A method for separating and purifying bacterial ferritin of anaerobic ammonium oxidizing bacteria

Abstract

The present invention discloses a method for separating and purifying bacterial ferritin of anaerobic ammonium oxidizing bacteria. KS The Bfr gene is amplified, cloned and expressed to obtain bacterial cells, which are then suspended with a lysis solution, ultrasonically lysed, and the supernatant is collected by centrifugation. The bacterial ferritin is then separated and purified twice to obtain bacterial ferritin, including: the gel and the supernatant are mixed and loaded into an empty column tube of an affinity chromatography column, and then gradient washing is performed in sequence using a washing buffer containing 100 mM, 200 mM, 400 mM, and 600 mM NaCl solutions; washing is performed at least 5 times with the washing solution, and then eluted with an elution solution to obtain a bacterial ferritin mixture; the bacterial ferritin mixture is concentrated with an ultrafiltration tube, and then separated with a molecular sieve chromatography column to obtain assembled spherical bacterial ferritin. This method can purify bacterial ferritin from the anaerobic ammonia-oxidizing bacteria Candidatus Kuenenia stuttgartiensis, thereby providing technical support for studying the structure and function of anaerobic ammonia-oxidizing bacterial ferritin.

Description

Technical Field

[0001] The invention belongs to the technical field of sewage treatment, and particularly relates to a method for separating and purifying bacterial ferritin of anaerobic ammonia-oxidizing bacteria. Background Art

[0002] Anammox bacteria is a general term for a class of bacteria involved in the anaerobic ammonium oxidation process, and is a type of anaerobic bacteria. Anammox bacteria are chemoautotrophic bacteria belonging to the Planctomycetes. The Planctomycetes can be divided into the Planctomycetales and the Anammoxales. The Anammoxales can be divided into six genera: Ca.Anammoximicrobium, Ca.Brocadia, Ca.Anammoxoglobus, Ca.Jettenia, Ca.Kuenenia, and Ca.Scalindua (Ca. is the abbreviation of Candidatus).

[0003] Anaerobic ammonium oxidizing bacteria use nitrite as an electron acceptor to oxidize ammonia nitrogen into nitrogen gas and nitrate nitrogen. It has the advantages of high efficiency and low consumption, and has the most application prospects in the denitrification process in the field of water treatment. Anaerobic ammonium oxidizing bacteria are rich in iron. When anaerobic ammonium oxidizing sludge becomes the dominant bacteria, it presents a beautiful red color, which is different from traditional activated sludge. Therefore, it is also called "red bacteria" in the field of water treatment.

[0004] Ferrous iron is an important substrate element for the growth of anaerobic ammonium oxidizing bacteria and is widely used in the cultivation of anaerobic ammonium oxidizing sludge. Van Niftrik et al. found nanoscale (16-25 nanometers in diameter) electron-dense particles in Anammox bacteria, showing a high iron content. The iron concentration in anaerobic ammonium oxidizing bacteria is an order of magnitude higher than that in other microorganisms. Proteomics found two bacterial ferritin genes (Q1Q5F8 and Q1Q315) in the Anammox bacterial genome. These iron-containing nanoparticles were proven to be bacterial ferritin, and their content accounted for more than 8.03% of the total protein. In addition, iron has a positive effect on the growth and activity of anaerobic ammonium oxidizing bacteria. The Fe content in the Anammox reactor is increased by 2.5%. 2+ Increasing the concentration of Fe from 0.03 mmol / L to 0.09 mmol / L is beneficial to the synthesis of heme and the growth of anaerobic ammonium oxidizing bacteria. It can also promote the synthesis of cytochrome C, increase the activity of hydrazine dehydrogenase (HDH), and greatly shorten the start-up time of the Anammox reactor. 2+The addition of increased the hydrophobicity of the sludge, increased the diameter of the anaerobic ammonium oxidizing bacteria particles, and improved the denitrification capacity of the anaerobic ammonium oxidizing reactor. The iron-containing protein in the anaerobic ammonium oxidizing bacteria is involved in many important cellular processes such as intracellular electron transfer, anabolism, catabolism and anaerobic ammonium oxidation reactions. Therefore, studying the structure and function of the iron protein of anaerobic ammonium oxidizing bacteria is of great significance to improving the operating efficiency of the anaerobic ammonium oxidizing process.

