Method for synthesizing propionic acid using 1,2-propanediol and recombinant bacteria used therefor
By introducing the KPpdu gene cluster into *Pseudomonas putida* KT2440 and optimizing its expression, the problem of low propionic acid yield was solved, achieving efficient propionic acid conversion and high-purity propionic acid production.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- INST OF MICROBIOLOGY CHINESE ACAD OF SCI
- Filing Date
- 2022-11-29
- Publication Date
- 2026-05-08
AI Technical Summary
In the existing technology, the theoretical yield of propionic acid from L-threonine by Pseudomonas putida KT2440 is low and the atom economy is not high, so it is necessary to improve the propionic acid yield of microorganisms.
By introducing the KPpdu gene cluster, including glycerol dehydratase and its activating protein, into *Pseudomonas putida* KT2440, using the PBAD promoter for tight regulation, and integrating it into the lacI site, the expression of glycerol dehydratase was optimized to improve propionic acid conversion.
This study achieved a highly efficient conversion from 1,2-propanediol to propionic acid, with a propionic acid conversion rate of 99% and a reduced yield of the byproduct propanol, providing a new approach for the production of high-purity bio-based propionic acid.
Smart Images

Figure BDA0003969604580000091 
Figure BDA0003969604580000101 
Figure HDA0003969604590000011
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biotechnology, and specifically relates to a method for synthesizing propionic acid using 1,2-propanediol and the recombinant bacteria used therein. Background Technology
[0002] Propionic acid (PA) is an important intermediate metabolite in living organisms. Propionic acid and its calcium salt are among the most widely used food additives, artificial flavorings, and preservatives. It is also certified as "Generally Recognized As Safe" (GRAS) by the Food and Drug Administration (FDA), indicating a high level of safety. Furthermore, propionic acid is an important intermediate in the production of various industrial compounds, with wide applications in paints, cosmetics, pharmaceuticals, and pesticides. Currently, the chemical synthesis of propionic acid mainly involves the hydrogenation of ethylene, with petroleum as the final feedstock. Although chemical synthesis methods offer high yields and profits, they often lead to severe environmental pollution problems, and petroleum is a non-renewable resource, exacerbating resource scarcity. Therefore, the method of producing propionic acid through fermentation using renewable resources as substrates in microbial cell factories has attracted widespread attention.
[0003] *Pseudomonas putida* KT2440 is a soil microorganism capable of degrading various pollutants and possessing biocontrol capabilities against plant diseases. KT2440 is the most well-characterized strain within the *Pseudomonas* group and is increasingly becoming a promising laboratory model strain in synthetic biology and metabolic engineering. KT2440 has been certified as a biosafety strain by the Recombinant DNA Advisory Committee and can be used to produce various industrial chemicals, including products intended for direct human use (Nelson 2002). Furthermore, *Pseudomonas putida* KT2440 possesses a complex intracellular aldehyde dehydrogenase system, endowing it with extremely strong oxidizing capabilities, making it an excellent industrial acid-producing strain.
[0004] Ma Chao et al. designed a pathway for the conversion of L-threonine into propionic acid and achieved efficient catalytic synthesis of propionic acid in *Pseudomonas putida* KT2440 (Patent No.: ZL 201811381133.2; Application No.: 201910572968.4; Application No.: 202111253877.8). However, the theoretical yield from L-threonine to propionic acid was only 0.62 g / g, which is not very atom-economical. Summary of the Invention
[0005] The technical problem to be solved by the present invention is to improve the propionic acid yield of microorganisms.
[0006] To address the above technical problems, this invention provides a recombinant *Pseudomonas putida*.
[0007] The recombinant *Pseudomonas putida* provided by this invention contains the KPpdu gene cluster, which encodes glycerol dehydratase and glycerol dehydratase activator protein.
[0008] The recombinant *Pseudomonas putida* also contains a promoter that initiates transcription of the KPpdu gene cluster, the promoter being named P... BAD promoter, P BAD The promoter is any of the following DNA molecules:
[0009] 1) A DNA molecule with a single strand whose nucleotide sequence is nucleotides 880 to 1229 of sequence 1 in the sequence listing;
[0010] 2) DNA molecules that share more than 80% identity with DNA molecules in 1) and have promoter function.
[0011] The recombinant *Pseudomonas putida* does not contain the lacI gene, which encodes a transcriptional regulatory factor protein.
[0012] The KPpdu gene cluster is derived from Klebsiella pneumoniae.
[0013] In the aforementioned recombinant *Pseudomonas putida*, the glycerol dehydratase comprises three proteins: the large glycerol dehydratase subunit pduC, the middle glycerol dehydratase subunit pduD, and the small glycerol dehydratase subunit pduE.
