crRNA primer set, kit and application for detecting pine wood nematode

Abstract

The present invention relates to a crRNA primer set, a kit and an application for detecting pine wood nematodes. The crRNA primer set includes a direct repeat sequence and an interval guide sequence; the direct repeat sequence has a Cas protein binding function; the target gene of the interval guide sequence includes an expansin gene. The crRNA primer set and the kit provided by the present invention can realize rapid and accurate screening of living pine wood nematodes by specifically detecting the expansin gene in living pine wood nematodes. The crRNA primer set and the kit of the present invention are applied to the detection of pine wood nematodes, which has the characteristics of strong specificity and high detection efficiency, and can effectively prevent the spread of living nematodes with the import, export and transportation of pine wood and other breeding materials, and have excellent prospects for promotion and use for port detection and practical applications.

Description

Technical Field

[0001] The present invention relates to the field of biological detection technology, and in particular to a crRNA primer set, a kit and an application for detecting pine wood nematodes. Background Art

[0002] Pine wilt disease (PWD) caused by pine nematode (Bursaphelenchus xylophilus) is the most devastating disease to pine forests in East Asia and Western Europe. Since it was first reported in Nanjing, Jiangsu, China in 1982, it has spread rapidly throughout China's provinces. The latest data published by the "Announcement of the State Forestry Administration (No. 6 of 2022)" shows that there are currently 19 provincial-level administrative regions in China that are pine wilt disease epidemic areas, with an area of ​​9.74 million mu affected, causing the death of more than billions of pine trees and causing direct or indirect economic losses of more than 100 billion yuan. This "cancer" on pine trees has had a serious impact on forestry production and economic development, and when pine trees are found to show more obvious symptoms of disease and prevention and control methods are taken, it is simply irreversible.

[0003] There are many identification methods for pine wood nematodes. In addition to the most traditional Baermann funnel method combined with morphological microscopic observation, various detection methods using molecular biological methods, such as the newly emerging loop-mediated isothermal amplification technology (LAMP) or recombinase polymerase amplification technology (RPA) based on constant temperature nucleic acid amplification technology, have also been successfully applied to the detection of pine wood nematodes.

[0004] The detection of pine wood nematodes by traditional molecular detection or the newly emerging loop-mediated isothermal amplification technology or recombinase polymerase amplification technology in recent years all rely on the presence of genomic DNA (this is also a common method for many disease detections, because genomic DNA can be extracted from both living and dead disease samples to meet the detection needs). However, pine wood nematodes are subject to secondary quarantine in China. Before the import and export of timber, fumigation or heat treatment is generally carried out to kill the pine wood nematodes. If genomic DNA is still used as an object for detection, false positive results are likely to occur, which will affect the progress of trade. How to achieve rapid and accurate detection of live pine wood nematodes in a relatively short period of time is of high value for forestry production and port import and export timber quarantine. Summary of the invention

[0005] In view of the problems existing in the prior art, the present invention provides a crRNA primer set, a kit and an application for detecting pine wood nematodes. The crRNA primer set provided by the present invention can specifically detect the target gene and realize the rapid detection of live pine wood nematodes in wood, thereby minimizing or preventing trade restrictions on imported and exported wood products.

[0006] The present invention provides a crRNA primer set for detecting pine wood nematodes, the primer set comprising a direct repeat sequence and a spacer guide sequence; the direct repeat sequence has a Cas protein binding function; the target gene of the spacer guide sequence comprises an expansin gene.

[0007] Preferably, the direct repeat sequence comprises SEQ ID NO:1.

[0008] Preferably, the interval guide sequence includes one or more of SEQ ID NO:2, SEQ ID NO:6, SEQ ID NO:8 and SEQ ID NO:9.

[0009] Further preferably, the interval guide sequence includes SEQ ID NO:2 and SEQ ID NO:8.