[0005] At present, the technologies for protein separation and purification include: gel filtration chromatography, ion exchange chromatography, affinity chromatography, hydrophobic interaction chromatography and reverse phase chromatography. The qualitative ability of ion exchange chromatography is poor, and pure protein cannot be obtained by only using the single method of ion exchange, and other purification steps are required. Hydrophobic chromatography often uses high-salinity buffer, but bacterial ferritin can easily disintegrate into single subunits in high salinity; at the same time, hydrophobic interaction chromatography is more suitable for extracting protein from large volumes, and the cost is relatively high. Therefore, how to separate and purify anaerobic ammonia-oxidizing bacterial ferritin is a technical problem that technicians in this field hope to solve. Summary of the invention

[0006] In view of the existing purification technology and the properties of bacterial ferritin itself, the purpose of the present invention is to provide a method for separating and purifying bacterial ferritin of anaerobic ammonium oxidizing bacteria, which can effectively separate and purify bacterial ferritin of the anaerobic ammonium oxidizing bacteria Candidatus Kuenenia stuttgartiensis, thereby providing technical support for studying the structure and function of anaerobic ammonium oxidizing bacterial ferritin.

[0007] The technical solution of the present invention is achieved in this way:

[0008] A method for separating and purifying bacterial ferritin from anaerobic ammonium oxidizing bacteria, comprising: firstly KS The Bfr gene is amplified, cloned and expressed to obtain bacterial cells, which are then suspended with a lysis buffer, ultrasonically lysed, and then centrifuged to collect the supernatant. Finally, bacterial ferritin is obtained by performing two separation and purification steps. The separation and purification includes the following steps:

[0009] S1 primary purification

[0010] After mixing the gel and the supernatant, incubate on a shaker at 4°C for at least 1 h, then load into an empty column tube of an affinity chromatography column, and then sequentially use a washing buffer containing 100 mM, 200 mM, 400 mM, and 600 mM NaCl solutions for concentration gradient washing; then use the washing solution for at least 5 times, and then use the elution solution for elution to obtain a bacterial ferritin mixture;

[0011] S2 Secondary purification

[0012] The bacterial ferritin mixed solution is concentrated by using an ultrafiltration tube, and then separated by using a molecular sieve chromatography column to obtain self-assembled spherical bacterial ferritin.

[0013] Furthermore, when amplified, KS The nucleotide sequence of the Bfr gene was used as a template, and PCR amplification was performed with primers 1 and 2. KS Bfr gene is Candidatus Kuenenia stuttgartiensis bacterial ferritin gene, KS The amino acid sequence of the Bfr gene is shown in SEQ ID NO.1. KS The nucleotide sequence of the Bfr gene is shown in SEQ ID NO.2; the nucleotide sequences of primer 1 and primer 2 are shown in SEQ ID NO.3 and SEQ ID NO.4, respectively.

[0014] Further, the cloning and expression operations are as follows: amplify KS The Bfr gene was connected to the cloning vector pET-28a+ to obtain KS Bfr cloning plasmid; KS The Bfr cloning plasmid was transferred into BL21 (DE3), then activated and cultured in LB medium containing kanamycin, and then transferred to fresh LB medium for amplification culture. When the OD600 value of the bacterial solution was 0.6-0.8, an inducer was added to the bacterial solution for induction culture, and finally the bacteria were collected.

[0015] Furthermore, when the bacteria are expanded, ferrous sulfate and heme are added to the bacterial solution to increase KS The self-assembly ability of Bfr, ​​where the concentration of ferrous sulfate is 1~5mM and the concentration of heme is 5~10 mM.

[0016] Furthermore, the lysis buffer is configured as follows: pH 7.5~8.0 Tris-HCl buffer concentration is 25~100 mM, NaCl concentration is 25~150 mM, Triton X-100 ratio is 0.1~0.5%, DTT is 2~5 mM, DNA hydrolase is 0~5 ug / mL, and protease inhibitor mixture is 5~10 ug / mL.

[0017] Furthermore, during ultrasonic lysis, the ultrasonic power was 420 w, the input was 4 s, the interval was 6 s, and the total time was 20-30 min; during centrifugation, the centrifugation was performed for 20-30 min, the speed was 8000-10000 rpm, and the temperature was 4 °C; when the gel and the supernatant were mixed, the volume ratio of the gel and the supernatant was 1:4.

