yield increased from 657 mg / L to 1248 mg / L, a 1.90-fold increase, indicating that intracellular limonene synthesis had reached its peak. Then, compartmentalization engineering was used to localize the entire limonene synthesis pathway enzymes to the mitochondria, achieving synchronous and efficient limonene synthesis within the mitochondria of the recombinant Saccharomyces cerevisiae strain. By comprehensively utilizing dual regulation from the cytoplasm and mitochondria, the limonene yield was further increased to 1392 mg / L, ultimately achieving highly efficient limonene synthesis in Saccharomyces cerevisiae. The recombinant yeast strain exhibits a better growth rate than the original strain and has significant application and promotion value. Detailed Implementation

[0024] The present invention will be further described below with reference to specific embodiments, so that those skilled in the art can better understand and implement the present invention, but the embodiments are not intended to limit the present invention.

[0025] Materials and methods:

[0026] The construction method of Saccharomyces cerevisiae MKL8 can be found in Chinese Patent Publication No. CN114606146A.

[0027] The gas chromatography-mass spectrometry (GC-MS) detection method was as follows: Detection was performed using a Thermofisher Scientific TSQ8000 instrument equipped with an FID detector and a column (Thermo; 25m, 0.32mm, 0.25μm). The injector temperature was 180℃, the carrier gas was helium, the flow rate was 1 mL / min, and the pressure was 5.8 psi. The program started at 70℃, increased to 150℃ at a rate of 20℃ / min, held for 3 minutes, and then increased to 190℃ at a rate of 2℃ / min, held for 3 minutes.

[0028] Example 1: Knocking out the citrate synthase gene CIT2 using CRISPR-Cas9 technology

[0029] (a) Using the Saccharomyces cerevisiae S288C genome as a template, the upstream 1000bp gene fragment of gene CIT2 was amplified using primers CIT2-UF and CIT2-UR, and the downstream 1000bp gene fragment of gene CIT2 was amplified using primers CIT2-DF and CIT2-DR.

[0030] (b) Using nucleases SwaI and BelI * The pML104 plasmid was digested with enzymes to obtain a linearized plasmid fragment.

[0031] (c) Gradient annealing was performed using primers CIT2-oligo2-F and CIT2-oligo1-R. Specifically, the two primers were added to the system in a 1:1 ratio, and the PCR instrument temperature was set from 98°C to 12°C, with annealing at a rate of 0.1°C per second.

[0032] (d) The linearized fragment obtained in (b) and the annealed primers in (c) were ligated using T4 DNA ligase. Specifically, 1 μL each of the mixtures obtained in (b) and (c), 1 μL of T4 DNA ligase, 1 μL of T4 DNA ligase 10× buffer, and 6 μL of deionized water were added, and the mixture was incubated at 22°C for 3 hours. This yielded the pML104-CIT2 CRISPR-Cas9 plasmid. After ligation, the plasmid was transformed into either E. coli jM109 or DH5α competent cells. Successfully transformed bacteria were sequenced. Single colonies with correct sequencing were inoculated into 2 mL of LB medium and cultured for 16 hours. The plasmid was then extracted using a plasmid extraction kit for subsequent yeast transformation.

[0033] (e) Prepare Saccharomyces cerevisiae MKL8 competent cells and transfer the amplified CIT2 upstream and downstream 1000bp gene fragments and pML104-CIT2 plasmid into the MKL8 competent cells. After single colonies grow on the SD Ura selection solid plate, colony PCR is performed using primers YZ-CIT2U-F and YZ-CIT2D-R for verification.

[0034] (f) Inoculate the single colonies that have been verified by colony PCR in step (c) into YPD liquid medium and culture for 16 h. Then streak them onto YPD solid plates containing 5-FOA and culture at 30 °C for 3 days. After that, transfer the grown single colonies to YPD solid plates and SD Ura selection solid plates for comparison and verification. The single colonies that grow normally on YPD plates but cannot grow on SD Ura selection plates are the correct genetically engineered bacteria and are named MKL9.

[0035] Primer sequences:

[0036] CIT2-UF: cagtggcaacaggaatatcttcagg

[0037] CIT2-UR: ctaatcaagaagtactagaatggttccgttttatttggcgtttcaagggc

[0038] CIT2-DF:gcccttgaaacgccaaataaaacggaaccattctagtacttcttgattagcacgc

[0039] CIT2-DR:ctcattattaagtttcagggaacaatatcaacacatatc

[0040] CIT2-oligo2-F: CTAGCTCTAAAACagatcttttgtttagcggac

[0041] CIT2-oligo1-R:gatcgtccgctaaacaaaagatctGTTTTAGAGCTAG

[0042] YZ-CIT2U-F:ccaagaaggggaagcgcc

[0043] YZ-CIT2D-R:gctaactggcgaggttccaac.

[0044] Example 2: Knockout of Glutamate Dehydrogenase (NADP(+)) GDH1 using CRISPR-Cas9 technology

[0045] (a) Using the Saccharomyces cerevisiae S288C genome as a template, the upstream 1000bp gene fragment of gene GDH1 was amplified using primers GDH1-UF and GDH1-UR, and the downstream 1000bp gene fragment of gene GDH1 was amplified using primers GDH1-DF and GDH1-DR.