[0010] The present invention provides a kit for detecting pine wood nematodes, comprising the crRNA primer set, and also comprising LwaCas13a protein, LwaCas13a buffer, rNTP mix buffer, RNase inhibitor, DEPC water, ssRNAFQ-labeled reporter and pine wood nematode expansin ssRNA standard.

[0011] Preferably, the sequence of the ssRNA FQ-labeled reporter is 5'-6FAM-UUUUU-BHQ1-3'.

[0012] The present invention also provides the use of the crRNA primer set and the kit in detecting pine wood nematodes.

[0013] Preferably, the application comprises the following steps:

[0014] S1. Extracting RNA from the sample to be tested, and using the RNA from the sample to be tested as a template to construct a CRISPR / Cas13 reaction system for pine wood nematodes;

[0015] S2. Initiate the CRISPR / Cas13 reaction of pine wood nematodes and perform real-time fluorescence detection at a constant temperature; process and compare the fluorescence signal: if the fluorescence signal is higher than the detection threshold, pine wood nematodes are present; if the fluorescence signal is lower than the detection threshold, pine wood nematodes are absent.

[0016] Preferably, the temperature of the constant temperature real-time fluorescence detection in step S2 is 37° C.; the time for processing and comparing the fluorescence signal in step S2 is 15-20 minutes after starting the reaction.

[0017] Preferably, the application includes any one of the following:

[0018] (1) Testing of trees that show symptoms of disease but have not been confirmed to contain pine wood nematodes;

[0019] (2) Testing of samples of nematode suspension obtained by the Baermann funnel method but not confirmed to contain pine wood nematodes;

[0020] (3) Testing of trees that are confirmed to contain pine wood nematodes but not to contain living pine wood nematodes.

[0021] Beneficial effects:

[0022] The present invention provides a crRNA primer set, a kit and an application for detecting pine wood nematodes. The crRNA primer set and the kit can realize rapid and accurate screening of live pine wood nematodes by specifically detecting the expansin gene in live pine wood nematodes. The crRNA primer set and the kit of the present invention are applied to the detection of pine wood nematodes, which has the characteristics of strong specificity and high detection efficiency, and can effectively prevent the spread of live nematodes with the import, export and transportation of pine wood and other breeding materials, and has excellent prospects for promotion and use for port detection and practical application. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] In order to more clearly illustrate the technical solutions in the present invention or the prior art, the drawings required for use in the embodiments or the description of the prior art will be described below.

[0024] Figure 1 This is a curve diagram for evaluating the detection effect of each crRNA primer set of pine wood nematode by real-time fluorescence method in Example 1 of the present invention;

[0025] Figure 2 This is a comparison diagram of the evaluation of the real-time fluorescence detection effect of the crRNA1+crRNA7 primer combination of pine wood nematode in Example 1 of the present invention;

[0026] Figure 3 This is a curve chart showing the specificity evaluation of real-time fluorescence detection of the pine wood nematode CRISPR / Cas13 amplification-free detection system according to Example 2 of the present invention. DETAILED DESCRIPTION

[0027] The present invention provides a crRNA primer set for detecting pine wood nematodes.

[0028] In the present invention, the primer set includes a direct repeat sequence and a spacer guide sequence; the direct repeat sequence has a Cas protein binding function. Cas protein can produce RNase activity under the guidance of crRNA, produce multiple cleavage sites on the target RNA single strand, and have base preference, and have RNase trans-cleavage activity for specific base small molecule sequences. In the present invention, the Cas protein preferably includes any one of Cas13a protease, Cas13b protease, Cas13c protease and Cas13d protease, and more preferably includes Cas13a protease. In the present invention, the direct repeat sequence preferably includes SEQ ID NO:1.

[0029] In the present invention, the target gene of the spacer guide sequence includes the expansin gene. The spacer guide sequence can specifically match the pine wood nematode expansin gene RNA present in the living cells of pine wood nematodes. In the present invention, the spacer guide sequence preferably includes one or more of SEQ ID NO:2, SEQ ID NO:6, SEQ ID NO:8 and SEQ ID NO:9; more preferably includes SEQ ID NO:2 and SEQ ID NO:8.