[0014] The glycerol dehydratase large subunit pduC is a protein whose amino acid sequence is sequence 2 in the sequence listing;
[0015] The glycerol dehydratase contains a protein whose amino acid sequence is sequence 3 in the sequence listing;
[0016] The glycerol dehydratase small subunit pduE is a protein whose amino acid sequence is sequence 4 in the sequence listing.
[0017] The glycerol dehydratase activating protein comprises the following proteins: glycerol dehydratase activating protein α subunit pduG and glycerol dehydratase activating protein β subunit pduH:
[0018] The α subunit pduG of the glycerol dehydratase activating protein is a protein whose amino acid sequence is sequence 5 in the sequence listing;
[0019] The β subunit pduH of the glycerol dehydratase activating protein is a protein whose amino acid sequence is sequence 6 in the sequence listing;
[0020] The pduC gene is any of the following DNA molecules:
[0021] C1) The coding sequence is the DNA molecule shown in positions 1230 to 2894 of SEQ ID NO.1;
[0022] The nucleotide sequence defined by C2) has 90% or more identity with C1) and is a DNA molecule encoding the protein pduC;
[0023] C3) hybridizes under stringent conditions with a nucleotide sequence defined by C1) or C2) and encodes the DNA molecule of the protein.
[0024] The pduD gene is any of the following DNA molecules:
[0025] D1) The coding sequence is the DNA molecule shown at positions 2905 to 3594 of SEQ ID NO.1;
[0026] D2) has 90% or more identity with the nucleotide sequence defined by D1) and is a DNA molecule encoding the protein pduD;
[0027] D3) hybridizes under stringent conditions with a nucleotide sequence defined by D1) or D2) and encodes the DNA molecule of the protein.
[0028] The pduE gene is any of the following DNA molecules:
[0029] E1) The coding sequence is the DNA molecule shown in positions 3609 to 4133 of SEQ ID NO. 1;
[0030] The nucleotide sequence defined by E2) has 90% or more identity with E1) and is a DNA molecule encoding the protein pduE.
[0031] E3) hybridizes under stringent conditions with a nucleotide sequence defined by E1) or E2) and encodes the DNA molecule of the protein.
[0032] The pduG gene is any of the following DNA molecules:
[0033] The G1 coding sequence is the DNA molecule shown in positions 4146 to 5978 of SEQ ID NO. 1;
[0034] The nucleotide sequence defined by G2) has 90% or more identity with G1) and is a DNA molecule encoding the protein pduG.
[0035] G3) hybridizes with a nucleotide sequence defined by G1) or G2) under stringent conditions and encodes the DNA molecule of the protein.
[0036] The pduH gene is any of the following DNA molecules:
[0037] The H1) coding sequence is the DNA molecule shown at positions 5968 to 6318 of SEQ ID NO. 1;
[0038] The nucleotide sequence defined by H2) has 90% or more identity with H1) and is a DNA molecule encoding the protein pduH;
[0039] H3) hybridizes under stringent conditions with a nucleotide sequence defined by H1) or H2) and encodes the DNA molecule of the protein.
[0040] The proteins mentioned above can be synthesized artificially, or their encoding genes can be synthesized first and then expressed biologically.
[0041] In the aforementioned proteins, the protein tag refers to a polypeptide or protein fused with the target protein using in vitro DNA recombination technology for expression, detection, tracing, and / or purification of the target protein. The protein tag may be a Flag tag, His tag, MBP tag, HA tag, myc tag, GST tag, and / or SUMO tag, etc.
[0042] In the above-mentioned proteins, identity refers to the identity of the amino acid sequences. The identity of amino acid sequences can be determined using homology search sites on the Internet, such as the BLAST page on the NCBI homepage. For example, in Advanced BLAST 2.1, using blastp as the program, setting the Expect value to 10, setting all filters to OFF, using BLOSUM62 as the matrix, setting the Gap existence cost, Per residue gap cost, and Lambda ratio to 11, 1, and 0.85 (default values) respectively, and performing an identity search on a pair of amino acid sequences to calculate the identity value (%), then the identity value can be obtained.
[0043] In the aforementioned proteins, the 80% or more identity can be at least 81%, 82%, 85%, 86%, 88%, 90%, 91%, 92%, 95%, 96%, 98%, 99%, or 100% identity.
[0044] The present invention also provides a method for constructing the above-mentioned recombinant *Pseudomonas putida*, the method comprising introducing the above-mentioned KPpdu gene cluster into a recipient *Pseudomonas putida* to obtain the recombinant *Pseudomonas putida*, culturing the recombinant *Pseudomonas putida*, and expressing the recombinant protein KPpdu.