[0046] (b) Following a method similar to steps (b)(c) of Example 1, gradient annealing was performed using primers GDH1-oligo2-F and GDH1-oligo1-R, and the plasmid pML104-GDH1 CRISPR-Cas9 was constructed using a method similar to step (d) of Example 1.

[0047] (c) Prepare Saccharomyces cerevisiae MKL9 competent cells and transfer the amplified 1000bp upstream and downstream gene fragments of GDH1 and the pML104-GDH1 plasmid into MKL7 competent cells. After single colonies grow on SD Ura selection solid plates, colony PCR is performed using primers YZ-GDH1U-F and YZ-GDH1D-R for verification.

[0048] (d) Inoculate the single colonies that were correctly verified by colony PCR in step (c) into YPD liquid medium and culture for 16 h. Then streak them onto YPD solid plates containing 5-FOA and culture at 30 °C for 3 days. After that, transfer the grown single colonies to YPD solid plates and SD Ura selection solid plates for comparison and verification. The single colonies that grow normally on YPD plates but cannot grow on SD Ura selection plates are the correct genetically engineered bacteria and are named MKL10.

[0049] Primer sequences:

[0050] GDH1-UF:gtggctgatagagttaatgcggg

[0051] GDH1-UR:ctatgatcgactatgccacaaacggggcacaaaactctcaaagaatcacatgg

[0052] GDH1-DF: tgtgattctttgagagttttgtgccccgtttgtggcatagtcgatcatagc

[0053] GDH1-DR: taagaagtagcagcaaaggccgg

[0054] GDH1-oligo2-F: CTAGCTCTAAAACtggacgagcaccagcaatgt

[0055] GDH1-oligo1-R:gatcacattgctggtgctcgtccaGTTTTAGAGCTAG

[0056] YZ-GDH1U-F:ggtgatatcggtgttggtggtcg

[0057] YZ-GDH1D-R:ccagagacgtcaattctcgccc.

[0058] Example 3: Optimal increase in the copy number of limonene synthase tLims on the genome

[0059] (a) Using the Saccharomyces cerevisiae S288C genome as a template, the gene fragment PGAL10-tLimS-TCYC1 was artificially synthesized and then amplified using primers tLimS-TRP-F and tLimS-1021D-R. Using the Saccharomyces cerevisiae S288C genome as a template, the upstream 500bp gene fragment of 1021b was amplified using primers 1021b-UF and 1021b-UR, and the downstream 500bp gene fragment of the integration site 1021b was amplified using primers 1021b-UF and 1021b-DR. The loxP-TRP tag fragment was amplified using primers loxP-TRP-F and loxP-TRP-R.

[0060] (b) Prepare competent cells of *Saccharomyces cerevisiae* MKL10. Transform the amplified gene fragment PGAL10-tLimS-TCYC1,1021b (upstream and downstream of 500 bp) and the loxP-TRP tag fragment into the MKL10 competent cells. After single colonies grow on SD TRP selection plates, colony PCR verification is performed using primers YZ-tLimS-1021b-F and YZ-1021b-tLimS-R. Successfully verified colonies are sent for sequencing. Single colonies with correct sequencing are considered the correct genetically engineered bacteria and are named MKL11.

[0061] Primer sequences:

[0062] 1021b-UF:ATATTAAGATGGGGAAAGAAAGATCCTTTAACGC

[0063] 1021b-UR:attgttatccgctcacaattccacaCAGGAATGGTTTAACTGCTAAGAGACAC

[0064] 1021b-DF:TTAACGTCAAGGAGAAAAAAACTATATGGCATTATGAGTTAAGAGATAATACGCACG

[0065] 1021b-DR:TGAATCTAGTACCCTTCCCCATTCA

[0066] tLimS-1021D-R:TATTATCTCTTAACTCATAATGCCATATAGTTTTTTCCTCTGACGTTAAAGTATAGAGG

[0067] tLimS-TRP-F:gatgcggtattttctccttacgcatggccgcaaattaaagccttcg

[0068] TRP-1021U-F:TCCTCTTAGCAGTTAAACATTCCTGtgtggaattgtgagcggataacaa

[0069] TRP-tLimS-R:cgctcgaaggctttaatttgcggccatgcgtaaggagaaaataccgcatcag

[0070] YZ-tLimS-1021b-F:ccaattctgatgctctgataacatgc

[0071] YZ-1021b-tLimS-R:TCTGCGGAATTTCACCAACTGAC

[0072] (c) Using the Saccharomyces cerevisiae S288C genome as a template, the gene fragment P was artificially synthesized. GAL10 -tLimS-T CYC1 Then, primers tLimS-208aU-F and tLimS-208aD-R were used to amplify the gene fragment. Using the Saccharomyces cerevisiae S288C genome as a template, primers 208a-UF and 208a-UR were used to amplify the 1000bp gene fragment upstream of the 208a locus, and primers 208a-DF and 208a-DR were used to amplify the 1000bp gene fragment downstream of the 208a locus.