[0030] The crRNA primer set provided by the present invention uses the pine wood nematode expansion protein expansin gene as the target gene for pine wood nematode detection. The expansin gene is only expressed in pharyngeal gland cells, plays a role in host-parasite interactions, and can assist nematode migration, propagation and diffusion in the host. The expansin protein is fused with a carbohydrate domain and an expansion protein domain, but in cyst nematodes, root-knot nematodes, pine wood and pseudo-pine wood nematodes, the protein does not contain a carbohydrate domain. After comparing the gene sequences of pine wood and pseudo-pine wood, it was found that there were some sequence differences, so it was selected as a target sequence to detect pine wood nematodes.

[0031] The present invention utilizes the trans-cleavage activity of the Cas protein, so that the Cas protein cuts the reporter molecule under the guidance of crRNA, thereby realizing rapid and accurate screening of living pine wood nematodes, thereby realizing the judgment of whether the pine wood nematodes are alive or not in the wood, and minimizing or preventing trade restrictions on imported and exported wood products.

[0032] The present invention provides a kit for detecting pine wood nematodes, including the crRNA primer set, and also including LwaCas13a protein, LwaCas13a buffer, rNTP mix buffer, RNase inhibitor, DEPC water, ssRNAFQ-labeled reporter and pine wood nematode expansin ssRNA standard. Wherein, the 5' end of the ssRNA FQ-labeled reporter is preferably labeled with a FAM reporter group, and the 3' end is preferably labeled with a BHQ1 reporter group; the sequence of the ssRNA FQ-labeled reporter is preferably 5'-6FAM-UUUUU-BHQ1-3'.

[0033] The kit of the present invention realizes the specific detection function by constructing a 37°C constant temperature fluorescence reaction system of CRISPR / Cas13a. In the present invention, the CRISPR / Cas13a reaction system is preferably a 20μl system: 2μl of crRNA primer set (10ng / μl), 1μl of LwaCas13a protein (10μM), 2μl of LwaCas13a buffer, 1μl of rNTP mix buffer, 0.5μl of RNase inhibitor, 9μl of DEPC water, 2.5μl of ssRNA FQ-labeled reporter and 2μl of pine wood nematode expansin ssRNA standard.

[0034] The kit provided by the present invention is based on the CRISPR / Cas13 system, and uses the crRNA primer set to perform non-amplification detection on the expansin gene of pine wood nematodes, which has the advantages of strong specificity and high detection efficiency. At the same time, the kit provided by the present invention also performs rapid and accurate screening on whether the host or forest wood contains live pine wood nematodes on the basis of successfully detecting pine wood nematodes, preventing the spread of live nematodes with the import, export and transportation of pine wood and other breeding materials, and has excellent prospects for promotion and use for port detection and practical application.

[0035] The present invention also provides the use of the crRNA primer set and the kit in detecting pine wood nematodes.

[0036] In the present invention, the application preferably includes any one of the following:

[0037] (1) Testing of trees that show symptoms of disease but have not been confirmed to contain pine wood nematodes;

[0038] (2) Testing of samples of nematode suspension obtained by the Baermann funnel method but not confirmed to contain pine wood nematodes;

[0039] (3) Testing of trees that are confirmed to contain pine wood nematodes but not to contain living pine wood nematodes.

[0040] In the present invention, the operation method used in detecting pine wood nematodes preferably includes the following steps:

[0041] S1. Extracting RNA from the sample to be tested, and using the RNA from the sample to be tested as a template to construct a CRISPR / Cas13 reaction system for pine wood nematodes;

[0042] S2. Initiate the CRISPR / Cas13 reaction of pine wood nematodes and perform real-time fluorescence detection at a constant temperature; process and compare the fluorescence signal: if the fluorescence signal is higher than the detection threshold, pine wood nematodes are present; if the fluorescence signal is lower than the detection threshold, pine wood nematodes are absent.