[0045] In the above method, the KPpdu gene cluster is introduced into the recipient *Pseudomonas putida* via a DNA fragment. The DNA fragment contains the KPpdu gene cluster and a promoter for initiating transcription of the KPpdu gene cluster. The nucleotide sequence of the promoter is nucleotides 880-1229 of SEQ ID No. 1. The KPpdu gene cluster is a DNA molecule, and its nucleotide sequence is positions 1230-6318 of sequence 1.
[0046] The DNA fragment is made by P BAD The sequence consists of a promoter, the regulatory protein gene araC, and the KPpdu gene cluster. Sequence 1, positions 1-879 represent the regulatory protein gene araC, and positions 880-1229 represent P. BAD The promoter sequence, positions 1230-6318 of sequence 1, is the coding sequence for the KPpdu gene cluster. Specifically, the nucleotide sequence from positions 1230-2894 of sequence 1 encodes the large subunit pduC protein of glycerol dehydratase (amino acid sequence is the protein of sequence 2); positions 2905-3594 of sequence 1 encodes the middle subunit pduD protein of glycerol dehydratase (amino acid sequence is the protein of sequence 3); positions 3609-4133 of sequence 1 encodes the small subunit pduE protein of glycerol dehydratase (amino acid sequence is the protein of sequence 4); positions 4146-5978 of sequence 1 encodes the α subunit pduG protein of glycerol dehydratase activator (amino acid sequence is the protein of sequence 5); and positions 5968-6318 of sequence 1 encodes the β subunit pduH protein of glycerol dehydratase activator (amino acid sequence is the protein of sequence 6).
[0047] In the above method, the KPpdu gene cluster is integrated into the lacI gene site of the recipient *Pseudomonas putida* via a DNA fragment, which is equivalent to knocking out the lacI gene of the recipient *Pseudomonas putida*. The lacI gene encodes a transcriptional regulatory factor protein.
[0048] This invention also provides the application of recombinant *Pseudomonas putida* in the preparation of propionic acid.
[0049] The present invention also provides a method for preparing propionic acid.
[0050] The method for preparing propionic acid provided by the present invention includes culturing the recombinant Pseudomonas putida to obtain a fermentation product, and obtaining propionic acid from the fermentation product.
[0051] This article investigates a novel biotransformation pathway from 1,2-propanediol to propionic acid. Figure 11,2-Propanediol is a bio-based raw material that has been industrialized for bio-production and is suitable for the production of bio-based propionic acid. 1,2-Propanediol is first catalyzed by a glycerol dehydrating enzyme to produce propionaldehyde and one molecule of H2O, which is then oxidized by the KT2440 enzyme to produce propionic acid. Both 1,2-Propanediol and propionic acid are three-carbon compounds, resulting in a very low atom loss rate during the conversion process. H2O is the only byproduct, and the mass conversion rate is as high as 97.36%.
[0052] Glyceryl dehydratase is a type of coenzyme B. 12 This enzyme is oxygen-dependent and exhibits a suicide inactivation effect on its substrates glycerol and 1,2-propanediol. It can be reactivated by co-expressing its "activating protein." In this invention, the KPpdu gene cluster (containing the glycerol dehydrases pduCDE (pduC, pduD, and pduE) and their activating proteins pduGH (pduG and pduH)) from *Klebsiella pneumoniae* was introduced into wild-type *P. putida* KT2440 to obtain the recombinant strain TVG01 overexpressing KPpdu. The recombinant strain TVG01 overexpressing KPpdu produced 149.5 mM propionic acid and 125.3 mM propanol (a byproduct) within 24 hours, with a remaining 8.1 mM of 1,2-propanediol.
[0053] To further improve propionic acid conversion and reduce the yield of the byproduct propanol, this invention optimizes the expression and conversion process of glycerol dehydrating enzyme. The most tightly regulated inducible promoter in Pseudomonas bacteria is the arabinose-inducible promoter P... BAD , will start the P BAD The KPpdu gene cluster, formed by the glycerol dehydratase and its activating protein genes, was integrated into the lacI site of *Pseudomonas* to obtain the engineered strain TVG02. During cultivation, the expression of the glycerol dehydratase was regulated by controlling the concentration of the inducer. Experiments showed that when the concentration of the inducer L-arabinose was 0.02% (0.02 g / 100 mL), the expression intensity of the glycerol dehydratase matched that of *Pseudomonas*' own aldehyde dehydrogenase. The intermediate product propionaldehyde did not accumulate and could be rapidly and continuously converted into the final product propionic acid, with a final propionic acid molar conversion rate of 99% after 24 hours. This invention provides a new approach for the synthesis of high-purity bio-based propionic acid. Attached Figure Description
[0054] Figure 1 This is the biotransformation pathway from 1,2-propanediol to propionic acid.