[0018] Furthermore, the washing solution is configured as follows: 25-50 mM Tris-HCl buffer, 25-100 mM NaCl, 0-5 mM imidazole, pH 7.5-8.0; during washing, the washing solution is used for at least 5 washes, and the amount of the washing solution each time is half of the column volume.

[0019] Furthermore, the elution is performed using an elution solution, and the configuration of the elution solution is: 25~50 mM Tris-HCl buffer, pH 7.5~8.0, 25~100 mM NaCl, 20~500 mM imidazole.

[0020] Furthermore, arginine is added to the elution buffer, and the concentration of arginine is 25-50 mM.

[0021] Furthermore, before concentration, dialysis is performed using a dialysate, and the dialysate is configured as follows: Before concentration, dialysis is performed using a dialysate, and the dialysate is configured as follows: 25-50 mM NaH2PO4, 25-100 mM NaCl, pH 7.5-8.0, and 25-50 mM arginine.

[0022] Compared with the prior art, the present invention has the following beneficial effects:

[0023] 1. The present invention can successfully purify and separate bacterial ferritin from the anaerobic ammonium oxidizing bacteria Candidatus Kuenenia stuttgartiensis, thereby providing technical support for studying the structure and function of anaerobic ammonium oxidizing bacterial ferritin.

[0024] 2. In the primary purification process of the present invention, NaCl concentration gradient washing is first used, then the impurity protein is washed with a washing solution, and then the target protein is eluted with an eluent; during the secondary purification, a molecular sieve chromatography column is used to separate the assembled spherical bacterial ferritin from the incompletely assembled chain bacterial ferritin to obtain correctly assembled spherical bacterial ferritin.

[0025] 3. Anaerobic ammonium oxidation is currently the most promising wastewater treatment technology. Bacterial ferritin is a good iron storage site. The purification of KS Bfr provides strong support for studying the iron metabolism process in anaerobic ammonium oxidizing bacteria and the iron regulation of this technology. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figure 1 - Example 1 KS Figure 3. Bfr gene and empty vector pET-28a+ enzyme digestion results.

[0027] Figure 2 - Macroscopic photograph of the BL21 (DE3) bacterial solution mixture of Example 1.

[0028] Figure 3 - SDS-PAGE image of the recombinant protein of Example 1.

[0029] Figure 4 - Transmission electron microscopy image of the primary purified bacterial ferritin of Example 1

[0030] Figure 5 - Optimization effect diagram of arginine in Example 1 and Example 2.

[0031] Figure 6 - Example 1 KS Gel permeation chromatogram of the Bfr gene.

[0032] Figure 7 - Example 1 KS Transmission electron micrograph of the Bfr gene.

[0033] Figure 8 - Recombination of Example 1 KS Activity verification diagram of Bfr gene. DETAILED DESCRIPTION

[0034] The present invention is further described in detail below in conjunction with the accompanying drawings and specific embodiments.

[0035] The Candidatus Kuenenia stuttgartiensis bacterial ferritin gene (abbreviated as: KS The amino acid sequence of the Bfr gene is as follows, specifically as shown in SEQ ID NO.1.

[0036] KS Amino acid sequence of the Bfr gene:

[0037] megnpkvivv lnellmaeit ainqyfvhak mcenwgykrl yefneknsie emkhaeklierllylegipk mdlgkitvgk vvkeqlendy alekiaiqrl qksitlcaev gdagsrelle hiltdeekhandleehlqqi kdmgienyls vqvikkde

[0038] Obtained through conversion and modification KS The nucleotide sequence of the Bfr gene, KS The nucleotide sequence of the Bfr gene is as follows, specifically shown in SEQ ID NO.2.