[0043] Furthermore, the temperature of the constant temperature real-time fluorescence detection in step S2 of the present invention is preferably 37° C.; the time for processing and comparing the fluorescence signal in step S2 is preferably 15-20 minutes after starting the reaction, and more preferably 18 minutes.

[0044] The frequency of collecting the fluorescence signal in step S2 is preferably once per minute.

[0045] The fluorescence signal in step S2 is preferably analyzed using a real-time fluorescence PCR instrument and analyzed according to the following criteria:

[0046] Negative judgment criteria: the relative fluorescence value at each time point after treatment is lower than or equal to the detection threshold;

[0047] Positive judgment criteria: the relative fluorescence value at each time point after treatment is lower than or equal to the detection threshold.

[0048] The negative control group is a negative signal group set up corresponding to each experimental group, in which non-pine wood nematode RNA is added as a template.

[0049] Furthermore, the negative signal group of the present invention can replace the template with water.

[0050] The application method provided by the present invention is a new type of nucleic acid rapid detection method for pine wood nematodes, which gets rid of the dependence on traditional amplification reactions and has the advantages of simple operation, high stability, strong specificity, short time consumption, high detection efficiency, etc., and is of great significance for the detection of live pine wood nematodes during wood transportation.

[0051] The crRNA primer set, kit and application for detecting pine wood nematodes provided by the present invention are described in detail below in conjunction with the embodiments, but they should not be understood as limiting the scope of protection of the present invention.

[0052] Unless otherwise specified, the experimental methods used in the examples are conventional methods; the materials and reagents used are all available from commercial sources.

[0053] Materials involved in the present invention: samples of pine wood nematodes and their closely related species, pine wood nematodes, were provided by the laboratory of the Institute of Zoology, Chinese Academy of Sciences; crRNA and ssRNA signal reporter probes were synthesized by Shanghai Shenggong Biological Co., Ltd.; other biochemical reagents were imported or domestically produced for analytical grade.

[0054] The instruments involved in the present invention include: a centrifuge, a metal bath, a vortexer, and a real-time fluorescence quantitative PCR instrument.

[0055] Example 1 Design and screening of CRISPR / Cas13a primer crRNA for non-amplification detection of pine wood nematodes

[0056] 1. Selection of target sequence

[0057] After multiple screening and comparison, the expansin gene of pine wood nematode and its closely related species Bursaphelenchus xylophilus was selected as the target sequence (Accession Number: AB374536.1, AB374538.1). The target gene is conserved within the pine wood nematode species and has great differences between Bursaphelenchus xylophilus species, so the pine wood nematode can be specifically detected.

[0058] 2. Design of crRNA specifically targeting the expansin gene of pine wood nematode

[0059] The design of LwaCas13a crRNA follows the following four principles:

[0060] (1) crRNA includes a spacer sequence and a direct repeat sequence (DR), and the sequence format is: 5'-direct repeat sequence bound to LwaCas13a protein-crRNA spacer sequence-3', and the direct repeat sequence corresponding to LwaCas13a is GAUUUAGACUACCCCAAAAACGAAGGGGACUAAAAC;

[0061] (2) connecting the direct repeat sequence to the spacer sequence to form a complete crRNA sequence;

[0062] (3) The spacer sequence of crRNA is reverse complementary to the target site sequence in the target RNA.