[0073] (d) Following a method similar to steps (b) and (c) of Example 1, gradient annealing was performed using primers 208a-oligo2-F and 208a-oligo1-R, and the plasmid pML104-208a CRISPR-Cas9 was constructed.

[0074] (e) Prepare competent cells of Saccharomyces cerevisiae MKL11, and transfer the amplified 1000bp gene fragment upstream and downstream of the 208a site and the pML104-208a plasmid into the competent cells. After single colonies grow on the SD Ura selection solid plate, colony PCR is performed using primers YZ-208aU-tLimS-F and YZ-tLimS-208aU-R to verify the colony.

[0075] (f) Inoculate the single colonies that have been verified by colony PCR in step (e) into YPD liquid medium and culture for 16 h. Then streak them onto YPD solid plates containing 5-FOA and culture at 30 °C for 3 days. After that, transfer the grown single colonies to YPD solid plates and SD Ura selection solid plates for comparison and verification. The single colonies that grow normally on YPD plates but cannot grow on SD Ura selection plates are the correct genetically engineered bacteria and are named MKL12.

[0076] Primer sequences:

[0077] tLimS-208aU-F:TCTGATTTTTTTTTTCAATGAGTGCAggccgcaaattaaagccttcg

[0078] tLimS-208aD-R:GATATTCAGTTTTTGTCATTGCCGTTATAGTTTTTTCCTCTGACGTTAAAGTATAGAG

[0079] 208a-UF:CTGTTACCAAATACTCCTCCTCTACTC

[0080] 208a-UR:cgctcgaaggctttaatttgcggccTGCACTCATTGAAAAAAAAATCAGAGAAAGCC

[0081] 208a-DF:TTAACGTCAAGGAGAAAAAAACTATAACGGCAATGACAAAAACTGAATATC

[0082] 208a-DR:TTACTTTACATGTTATCGGAGGCCTG

[0083] 208a-oligo2-F:CTAGCTCTAAAACagatcttttgtttagcggac

[0084] 208a-oligo1-R:gatcgtccgctaaacaaaagatctGTTTTAGAGCTAG

[0085] YZ-208aU-tLimS-F:GGTTCACTACACGAGCATTCATTG

[0086] YZ-tLimS-208aU-R:gagattggctgatgatttgggtac

[0087] (g) Using the Saccharomyces cerevisiae S288C genome as a template, the gene fragment P was artificially synthesized. GAL10 -tLimS-T CYC1 Then, primers tLimS-308aU-F and tLimS-308aD-R were used to amplify the gene fragment. Using the Saccharomyces cerevisiae S288C genome as a template, primers 308a-UF and 308a-UR were used to amplify the 1000bp gene fragment upstream of the 308a locus, and primers 308a-DF and 308a-DR were used to amplify the 1000bp gene fragment downstream of the 308a locus.

[0088] (h) Following a method similar to steps (b) and (c) of Example 1, gradient annealing was performed using primers 308a-oligo2-F and 308a-oligo1-R, and a method similar to step (d) of Example 1 was used to construct the plasmid pML104-308a CRISPR-Cas9.

[0089] (i) Prepare competent cells of Saccharomyces cerevisiae MKL12 and transfer the amplified 1000bp gene fragment upstream and downstream of the 308a site and the pML104-308a plasmid into the competent cells. After single colonies grow on the SD Ura selection solid plate, colony PCR is performed using primers YZ-308aU-tLimS-F and YZ-tLimS-308aU-R to verify the colony.

[0090] (j) Inoculate the single colonies that were correctly verified by colony PCR in step (e) into YPD liquid medium and culture for 16 h. Then streak them onto YPD solid plates containing 5-FOA and culture at 30 °C for 3 days. After that, transfer the grown single colonies to YPD solid plates and SD Ura selection solid plates for comparison and verification. The single colonies that grow normally on YPD plates but cannot grow on SD Ura selection plates are the correct genetically engineered bacteria and are named MKL13.

[0091] Primer sequences:

[0092] tLimS-308aU-F:taccatccaataccttgatgaacttttcaggccgcaaattaaagccttc

[0093] tLimS-308aD-R:ggtagcaatatgtagcaaagaagacTATAGTTTTTTCCTCTGACGTTAAAGTATAGAGG

[0094] 308a-UF:cgttgattcgtcaacttaaagatgacc

[0095] 308a-UR:aggctttaatttgcggcctgaaaagttcatcaaggtattggatggtatat

[0096] 308a-DF:TTAACGTCAAGGAGAAAAAAACTATAgtcttctttgctacatattgctaccac

[0097] 308a-DR:gattctcaccgcatgacaagt

[0098] 308a-oligo2-F:CTAGCTCTAAAACTATATTCTGTTTGACAAGTG

[0099] 308a-oligo1-R:gatcCACTTGTCAAACAGAATATAGTTTTAGAGCTAG

[0100] YZ-308aU-tLimS-F:ctacagggaatcgatgaggttgtaag

[0101] YZ-tLimS-308aU-R:gatggttctacggtggtcataagcc

[0102] (k) Using the Saccharomyces cerevisiae S288C genome as a template, the gene fragment P was artificially synthesized. GAL10 -tLimS-T CYC1 Then, primers tLimS-720aU-F and tLimS-720aD-R were used to amplify the gene fragment. Using the Saccharomyces cerevisiae S288C genome as a template, primers 720a-UF and 720a-UR were used to amplify the 1000bp gene fragment upstream of the 720a locus, and primers 720a-DF and 720a-DR were used to amplify the 1000bp gene fragment downstream of the 720a locus.