[0055] Figure 2 To verify the pUCP18-KPpdu plasmid by colony PCR.
[0056] Figure 3The chromatograms of recombinant strain TVG01 after 24 hours of reaction are shown. A represents the chromatograms of standards for 1,2-propanediol, propionic acid, and propanol. The peak time for 1,2-propanediol standard is 19.7 min (50 mM), for propionic acid standard is 21.5 min (50 mM), and for propanol standard is 31.6 min (50 mM). B represents the chromatogram of recombinant strain TVG01 after 24 hours of reaction. The peak at 19.7 min is 1,2-propanediol, the peak at 21.5 min is propionic acid, and the peak at 31.6 min is propanol.
[0057] Figure 4 The production of propionic acid after overexpression of glycerol dehydratase and its activating protein from Klebsiella pneumoniae in P. putidaKT2440.
[0058] Figure 5 The chromatograms of recombinant strain TVG02 after 24 hours of reaction are shown. A represents the chromatograms of standards for 1,2-propanediol, propionic acid, and propanol. The peak time for 1,2-propanediol standard is 19.7 min (50 mM), for propionic acid standard is 21.5 min (50 mM), and for propanol standard is 31.6 min (50 mM). B represents the chromatogram of recombinant strain TVG02 after 24 hours of reaction; the peak at 21.5 min is propionic acid.
[0059] Figure 6 The propionic acid production of recombinant strain TVG02 after induction with 0.02% L-arabinose. Detailed Implementation
[0060] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.
[0061] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.
[0062] Unless otherwise specified, the quantitative experiments in the following examples are all repeated three times, and the results are averaged.
[0063] The pUCP18 and pK18Gm plasmids used in the following examples are described in Ma, C., Mu, Q., Wang, L. et al. Bio-production of high-purity propionate by engineering L-threonine degradation pathway in Pseudomonas putida. Appl Microbiol Biotechnol (104), 5303–5313 (2020). This biomaterial is available to the public from the applicant and is intended solely for the purpose of replicating experiments of this invention and may not be used for any other purpose.
[0064] The pRB1k plasmid in the following examples has been described in Qingxuan Mu, Ya'nan Shi, Rongshan Li, Chao Ma, Yong Tao, and Bo Yu. Production of Propionate by a Sequential Fermentation-Biotransformation Process via L-Threonine. Journal of Agricultural and Food Chemistry 2021 69(46), 13895-13903. The biological material is available to the public from the applicant and is intended solely for the purpose of repeating experiments of the present invention and shall not be used for any other purpose.
[0065] The strain Pseudomonas putida KT2440 used in this invention has been described in Ma, C., Mu, Q., Wang, L. et al. Bio-production of high-purity propionate by engineering L-threonine degradation pathway in Pseudomonas putida. Appl Microbiol Biotechnol (104), 5303–5313 (2020). This biological material is available to the public from the applicant and is intended solely for the purpose of replicating the experiments of this invention and may not be used for any other purpose.
[0066] Example 1: Construction of recombinant strain TVG01
[0067] 1. Construction and transformation of recombinant expression vector pUCP18-KPpdu
[0068] Plasmid pUCP18 was double-digested with BamHI and HindIII (New England Biolabs Inc., USA) to obtain a linearized plasmid backbone. The KPpdu gene cluster (composed of the glycerol dehydratase gene pduCDE and its activating protein gene pduGH) was cloned from a previously constructed plasmid, yielding the PCR product of KPpdu with a nucleotide sequence corresponding to positions 2234-7374 of sequence 7 in the sequence listing. The linearized plasmid backbone and the KPpdu PCR product were ligated using Gibson assembly. The ligation product was transformed into *E. coli* DH5α to obtain transformants. The plasmid from the transformants was extracted and sequenced to obtain the constructed recombinant expression plasmid pUCP18-KPpdu, with a nucleotide sequence corresponding to sequence 7 in the sequence listing.
[0069] pUCP18-KPpdu was electroporated into Pseudomonas putida KT2440 (recipient strain). 100 μL of competent Pseudomonas putida KT2440 cells were transduced with 1 μg of plasmid. Electroporation conditions: A BioRad electroporator was used, with a 1 mm electroporation cuvette, 1.8 kV discharge, and a discharge time of 4-5 seconds. All transformed cells were plated on gentamicin-resistant plates (50 μg / mL) and incubated statically overnight at 30°C. Single colonies were picked and verified by colony PCR using primers KPpdu-F and KPpdu-R.