[0063] (4) The length of the crRNA spacer sequence is 28 bases, and its sequence recognition with the target RNA has a base preference, tending to recognize the base "U";

[0064] Based on the target sequence comparison results of the existing pine wood nematode and pine wood nematode expansin genes, 8 crRNA-specific primers were designed according to the crRNA design principles, and their nucleotide sequences are as follows:

[0065] crRNA1: sequence 1 + sequence 2

[0066] Sequence 1:

[0067] GAUUUAGACUACCCCAAAAACGAAGGGGACUAAAAC

[0068] Sequence 2: AUGAUGCCAACAGCGACAACAAGUAGAC

[0069] crRNA2: sequence 1 + sequence 3

[0070] Sequence 1:

[0071] GAUUUAGACUACCCCAAAAACGAAGGGGACUAAAAC

[0072] Sequence 3: UCUGGUCGGCGAUGACAAAUGAUGCCAA

[0073] crRNA3: sequence 1 + sequence 4

[0074] Sequence 1:

[0075] GAUUUAGACUACCCCAAAAACGAAGGGGACUAAAAC

[0076] Sequence 4: CAAGUUUUGCACAUCCAGACCACAAGCC

[0077] crRNA4: sequence 1 + sequence 5

[0078] Sequence 1:

[0079] GAUUUAGACUACCCCAAAAACGAAGGGGACUAAAAC

[0080] Sequence 5: CCAUUGGAGUCGAAGAGGCUUCCAGACA

[0081] crRNA5: sequence 1 + sequence 6

[0082] Sequence 1:

[0083] GAUUUAGACUACCCCAAAAACGAAGGGGACUAAAAC

[0084] Sequence 6: GAUUCGAGGGCACCCAUUGACCAUUGGA

[0085] crRNA6: sequence 1 + sequence 7

[0086] Sequence 1:

[0087] GAUUUAGACUACCCCAAAAACGAAGGGGACUAAAAC

[0088] Sequence 7: AAUGTAUCUUCCGUCAGGCAGAUUCGAG

[0089] crRNA7: sequence 1 + sequence 8

[0090] Sequence 1:

[0091] GAUUUAGACUACCCCAAAAACGAAGGGGACUAAAAC

[0092] Sequence 8: ACUGGGUCAUCCAAAAUGUAUCUUCCGU

[0093] crRNA8: sequence 1 + sequence 9

[0094] Sequence 1:

[0095] GAUUUAGACUACCCCAAAAACGAAGGGGACUAAAAC

[0096] Sequence 9: UGCCUCGGCAAACUGGGUCAUCCAAAAU

[0097] 3. Preparation of crRNA

[0098] In order to facilitate the needs of experimental preservation and amplification, the present invention synthesizes crRNA into a DNA sequence, and in actual use, the DNA is transcribed into RNA using an in vitro transcription method; the in vitro transcription method requires the addition of a T7 promoter sequence (GAAATTAATACGACTCACTATAGGG) to the 5' of the synthesized DNA sequence. The DNA sequence was synthesized by Shanghai Shenggong Bioengineering Co., Ltd., as shown in Table 1.

[0099] Table 1 Template sequences (oligo DNA) used to prepare crRNA of pine wood nematode

[0100]

[0101]

[0102] The oligo DNA template of crRNA was annealed into double-stranded DNA using rTaq 10X PCR buffer (TaKaRa).

[0103] Annealing system: Oligo DNA 1μl, T7 promoter 1μl, Standard Taq buffer 1μl, DEPCH2O 7μl. (10μl system)

[0104] In the above reaction system, the concentrations of oligo DNA and T7 promoter were 100 μM, and the concentration of Standard Taqbuffer was 10X.

[0105] The annealing procedure is as follows:

[0106] 95℃5min; 94℃to 25℃(0.1℃ / s); 25℃∞.

[0107] According to the instructions of HiScribe T7 Quick High Yield RNA Synthesis Kit (New England Biolabs), the annealed product dsDNA (crRNA) obtained in the previous step was transcribed using T7 RNA polymerase to obtain crRNA.

[0108] The transcription system is: RNase-free H2O 17μl, NTP buffer Mix 10μl, T7 RNA Polymerase Mix 2μl, dsDNA (crRNA) 1μl. (30μl system)

[0109] In the above reaction system, the final concentration of NTP buffer is 6.7 mM, and the final concentration of dsDNA (crRNA) is 1 μg / μl.