[0103] (l) Following the steps of Example 1(b)(c), gradient annealing was performed using primers 720a-oligo2-F and 720a-oligo1-R, and the plasmid pML104-720a CRISPR-Cas9 was constructed using the steps of Example 1(d).

[0104] (m) Prepare competent cells of Saccharomyces cerevisiae MKL13, and transfer the amplified 1000bp gene fragment upstream and downstream of the 720a site and the pML104-720a plasmid into the competent cells. After single colonies grow on the SD Ura selection solid plate, colony PCR is performed using primers YZ-720aU-tLimS-F and YZ-tLimS-720aU-R to verify the colony.

[0105] (n) Inoculate the single colonies that have been verified by colony PCR in step (e) into YPD liquid medium and culture for 16 h. Then streak them onto YPD solid plates containing 5-FOA and culture at 30 ℃ for 3 days. After that, transfer the grown single colonies to YPD solid plates and SD Ura selection solid plates for comparison and verification. The single colonies that grow normally on YPD plates but cannot grow on SD Ura selection plates are the correct genetically engineered bacteria and are named MKL14.

[0106] Primer sequences:

[0107] tLimS-720aU-F:GTTTGTTACTGTTGATTGTTCGTTTggccgcaaattaaagccttcg

[0108] tLimS-720aD-R:gcgagcgcagaagcgaacacttgtcTATAGTTTTTTCCTCTGACGTTAAAGTATAGAGG

[0109] 720a-UF:GTTGATGCCGTTATTATCGATGCTGAC

[0110] 720a-UR:cgctcgaaggctttaatttgcggccAAACGAACAATCAACAGTAACAAACCG

[0111] 720a-DF:TTAACGTCAAGGAGAAAAAAACTATAgacaagtgttcgcttctgcgc

[0112] 720a-DR:atctccatatgaataccaacaggttg

[0113] 720a-oligo2-F:CTAGCTCTAAAACCAACAATTGTTACAATAGTA

[0114] 720a-oligo1-R:gatcTACTATTGTAACAATTGTTGGTTTTAGAGCTAG

[0115] YZ-720aU-tLimS-F:ccaattctgatgctctgataacatgc

[0116] YZ-tLimS-720aU-R:ATTGAGGAAAGCACTGATGATCTAG

[0117] (o) Using the Saccharomyces cerevisiae S288C genome as a template, the gene fragment P was artificially synthesized. GAL10 -tLimS-T CYC1 Then, primers tLimS-YPRCδ15cU-F and tLimS-YPRCδ15cD-R were used to amplify the gene fragment. Using the Saccharomyces cerevisiae S288C genome as a template, primers YPRCδ15c-UF and YPRCδ15c-UR were used to amplify the 1000bp gene fragment upstream of the YPRCδ15c site, and primers YPRCδ15c-DF and YPRCδ15c-DR were used to amplify the 1000bp gene fragment downstream of the YPRCδ15c site.

[0118] (p) Following a similar method to steps (b) and (c) in Example 1, gradient annealing was performed using primers YPRCδ15c-oligo2-F and YPRCδ15c-oligo1-R, and a similar method to step (d) in Example 1 was used to construct the plasmid pML104-YPRCδ15cCRISPR-Cas9.

[0119] (q) Prepare competent cells of Saccharomyces cerevisiae MKL14, and transfer the amplified gene fragments upstream and downstream of the YPRCδ15c site and the pML104-YPRCδ15c plasmid into the competent cells. After single colonies grow on the SD Ura selection solid plate, colony PCR is performed using primers YZ-YPRCδ15cU-tLimS-F and YZ-tLimS-YPRCδ15cU-R to verify the colony.

[0120] (r) Inoculate the single colonies that have been verified by PCR in step (e) into YPD liquid medium and culture for 16 h. Then streak them onto YPD solid plates containing 5-FOA and culture at 30 °C for 3 days. After that, transfer the grown single colonies to YPD solid plates and SD Ura selection solid plates for comparison and verification. The single colonies that grow normally on YPD plates but cannot grow on SD Ura selection plates are the correct genetically engineered bacteria and are named MKL15.