[0070] Table 1 Primers for colony PCR verification
[0071] Primer name Primer sequence 5'-3' KPpdu-F ATTCGAGCTCGGTACCCGGGGATCCAATGAGATCGAAAAGATTTGAAG KPpdu-R GTAAAACGACGGCCAGTGCCAAGCTTTTAAGCATGGCGATCCCGAAATG
[0072] PCR validation results are as follows Figure 2As shown, the obtained band size is about 5.1Kb. The positive clone is the recombinant *Pseudomonas putida* containing the pUCP18-KPpdu plasmid, abbreviated as recombinant strain TVG01. The plasmid nucleotide sequence is sequence 7 in the sequence listing. The recombinant *Pseudomonas putida* contains a gene cluster KPpdu whose coding sequence (CDS) is nucleotides 2260-7348 of sequence 7. This cluster contains the following nucleotide sequences: nucleotides 2260-3924 of sequence 7 encode the large subunit pduC protein of glycerol dehydratase (amino acid sequence is sequence 2); nucleotides 3935-4624 of sequence 7 encode the middle subunit pduD protein of glycerol dehydratase (amino acid sequence is sequence 3); nucleotides 4639-5163 of sequence 7 encode the small subunit pduE protein of glycerol dehydratase (amino acid sequence is sequence 4); nucleotides 5176-7008 of sequence 7 encode the α subunit pduG protein of glycerol dehydratase activator (amino acid sequence is sequence 5); and nucleotides 6998-7348 of sequence 7 encode the β subunit pduH protein of glycerol dehydratase activator (amino acid sequence is sequence 6).
[0073] Colony PCR confirmed the successful construction of the pUCP18-KPpdu plasmid. The leftmost lane represents a commercially available 1kb DNA molecular weight standard (Tiangen Biotech Co., Ltd., MD111).
[0074] Colony PCR of Pseudomonas putida KT2440 (the recipient bacterium) using primers KPpdu-F and KPpdu-R failed to yield specific PCR products, indicating that Pseudomonas putida KT2440 does not contain the fusion gene Kppdu.
[0075] The empty vector pUCP18 was electroporated into Pseudomonas putida KT2440 according to the steps described above to obtain the blank control strain pUCP18-kt.
[0076] Example 2: Method for producing propionic acid through whole-cell conversion
[0077] Single clones of the above recombinant strain TVG01 and blank control strain pUCP18-kt were picked and placed in LB medium with 50 μg / mL gentamicin (liquid medium obtained by adding gentamicin to LB medium to a gentamicin concentration of 50 μg / mL). The medium was cultured overnight at 30°C and 200 rpm. 1% of the clones were then transferred to fresh medium (LB with 50 μg / mL gentamicin and 5 mg / LVB12) and cultured for 18 hours.
[0078] Collect bacterial cells by centrifugation, resuspend in 50 mM pH 7.0 PBS (8.0 g / L NaCl, 0.2 g / L KCl, 2.9 g / L Na2HPO4·12H2O, 0.24 g / L KH2PO4) buffer, and wash twice. Add the bacterial cells to a 100 mL wide-mouth flask, then add 50 mM pH 7.0 PBS, 1,2-propanediol, and vitamin B12. 12 A reaction system with a volume of 50 mL was obtained, and the bacterial cell content in the reaction system was 30 OD. 600nm / mL, the content of 1,2-propanediol is 300mM, VB 12 The concentration was 5 mg / L. The reaction was carried out in a constant temperature water bath (37℃, 500 rpm), and the pH of the reaction was monitored in real time. The propionic acid generated by the reaction was neutralized by automatically pumping in 1M Ca(OH)2 to maintain the pH at around 7.0. Samples were taken at regular intervals, and the reaction was completed after 24 hours. The experiment was repeated 3 times.
[0079] After the reaction was completed, the contents of 1,2-propanediol, propanol, and the generated propionic acid in the reaction solution were determined. The specific determination method was as follows: the reaction solution obtained from the sample was centrifuged, the supernatant was collected, diluted 10 times with deionized water, 1 mL of the diluted solution was taken, and filtered through a 0.22 μm filter membrane. The resulting filtrate was the sample to be tested, and the sample was analyzed by HPLC.