[0110] The transcription reaction procedure is as follows:

[0111] Incubate at 37°C for 16 h

[0112] Add 20 μl of nuclease-free water to the reaction system, pipette and mix well, then add 2 μl of DNase I

[0113] Incubate at 37°C for 15 min

[0114] After the transcription reaction is completed, the crRNA is purified in vitro using RNA Clean&Concentrator kit; the concentration of the purified crRNA is measured by Nanodrop2000, and the concentration of crRNA is diluted to 10 ng / μl using DEPC water (the diluted crRNA is packaged into 20 μl per tube and stored at -80°C for subsequent use).

[0115] 4. No amplification reaction of CRISPR / Cas13a

[0116] CRISPR / Cas13a amplification-free detection reaction was performed using the following reaction solution ratio to construct a 20 μl reaction system:

[0117] Table 2 CRISPR / Cas13a reaction system

[0118]

[0119] The above reagents were added to eight rows of RNase-free centrifuge tubes in sequence and centrifuged to mix.

[0120] The negative control was set up by replacing the template RNA in Table 2 with DEPC water and keeping other reagent components unchanged.

[0121] 5. Preparation of ssRNA fragment of pine wood nematode expansin gene

[0122] The pine wood nematode (provided by the Institute of Zoology, Chinese Academy of Sciences) was used as the material, and the genomic DNA of the pine wood nematode was extracted using the CTAB method and stored at -20°C.

[0123] The obtained DNA was used as a template to perform conventional PCR reaction on the Bx-expansin gene fragment, and a single band of 700 bp in length was obtained.

[0124] PCR reaction system: 2×San Taq PCR Mix 25μl, upstream primer 2μl, downstream primer 2μl, DNA template 1μl, DEPC H2O 20μl. (50μl system)

[0125] In the above reaction system, the concentrations of upstream and downstream primers were both 10 μM.

[0126] The PCR reaction program is as follows:

[0127] 94℃5min; 94℃30s, 55℃30s, 72℃40s, 35cycles; 72℃10min; 4℃∞.

[0128] The obtained product was subjected to agarose gel electrophoresis, gel excision and recovery, and the recovery effect was detected by agarose gel electrophoresis.

[0129] The PCR product of Bx-expansin gene was transcribed to obtain Bx-expansin ssRNA positive control.

[0130] The transcription system is: Bx-expansin recovery product 11μl, NTP Buffer Mix 10μl, T7 Polymerase 2μl, RNase H2O 17μl. (40μl system)

[0131] The above reaction system was incubated at 37°C for 16 hours to complete the transcription reaction. Then, the RNA Clean&Concentrator kit was used for purification. The concentration of the purified Bx-expansin ssRNA was measured using Nanodrop2000 and stored at -80°C for subsequent use.

[0132] 6. Screening of crRNA primers for CRISPR / Cas13a without amplification reaction

[0133] The obtained Bx-expansin ssRNA fragment was used as the target to screen the key primer crRNA required in the CRISPR / Cas13 reaction.

[0134] The samples were prepared according to the ratio of each reaction solution in the CRISPR / Cas13a reaction system. Except for crRNA, the other components were kept the same; the negative control was set to DEPC water instead of the template RNA in the reaction system, and the other reagent components remained unchanged.

[0135] The comparison of the constant temperature real-time fluorescence detection results is shown in Figure 1 .according to Figure 1 The test results showed that both crRNA1 and crRNA7 primer sets could quickly detect pine wood nematode RNA within 20 minutes, and the relative fluorescence values ​​were significantly better than those of other crRNA primer sets.