[0121] Primer sequences:

[0122] tLimS-YPRCδ15cU-F:tttggtttcgattgttggcaaagacggccgcaaattaaagccttcg

[0123] tLimS-YPRCδ15cD-R:ggacgcgaatgcaagacagaagtccTATAGTTTTTTCCTCTGACGTTAAAGTATAGAGG

[0124] YPRCδ15c-UF:gctcgcactcaggatcgaac

[0125] YPRCδ15c-UR:cgctcgaaggctttaatttgcggccgtctttgccaacaatcgaaaccaaac

[0126] YPRCδ15c-DF:TTAACGTCAAGGAGAAAAAAACTATAggacttctgtcttgcattcgcg

[0127] YPRCδ15c-DR:cacacgtcggcacttactatcc

[0128] YPRCδ15c-oligo2-F:CTAGCTCTAAAACAATCCGAACAACAGAGCATA

[0129] YPRCδ15c-oligo1-R:gatcTATGCTTCTGTTGTTCGGATTGTTTTAGAGCTAG

[0130] YZ-YPRCδ15cU-tLimS-F:ggctttaccaacaatggaatttcgac

[0131] YZ-tLimS-YPRCδ15cU-R:gatggttctacggtggtcataagcc

[0132] (s) Using the Saccharomyces cerevisiae S288C genome as a template, the gene fragment P was artificially synthesized. GAL10 -tLimS-T CYC1 Then, primers tLimS-1014aU-F and tLimS-1014aD-R were used to amplify the gene fragment. Using the Saccharomyces cerevisiae S288C genome as a template, primers 1014a-UF and 1014a-UR were used to amplify the 1000bp gene fragment upstream of the 1014a locus, and primers 1014a-DF and 1014a-DR were used to amplify the 1000bp gene fragment downstream of the 1014a locus.

[0133] (t) Following a similar method to steps (b) and (c) in Example 1, gradient annealing was performed using primers 1014a-oligo2-F and 1014a-oligo1-R, and a similar method to step (d) in Example 1 was used to construct the plasmid pML104-1014a CRISPR-Cas9.

[0134] (u) Prepare competent cells of Saccharomyces cerevisiae MKL15, and amplify the 1000bp gene fragments upstream and downstream of the 1014a locus. GAL10 -tLimS-T CYC1 The pML104-1014a plasmid was co-transformed into MKL15 competent cells. After single colonies grew on SD Ura selection solid plates, colony PCR was performed using primers YZ-1014aU-tLimS-F and YZ-tLimS-1014aU-R to verify the colony.

[0135] (v) Inoculate the single colonies that were correctly verified by colony PCR in step (e) into YPD liquid medium and culture for 16 h. Then streak them onto YPD solid plates containing 5-FOA and culture at 30 °C for 3 days. After that, transfer the grown single colonies to YPD solid plates and SD Ura selection solid plates for comparison and verification. The single colonies that grow normally on YPD plates but cannot grow on SD Ura selection plates are the correct genetically engineered bacteria and are named MKL16.

[0136] Primer sequences:

[0137] tLimS-1014aU-F:tagcccttaacaacaatggaatacgggccgcaaattaaagccttcgag

[0138] tLimS-1014aD-R:agaagtctgtatgagttacggaagcTATAGTTTTTTCCTCTGACGTTAAAGTATAGAGG

[0139] 1014a-UF:gctctaccattgagccaccg

[0140] 1014a-UR:cgctcgaaggctttaatttgcggcccgtattccattgttgttaagggctac

[0141] 1014a-DF:TTAACGTCAAGGAGAAAAAAACTATAgcttccgtaactcatacagacttctatcg

[0142] 1014a-DR:ccagagatgactggccaacagc

[0143] 1014a-oligo2-F:CTAGCTCTAAAACttatgtgcgtattgctttca

[0144] 1014a-oligo1-R:gatctgaaagcaatacgcacataaGTTTTAGAGCTAG

[0145] YZ-1014aU-tLimS-F:gacatgaatgatgagaaatagtcatcagac

[0146] YZ-tLimS-1014aU-R:gatggttctacggtggtcataagcc.

[0147] Example 4: Verification of the mitochondrial localization of MVA pathway genes and limonene synthase genes

[0148] The 26AA subunit IV of yeast cytochrome oxidase (CoxIV) was selected as the N-terminal mitochondrial localization signal (MLS, nucleotide sequence as shown in SEQ ID NO.3: atgctttcactacgtcaatctataagatttttcaagccagccacaagaactttgtgtagctctagatatctgcttcag), which was fused to the N-terminus of the target gene. Then, green fluorescent protein eGFP was fused to the C-terminus of the target gene. Using the inducible promoter GAL10 and plasmid PY15 as the expression vector, nine different plasmids were constructed. Using plasmid PY26 as the vector, the signal peptide (MLS) sequence was fused to the N-terminus of red fluorescent protein mCherry. The constructed PY26 and PY15 plasmids were sequentially transformed into yeast cells, and the fluorescently colored regions were observed using confocal microscopy to verify the mitochondrial localization of the gene.

[0149] Example 5: Using CRISPR-Cas9 technology, the MVA pathway genes ERG10 and ERG13 were linked to the mitochondrial localization signal peptide MLS and integrated into the 1414a site of the Saccharomyces cerevisiae genome.

[0150] (a) Using the Saccharomyces cerevisiae S288C genome as a template, the gene fragment PGAL1-MLS-ERG10-TADH1-PGAL10-MLS-ERG13-TCYC1 was artificially synthesized and then amplified using primers ERG10-13-F and ERG10-13-R. Using the Saccharomyces cerevisiae S288C genome as a template, the upstream 500bp gene fragment of 1414a was amplified using primers 1414a-UF and 1414a-UR, and the downstream 500bp gene fragment of the integration site 1414a was amplified using primers 1414a-DF and 1414a-DR.