[0080] Using Sinopharm Chemical Reagent Co., Ltd. (product catalog number 81011918), Innochem (product catalog number KYFJQ22), and Sinopharm Chemical Reagent Co., Ltd. (product catalog number 80109118) as standards, the contents of propionic acid, 1,2-propanediol, and propanol were qualitatively analyzed based on the retention time of the standards and quantitatively analyzed using the standard curve method (external standard method). In the HPLC analysis, the column was a Bio-Rad HPX-87H column (7.8 × 300 mm, 9 μm); the mobile phase was 6 mM sulfuric acid aqueous solution; the flow rate was 0.5 ml / min; the injection volume was 10 μl; and the detector was a refractive index detector (RID).
[0081] Figure 3 A represents the chromatograms of the standards for 1,2-propanediol, propionic acid, and propanol. The peak time for the 1,2-propanediol standard is 19.7 min (concentration 50 mM), the peak time for the propionic acid standard is 21.5 min (concentration 50 mM), and the peak time for the propanol standard is 31.6 min (concentration 50 mM).
[0082] Figure 3 The chromatogram of recombinant strain TVG01 after 24 hours of reaction is shown in Figure B. The peak at 19.7 min is 1,2-propanediol, the peak at 21.5 min is propionic acid, and the peak at 31.6 min is propanol.
[0083] The results of the determination of propionic acid production from 1,2-propanediol by recombinant strain TVG01 are as follows: Figure 4 As shown, pUCP18-kt represents the substrate residue and product production of Pseudomonas putida KT2440 containing the empty plasmid pUCP18 after 24 hours. TVG01 represents the substrate residue and product production of the recombinant Pseudomonas putida KT2440 strain overexpressing KPpdu after 24 hours. According to HPLC results, the pUCP18-kt strain still had 211.4 mM 1,2-propanediol remaining after 24 hours, with propanol and propionic acid yields of 43.2 mM and 42.9 mM, respectively. TVG01, on the other hand, produced 149.5 mM propionic acid and 125.3 mM propanol byproducts after 24 hours, with 8.1 mM 1,2-propanediol remaining.
[0084] Example 3: Integration of gene KPpdu into the lacI site of chromosome Pseudomonas putida KT2440.
[0085] The upstream and downstream homologous arms of the lacI site, each 600 bp, were obtained by PCR amplification from the Pseudomonas putida KT2440 chromosome set. The primers used for PCR amplification of the upstream homologous arm were LacI-up-F and LacI-up-R (Table 2), and the primers used for PCR amplification of the downstream homologous arm were LacI-down-F and LacI-down-R (Table 2). The KPpdu gene cluster sequence was obtained by PCR amplification from plasmid pUCP18-KPpdu, using primers listed in Table 2. BAD -KPpdu-F and P BAD -KPpdu-R.
[0086] Using primer P in Table 2 BAD -F and P BAD -R was obtained from PCR amplification of promoter P from plasmid pRB1k. BAD And its upstream regulatory protein gene araC sequence.
[0087] Plasmid pK18Gm was circularly digested with BamHI and HindIII (New England Biolabs Inc., USA) to obtain the plasmid backbone. The DNA fragment obtained from the PCR was then ligated with the double-digested plasmid backbone using Gibson recombination to obtain the ligation product. This ligation product was transformed into *E. coli* DH5α to obtain transformants. The plasmid from the transformants was extracted and sequenced for analysis. The pK18Gm-up-down sequence was performed using the ΔlacI::P... BADThe nucleotide sequence of -KPpdu) is sequence 8 in the sequence listing. pK18Gm-up-down(ΔlacI::P BAD -KPpdu) contains the KPpdu gene cluster, which is a DNA molecule whose nucleotide sequence is from position 1230 to 6318 of sequence 8. Sequence 8 is composed of P BAD The sequence consists of a promoter, the regulatory protein gene araC, and the KPpdu gene cluster. Sequence 8, positions 1-879, contains the araC regulatory protein sequence, and positions 880-1229 of sequence 8 contain P. BAD The promoter sequence, specifically positions 1230-6318 of sequence 8, is the coding sequence for the KPpdu gene cluster. The nucleotide sequence from positions 1230-2894 of sequence 8 encodes the large subunit pduC protein of glycerol dehydratase (the amino acid sequence is the protein in sequence 2), the nucleotide sequence from positions 2905-3594 of sequence 8 encodes the middle subunit pduD protein of glycerol dehydratase (the amino acid sequence is the protein in sequence 3), and the nucleotide sequence from positions 3609-4133 of sequence 8 encodes the glycerol dehydratase... The small subunit of the hydrolase pduE protein (amino acid sequence of sequence 4) and the DNA nucleotide sequence of sequence 8 (positions 4146-5978) encode the α subunit of the glycerol dehydratase activator pduG protein (amino acid sequence of sequence 5). The DNA nucleotide sequence of sequence 8 (positions 5968-6318) encodes the β subunit of the glycerol dehydratase activator pduH protein (amino acid sequence of sequence 6). The resulting recombinant plasmid pK18-up-down(ΔlacI::P) was constructed. BAD -KPpdu).