[0136] The present invention attempts to add an equal amount of crRNA primer set (the addition amount of crRNA1 and crRNA7 is 1 μl, the concentration is 10 ng / μl; the molar ratio of LwaCas13a enzyme: crRNA is not changed) to observe the detection reaction, and the comparison of the constant temperature real-time fluorescence detection results is shown in Figure 2 .according to Figure 2 The test results showed that the detection effect of the crRNA1+crRNA7 primer group was better than that of a single crRNA primer in the first 30 minutes, and the fluorescence reaction data value was higher. At the end point of 60 minutes, the detection effect was almost the same as that of a single crRNA primer group.

[0137] Example 2 CRISPR / Cas13a amplification-free detection reaction specificity test

[0138] 1. Test methods

[0139] The total RNA of pine wood nematode and pine wood nematode was extracted using a kit.

[0140] The obtained total RNA of pine wood nematode and pine wood nematode was used as a template, and the system established in Example 1 was applied to perform CRISPR / Cas13a amplification-free reaction-specific real-time fluorescence detection, and a negative control was set to verify the specificity of the method.

[0141] Place the reaction tube in a real-time fluorescence PCR instrument, and set the reaction program to 37°C for 60 minutes; read the fluorescence reaction value every 1 minute. If the fluorescence reaction value is higher than the reaction threshold after calculation, it is judged as positive (there are living pine wood nematodes); if the fluorescence reaction value is lower than the reaction threshold after calculation, it is judged as negative (no living pine wood nematodes).

[0142] 2. Test results

[0143] The specificity of CRISPR / Cas13a real-time fluorescence detection was evaluated by detecting Bursaphelenchus xylophilus and Bursaphelenchus philadelphica respectively.

[0144] Test results such as Figure 3 As shown, only when the fluorescence reaction result of detecting pine wood nematode is higher than the reaction threshold, the result is judged as positive, and the fluorescence reaction result of detecting pseudopine wood nematode is lower than the reaction threshold, the result is judged as negative; these test results prove that the detection method established by the present invention has good specificity.

[0145] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A crRNA primer set for detecting pine wood nematodes, characterized in that: It is composed of crRNA1 with a nucleotide sequence as shown in SEQ ID NO: 10 and crRNA7 with a nucleotide sequence as shown in SEQ ID NO:

16.

2. A kit for detecting pine wood nematodes, characterized in that: The invention comprises the crRNA primer set according to claim 1, and further comprises LwaCas13a protein, LwaCas13a buffer, rNTP mix buffer, RNase inhibitor, DEPC water, ssRNAFQ-labeled reporter and pine wood nematode expansin ssRNA standard.

3. The kit according to claim 2, characterized in that The sequence of the ssRNA FQ-labeled reporter is 5'-6FAM-UUUUU-BHQ1-3'.

4. Use of the crRNA primer set according to claim 1, the kit according to claim 2 or claim 3 in detecting pine wood nematodes.

5. The use according to claim 4, characterized in that: The steps include: S1. Extract RNA from the sample to be tested, and use the RNA from the sample to be tested as a template to construct a CRISPR / Cas13 reaction system for pine wood nematodes; S2. Initiate the CRISPR / Cas13 reaction of pine wood nematodes and perform real-time fluorescence detection at a constant temperature; process and compare the fluorescence signal: if the fluorescence signal is higher than the detection threshold, pine wood nematodes are present; if the fluorescence signal is lower than the detection threshold, pine wood nematodes are absent.

6. The use according to claim 5, characterized in that: The temperature of the constant temperature real-time fluorescence detection in step S2 is 37° C.; the time for processing and comparing the fluorescence signal in step S2 is 15-20 minutes after starting the reaction.

7. The use according to any one of claims 4 to 6, characterized in that: The application includes any of the following: (1) Testing of trees that show symptoms of disease but have not been confirmed to contain pine wood nematodes; (2) Testing of samples of nematode suspension obtained by the Baermann funnel method but not confirmed to contain pine wood nematodes; (3) Testing of trees that are confirmed to contain pine wood nematodes but not to contain living pine wood nematodes.

Images