[0151] (b) Following a method similar to steps (b)(c) of Example 1, gradient annealing was performed using primers 1414a-oligo2-F and 1414a-oligo1-R, and the plasmid pML104-1414aCRISPR-Cas9 was constructed using a method similar to step (d) of Example 1.

[0152] (c) Prepare competent cells of Saccharomyces cerevisiae MKL14, and transform the amplified 500bp gene fragment upstream and downstream of the 1414a site, the gene fragment PGAL1-MLS-ERG10-TADH1-PGAL10-MLS-ERG13-TCYC1, and the pML104-1414a plasmid into the competent cells of MKL14. After single colonies grow on SD Ura selection solid plates, colony PCR is performed using primers YZ-1414a-F and YZ-1414a-R to verify the colony.

[0153] (d) Inoculate the single colonies that were correctly verified by colony PCR in step (c) into YPD liquid medium and culture for 16 h. Then streak them onto YPD solid plates containing 5-FOA and culture at 30 ℃ for 3 days. After that, transfer the grown single colonies to YPD solid plates and SD Ura selection solid plates for comparison and verification. The single colonies that grow normally on YPD plates but cannot grow on SD Ura selection plates are the correct genetically engineered bacteria and are named MKL17.

[0154] Primer sequences:

[0155] 1414a-UF: cagaatctcggcctactgagc

[0156] 1414a-UR: cgctcgaaggctttaatttgcggccgatgtgcacatgtcgttttttgagc

[0157] 1414a-DF: tctcaggtatagcatgaggtcgctccacgtttattgcttgggagtaagg

[0158] 1414a-DR:gcaaatgcgcactcggagtc

[0159] ERG10-13-R:accttactcccaagcaataaacgtggagcgacctcatgctatacctgaga

[0160] ERG10-13-F: gctcaaaaaacgacatgtgcacatcggccgcaaattaaagccttcgag

[0161] 1414a-oligo2-F:CTAGCTCTAAAACgacccttgaaactgtggcgc

[0162] 1414a-oligo1-R:gatcgcgccacagtttcaagggtcGTTTTAGAGCTAG

[0163] YZ-1414a-F:cgctaagtagattgattacccctttg

[0164] YZ-1414a-R:ctatgttggatctgacgacttacaag.

[0165] Example 6: Using CRISPR-Cas9 technology, the MVA pathway genes ERG8, ERG12, and ERG19 were linked to the mitochondrial localization signal peptide MLS and integrated into the HIS3b site of the Saccharomyces cerevisiae genome.

[0166] (a) Using the Saccharomyces cerevisiae S288C genome as a template, the gene fragment PGAL1-MLS-ERG8-TADH1-PGAL10-MLS-ERG19-TCYC1-PGAL7-MLS-ERG12-TTDH3 was artificially synthesized and then amplified using primers ERG8-12-19-F and ERG8-12-19-R. Using the Saccharomyces cerevisiae S288C genome as a template, the upstream 500bp gene fragment of HIS3b was amplified using primers HIS3b-UF and HIS3b-UR, and the downstream 500bp gene fragment of the integration site HIS3b was amplified using primers HIS3b-DF and HIS3b-DR.

[0167] (b) Following a method similar to steps (b)(c) of Example 1, gradient annealing was performed using primers HIS3b-oligo2-F and HIS3b-oligo1-R, and the plasmid pML104-HIS3bCRISPR-Cas9 was constructed using a method similar to step (d) of Example 1.

[0168] (c) Prepare competent cells of Saccharomyces cerevisiae MKL17, and transform the amplified 500bp gene fragments upstream and downstream of the HIS3b site, the gene fragment PGAL1-MLS-ERG10-TADH1-PGAL10-MLS-ERG13-TCYC1, and the pML104-HIS3b plasmid into the competent cells of MKL17. After single colonies grow on SD Ura selection solid plates, colony PCR is performed using primers YZ-HIS3b-F and YZ-HIS3b-R for verification.

[0169] (d) Inoculate the single colonies that were correctly verified by colony PCR in step (c) into YPD liquid medium and culture for 16 h. Then streak them onto YPD solid plates containing 5-FOA and culture at 30 ℃ for 3 days. After that, transfer the grown single colonies to YPD solid plates and SD Ura selection solid plates for comparison and verification. The single colonies that grow normally on YPD plates but cannot grow on SD Ura selection plates are the correct genetically engineered bacteria and are named MKL18.

[0170] Primer sequences:

[0171] ERG8-12-19-F:aagtcataacacagtcctttcccgcAAGGGAAAGATATGAGCTATACAGCG

[0172] ERG8-12-19-R:ctttgccttcgtttatcttgcctgcgagcgacctcatgctatacctgagaa

[0173] HIS3b-DF:tctcaggtatagcatgaggtcgctcgcaggcaagataaacgaaggcaaag

[0174] HIS3b-DR:gcgcgcctcgttcagaat

[0175] HIS3b-UF:ctcgacatcacaatgaagtcaaccc

[0176] HIS3b-UR:GCTGTATAGCTCATATCTTTCCCTTgcgggaaaggactgtgttatgac

[0177] HIS3b-oligo2-F:CTAGCTCTAAAACcctctagtacactctatatt

[0178] HIS3b-oligo1-R:gatcaatatagagtgtactagaggGTTTTAGAGCTAG

[0179] YZ-HIS3b-R:gaaacagacttgggtgggactg

[0180] YZ-HIS3b-U:gccatatggatccgctgcac.