[0088] pK18Gm-up-down(ΔlacI::P BAD -KPpdu) contains the FRT sequence that mediates homologous recombination. The FRT sequence is a DNA molecule whose nucleotide sequence is positions 7412-7458 of sequence 8.
[0089] pK18Gm-up-down(ΔlacI::P BAD -KPpdu) electroconversion of Pseudomonas putida KT2440 was performed using the same method as in Example 1. Transformation plates were incubated overnight. Multiple single-clonal transformants were picked and streaked onto LB plates containing 20% (20g / 100mL) sucrose, and then incubated statically at 30°C for 36 hours.
[0090] Single colonies newly grown after the above steps were selected and verified by colony PCR using primers ΔlacI-YF and ΔlacI-YR from Table 2. The KPpdu gene cluster has been successfully integrated into the lacI site, and the homologous recombination plasmid pK18Gm-up-down(ΔlacI::P) has been successfully integrated. BAD -KPpdu) has been eliminated, resulting in recombinant strain TVG02 (recombinant Pseudomonas putida TVG02). Recombinant Pseudomonas putida TVG02 is obtained by integrating the KPpdu gene cluster into the lacI site of the Pseudomonas putida KT2440 genome and knocking out the lacI gene of Pseudomonas putida KT2440 (nucleotide sequence (CDS) is GenBank:NC_002947(10-February-2022) from position 1 to position 1351).
[0091] Table 2 Primers used in the experiment
[0092]
[0093]
[0094] Example 4: Optimized method for whole-cell conversion to produce propionic acid
[0095] Single clones of strain TVG02 obtained in Example 3 were picked and cultured in LB medium with 50 μg / mL gentamicin (a liquid medium obtained by adding gentamicin to LB medium to a gentamicin concentration of 50 μg / mL). The culture was incubated overnight at 30°C and 200 rpm. 1% of the culture was then transferred to fresh LB medium with 50 μg / mL gentamicin and cultured until the early logarithmic growth phase (OD1). 600nm =0.6-0.8 (using LB medium + 50 μg / mL gentamicin as a blank control), add L-arabinose and vitamin B12. 12 This resulted in an L-arabinose content of 0.02% (0.02 g / 100 mL) in the culture system, and VB 12 The concentration of glycerol dehydratase was 5 mg / L to induce expression, and the cells were cultured for another 16 hours. The cells were collected by centrifugation and resuspended in 50 mM pH 7.0 PBS (8.0 g / L NaCl, 0.2 g / L KCl, 2.9 g / L Na2HPO4·12H2O, 0.24 g / L KH2PO4) buffer, and washed twice. The cells were then added to a 1 L fermenter, followed by 50 mM pH 7.0 PBS, 1,2-propanediol, and vitamin B12. 12 A reaction system with a volume of 300 mL was obtained, and the bacterial cell content in the reaction system was 30 OD. 600nm / mL, the content of 1,2-propanediol is 400mM, VB 12 The concentration was 5 mg / L. The stirring speed was automatically controlled within the range of 300-600 rpm, correlated with dissolved oxygen level, and the aeration rate was 1.5 L / min to maintain a dissolved oxygen level of 50%. The reaction temperature was 37°C, and the pH was controlled at 7.0 by adding 1.0 M Ca(OH)₂ aqueous solution. Samples were taken at regular intervals, and the reaction was completed after 24 hours. Sample processing and detection methods were the same as in Example 2. The experiment was repeated three times, with one 1 L fermenter per treatment per repeat.
[0096] Formula for calculating propionic acid conversion rate: Conversion rate = 24-hour propionic acid yield (concentration, mM) / 1,2-propanediol feed amount (concentration, mM) * 100%
[0097] Figure 5 A represents the chromatograms of the standards for 1,2-propanediol, propionic acid, and propanol. The peak time for the 1,2-propanediol standard is 19.7 min (concentration 50 mM), the peak time for the propionic acid standard is 21.5 min (concentration 50 mM), and the peak time for the propanol standard is 31.6 min (concentration 50 mM). Figure 5 Figure B shows the chromatogram of recombinant strain TVG02 after 24 hours of reaction; the peak at 21.5 min is propionic acid. The yield of propionic acid per liter of reaction system is 392.3 mM.