[0181] Example 7: Using CRISPR-Cas9 technology, the MVA pathway gene tHMG1 and the IDI-linked mitochondrial localization signal peptide MLS were integrated into the YOLCd1b site of the Saccharomyces cerevisiae genome.

[0182] (a) Using the Saccharomyces cerevisiae S288C genome as a template, the gene fragment PGAL1-MLS-tHMG1-TADH1-PGAL10-MLS-IDI-TCYC1 was artificially synthesized and then amplified using primers tHMG1-IDI-F and tHMG1-IDI-R. Using the Saccharomyces cerevisiae S288C genome as a template, the upstream 500bp gene fragment of YOLCd1b was amplified using primers YOLCd1b-UF and YOLCd1b-UR, and the downstream 500bp gene fragment of the integration site YOLCd1b was amplified using primers YOLCd1b-DF and YOLCd1b-DR.

[0183] (b) Following a method similar to steps (b)(c) of Example 1, gradient annealing was performed using primers YOLCd1b-oligo2-F and YOLCd1b-oligo1-R, and the plasmid pML104-YOLCd1bCRISPR-Cas9 was constructed using a method similar to step (d) of Example 1.

[0184] (c) Prepare Saccharomyces cerevisiae MKL18 competent cells, and transform the amplified YOLCd1b site upstream and downstream 500bp gene fragments, gene fragment PGAL1-MLS-tHMG1-TADH1-PGAL10-MLS-IDI-TCYC1, and pML104-YOLCd1b plasmid into MKL18 competent cells. After single colonies grow on SD Ura selection solid plates, colony PCR is performed using primers YZ-YOLCd1b-F and YZ-YOLCd1b-R for verification.

[0185] (d) Inoculate the single colonies that were correctly verified by colony PCR in step (c) into YPD liquid medium and culture for 16 h. Then streak them onto YPD solid plates containing 5-FOA and culture at 30 °C for 3 days. After that, transfer the grown single colonies to YPD solid plates and SD Ura selection solid plates for comparison and verification. The single colonies that grow normally on YPD plates but cannot grow on SD Ura selection plates are the correct genetically engineered bacteria and are named MKL19.

[0186] Primer sequences:

[0187] tHMG1-IDI-F:tggaatttcgttccaacatcaataccggccgcaaattaaagccttcg

[0188] tHMG1-IDI-R:atcaggatagttacctaccgttagccgagcgacctcatgctatacctgag

[0189] YOLCd1b-DF:tctcaggtatagcatgaggtcgctcggctaacggtagtaactatcctgatg

[0190] YOLCd1b-DR:ctgtggcaattatcagcattctcatac

[0191] YOLCd1b-UD:gctcgaaggctttaatttgcggccggtattgatgttggaacgaaattccaatatc

[0192] YOLCd1b-UF:cgacaccttcaggcacttgt

[0193] YOLCd1b-oligo2-F:CTAGCTCTAAAACctagaatttccattttgcgt

[0194] YOLCd1b-oligo1-R:gatcacgcaaaatggaaattctagGTTTTAGAGCTAG

[0195] YZ-YOLCd1b-F:gggtgaattttgagagaattgttggg

[0196] YZ-YOLCd1b-R:ccgtatccatgccatccatcg.

[0197] Example 8: Using CRISPR-Cas9 technology to transduce the MVA pathway gene ERG20 ww The mitochondrial localization signaling peptide MLS, linked to tLimS, was integrated into the 106a site of the Saccharomyces cerevisiae genome.

[0198] (a) Using the Saccharomyces cerevisiae S288C genome as a template, the gene fragment PGAL1-MLS-tHMG1-TADH1-PGAL10-MLS-IDI-TCYC1 was artificially synthesized and then amplified using primers tHMG1-IDI-F and tHMG1-IDI-R. Using the Saccharomyces cerevisiae S288C genome as a template, the 500bp gene fragment upstream of 106a was amplified using primers 106a-UF and 106a-UR, and the 500bp gene fragment downstream of the integration site 106a was amplified using primers 106a-DF and 106a-DR.

[0199] (b) Following a method similar to steps (b)(c) of Example 1, gradient annealing was performed using primers 106a-oligo2-F and 106a-oligo1-R, and the plasmid pML104-106a CRISPR-Cas9 was constructed using a method similar to step (d) of Example 1.

[0200] (c) Prepare competent cells of Saccharomyces cerevisiae MKL19, and transform the amplified 500bp gene fragments upstream and downstream of the 106a site, the gene fragment PGAL1-MLS-tHMG1-TADH1-PGAL10-MLS-IDI-TCYC1, and the pML104-106a plasmid into the competent cells of MKL19. After single colonies grow on SD Ura selection solid plates, colony PCR is performed using primers YZ-106a-F and YZ-106a-R for verification.