[0098] During cultivation, the expression of glycerol dehydratase was regulated by controlling the concentration of the inducer. When the concentration of the inducer L-arabinose was 0.02% (w / v), the expression intensity of glycerol dehydratase matched that of Pseudomonas aeruginosa's own aldehyde dehydrogenase, and the intermediate product propionaldehyde did not accumulate, allowing for rapid and continuous conversion to the final product propionic acid. Figure 6 It was found that the 24-hour biotransformation process of 1,2-propanediol resulted in a final propionic acid molar conversion rate of 99%. This study provides a new approach for the synthesis of high-purity bio-based propionic acid.
[0099] The present invention has been described in detail above. For those skilled in the art, the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. Although specific embodiments have been given, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein. Some of the essential features can be applied within the scope of the following appended claims.
Claims
1. Recombinant *Pseudomonas putida*, characterized by: The recombinant *Pseudomonas putida* contains KPpdu Gene clusters, the KPpdu The gene cluster encodes glycerol dehydratase and glycerol dehydratase activator protein; The KPpdu The gene cluster originates from Klebsiella pneumoniae; The glycerol dehydratase comprises three proteins: the large glycerol dehydratase subunit pduC, the medium glycerol dehydratase subunit pduD, and the small glycerol dehydratase subunit pduE. 1) The large subunit pduC of the glycerol dehydratase is a protein whose amino acid sequence is sequence 2 in the sequence listing; 2) The subunit pduD of the glycerol dehydratase is a protein whose amino acid sequence is sequence 3 in the sequence listing; 3) The small subunit pduE of the glycerol dehydratase has the amino acid sequence of sequence 4 in the sequence listing; The glycerol dehydratase activating protein comprises the following proteins: glycerol dehydratase activating protein α subunit pduG and glycerol dehydratase activating protein β subunit pduH: 1) The α subunit pduG of the glycerol dehydratase activating protein has the amino acid sequence of sequence 5 in the sequence listing; 2) The β subunit pduH of the glycerol dehydratase activating protein has the amino acid sequence of sequence 6 in the sequence listing; By introducing the above into the receptor Pseudomonas putida KPpdu Gene clusters were used to obtain the recombinant *Pseudomonas putida*. The recipient *Pseudomonas putida* was *Pseudomonas putida* KT2440.
2. The recombinant *Pseudomonas putida* according to claim 1, characterized in that, The recombinant *Pseudomonas putida* also contains a promoter. KPpdu The promoter for gene cluster transcription, the promoter being named P BAD promoter, P BAD The promoter is a DNA molecule whose nucleotide sequence is nucleotides 880 to 1229 of sequence 1 in the sequence listing.
3. The recombinant *Pseudomonas putida* according to claim 1 or 2, characterized in that, The recombinant *Pseudomonas putida* does not contain... lac I gene, as described lac Gene I encodes a transcriptional regulatory factor protein.
4. A method for constructing the recombinant *Pseudomonas putida* according to any one of claims 1-3, the method comprising introducing the recombinant *Pseudomonas putida* according to any one of claims 1-3 into a recipient *Pseudomonas putida*. KPpdu Gene clusters were used to obtain the recombinant *Pseudomonas putida*; the recipient *Pseudomonas putida* was *Pseudomonas putida* KT2440.
5. The method as described in claim 4, characterized in that, The KPpdu The gene cluster is introduced into the recipient *Pseudomonas putida* via a DNA fragment, the DNA fragment containing the... KPpdu Gene clusters and the starter KPpdu The promoter for gene cluster transcription, wherein the nucleotide sequence of the promoter is nucleotides 880-1229 of SEQ ID No.
1.
6. The method as described in claim 5, characterized in that, The KPpdu Gene clusters are integrated into the receptor *Pseudomonas putida*. lac The I gene locus will transmit the receptor *Pseudomonas putida*. lac I gene knockout, the aforementioned lac Gene I encodes a transcriptional regulatory factor protein.
7. The use of the recombinant *Pseudomonas putida* according to any one of claims 1-3 in the preparation of propionic acid.
8. A method for preparing propionic acid, characterized in that, The method includes culturing the recombinant *Pseudomonas putida* as described in any one of claims 1-3, obtaining a fermentation product, and obtaining propionic acid from the fermentation product.
Citation Information
Patent Citations
Construction of recombinant pseudomonas putida and application of recombinant pseudomonas putida in production of propionic acid
CN111197054A
Construction of recombinant *Pseudomonas putida* strain and its application in the conversion of threonine to propionic acid
CN112143689B
Method for synthesizing propionic acid by using threonine and recombinant bacterium used in method
CN114015633A