[0201] (d) Inoculate the single colonies that were correctly verified by colony PCR in step (c) into YPD liquid medium and culture for 16 h. Then streak them onto YPD solid plates containing 5-FOA and culture at 30 °C for 3 days. After that, transfer the grown single colonies to YPD solid plates and SD Ura selection solid plates for comparison and verification. The single colonies that grow normally on YPD plates but cannot grow on SD Ura selection plates are the correct genetically engineered bacteria and are named MKL20.

[0202] Primer sequences:

[0203] 106a-DF:tctcaggtatagcatgaggtcgctcccggcagaaagattttcgctacc

[0204] 106a-DR:cagaaccagcaacaacgtttaatg

[0205] 106a-UF:cagagcatgtagtatgggactcaag

[0206] 106a-UR:cgctcgaaggctttaatttgcggccctagcattgacacacatctcaagtc

[0207] ERG20ww-tLimS-F:gacttgagatgtgtgtcaatgctagggccgcaaattaaagccttcg

[0208] ERG20ww-tLimS-R:cgggtagcgaaaatctttctgccgggagcgacctcatgctatacctg

[0209] 106a-oligo2-F:CTAGCTCTAAAACgggcgctaccctgaccgtat

[0210] 106a-oligo1-R:gatcatacggtcagggtagcgcccGTTTTAGAGCTAG

[0211] YZ-106a-F:gataggttgcagttgtctgcgg

[0212] YZ-106a-R:ggctgatgatttgggtacatctg.

[0213] Example 9: Fermentation culture of reconstructed engineered Saccharomyces cerevisiae

[0214] Single colonies of engineered *Saccharomyces cerevisiae* were picked from solid YPD plates and inoculated into 2 ml of YPD liquid medium. After incubation at 30°C and 220 rpm for 16-20 h, the culture was transferred to a 250 mL round-bottom shake flask with a baffle containing 40 mL of soybean peptone liquid medium, based on an initial OD of 0.2. 10% n-dodecane was directly applied above the fermentation broth for biphasic fermentation at 30°C and 220 rpm for 96 h. After fermentation, the organic phase was collected by centrifugation for gas chromatography-mass spectrometry (GC-MS) analysis.

[0215] Fermentation results

[0216] Samples were diluted 200-fold with n-hexane and then analyzed using a Thermo TSQ8000 triple quadrupole GC-MS system with a TG-5MS column. The limonene yields of strains MKL8, MKL9, MKL10, MKL11, MKL12, MKL13, MKL14, MKL15, MKL16, and MKL20 were 1392 mg / L.

[0217] The above-described embodiments are merely preferred embodiments provided to fully illustrate the present invention, and the scope of protection of the present invention is not limited thereto. Equivalent substitutions or modifications made by those skilled in the art based on the present invention are all within the scope of protection of the present invention. The scope of protection of the present invention is defined by the claims.

Claims

1. A recombinant yeast strain for producing D-limonene, characterized in that, The strain used Saccharomyces cerevisiae MKL8 as the host, knocked out the citrate synthase gene CIT2 and the glutamate dehydrogenase gene GDH1, and increased the copy number of limonene synthase tLimS. The copy number of limonene synthase tLimS increased from 2 to 6, and the expression sites of the increased limonene synthase tLimS were the 1021b, 208a, 308a and 720a sites of the Saccharomyces cerevisiae genome. The recombinant yeast strain further includes the fusion of the N-terminus of the limonene synthesis pathway enzyme with the mitochondrial localization signal MLS, thereby localizing the limonene synthesis pathway enzyme to mitochondria for expression. The limonene synthesis pathway enzyme includes the mevalonate pyrophosphate decarboxylase gene IDI, the truncated 3-hydroxy-3-methylglutaryl-CoA reductase gene tHMG1, the acetyl-CoA thiolase gene ERG10, the β-hydroxy-β-methylglutaryl-CoA synthase gene ERG13, the mevalonate kinase gene ERG12, mevalonate phosphate ERG8 and mevalonate pyrophosphate decarboxylase ERG19, the farnesyl pyrophosphate synthase mutant gene ERG20ww, and the limonene synthase gene tLimS.

2. The recombinant yeast strain according to claim 1, characterized in that, The amino acid sequence of the limonene synthase tLimS is shown in SEQ ID NO.

1.

3. The recombinant yeast strain according to claim 1, characterized in that, The limonene synthase tLimS gene is expressed via the inducible promoter GAL10.

4. The recombinant yeast strain according to claim 1, characterized in that, The nucleotide sequence of the truncated 3-hydroxy-3-methylglutaryl-CoA reductase gene tHMG1 is shown in SEQ ID NO.

2.

5. The recombinant yeast strain according to claim 1, characterized in that, The farnesyl pyrophosphate synthase mutant gene ERG20ww is obtained by mutating phenylalanine at position 96 of the farnesyl pyrophosphate synthase gene ERG20 to tryptophan and asparagine at position 127 to tryptophan.

6. The use of the recombinant yeast strain according to any one of claims 1 to 5 in the fermentation production of D-limonene.

Citation Information

Patent Citations

  • Recombinant strain for producing squalene as well as construction method and application of recombinant strain

    CN114015587A

  • Yeast for producing D-limonene and application thereof

    CN114606146A