[0039] KS Nucleotide sequence of the Bfr gene:

[0040] ATGGAAGGCA ACCCGAAAGT AATTGTAGTG CTGAATGAAC TGCTGATGGC AGAAATCACCGCGATTAACC AGTATTTCGT ACACGCGAAA ATGTGCGAGA ACTGGGGCTA CAAACGCCTG TATGAGTTCAATGAAAAGAA CTCTATCGAG GAAATGAAAC ATGCCGAAAA ACTGATTGAA CGTCTGCTGT ACCTGGAAGGCATTCCGAAG ATGGATCTGG GTAAAATTAC CGTCGGCAAG GGTCTGCTGT ACCTGGAAGG CATTCCGAAGATGGATCTGG GTAAAATTAC CGTCGGCAAG GAGAAAAGCA TCACTCTGTG CGCAGAAGTG GGCGACGCTGGTTCCCGCGA GCTGCTGGAA CACATCCTGA CTGATGAAGA AAAACACGCC AACGACCTGG AGGAACACCTGCAGCAGATT AAAGACATGG GCATCGAAAA CTATCTGAGC GTACAGGTGA TCAAGAAAGA TGAA

[0041] Example 1

[0042] (1) Gene amplification

[0043] clone KS Bfr gene, amplified by PCR KS The Bfr gene was amplified KS The nucleotide sequences of the Bfr gene, primer 1 and primer 2 used are as follows, specifically shown as SEQ ID NO.3 and SEQ ID NO.4 respectively.

[0044] Primer 1: AAGGAGCAAC TGGAGAACGA TTACG

[0045] Primer 2: TCGGTCAAAA TATGTTCAAG CAACTCC

[0046] The PCR amplification system was: primer 1 0.5uL×22, primer 2 0.5uL×24, dNTP (25 mM) 1uL, 10Xpfu Buffer 5 uL, upstream and downstream primers 2uL each, Pfu (5 μ / μL) 0.4μL, and ddH2O was added to make up to 50μL.

[0047] PCR reaction conditions: 94°C pre-denaturation for 3 min; 94°C denaturation for 22 s; 58°C annealing for 20 s; 72°C extension for 30 s; and finally 72°C extension for 5 min. 24 cycles were set from the second step for two rounds of amplification.

[0048] The plasmid was double-digested, and the vector digestion system was placed in a 37 ℃ constant temperature water bath for 2 h. The PCR product was detected by 2% agarose gel electrophoresis, and the PCR product was recovered by gel excision using the AxyPrepDNA gel recovery kit. The recovered product was used for subsequent research. Vector pET28a: 4 μg; 10X FD Buffer: 5μL; Sall: 1μL (10 μ / μL); EcoRI: 1 μL (10 μ / μL); ddH2O: 39 μL.

[0049] (2) Connection of target fragments and product transformation

[0050] The recovered purified DNA fragments were connected to the vector. Since the same nuclease will produce the same sticky ends, the vector plasmid and the inserted DNA fragment have the same sticky ends. The two fragments with sticky ends can be connected together using ligase. The ligation system mixture was placed in a 22℃ PCR instrument for 1 h. After the connection was completed, the enzyme cutting was re-verified. Ligation system: enzyme cutting target fragment: 8 μg; enzyme cutting vector pET28a: 4 μL; 10X T4DNAligase Buffer: 2 μL; T4 DNAligase: 1 μL (5 μ / μL); ddH2O: supplemented to 20 μL.

[0051] The results are as follows Figure 1 As shown in the figure, the fragment gene size was obtained by digestion with MuI and XHoI. One is a large band without the target gene, and the other is a small band with the target gene. After digestion with MuI and XhoI, the digested fragment is consistent with the theoretical size of 1336bp. Both the plasmid and the target gene digested fragment are in line with expectations and can proceed to the next stage.

[0052] (3) Transform the plasmid into BL21(DE3) competent cells

[0053] To transfer the connected plasmid into competent cells, you need to first remove the competent cells from the low-temperature refrigerator and melt them on ice, then add 2 μL of the connection product to the melted cells and continue to ice bath for 15 min. Then place the mixed cell solution in a constant temperature water bath at 42 ℃ for 90s to allow the DNA to enter the competent cells. Keep the cells stable during the whole process and avoid shaking. After the heat shock is completed, ice bath for 5 min. Finally, add 500 μL LB medium, shake at 37℃, 200 rpm for 1 h, take 200 μL of bacteria and apply them to LB plates containing resistance (final concentration 50 μg / ml kanamycin), and invert and culture at 37℃ overnight.

[0054] (4) Expression of bacterial ferritin

[0055] A. Activation:

[0056] Will KS The Bfr cloning plasmid was transformed into BL21(DE3), and then the plasmid carrying pET28a -KS The E. coli expressing the Bfr plasmid gene expression vector was inoculated into 5 mL LB liquid medium containing 50 ug / mL kanamycin and cultured overnight in a shaking incubator at 37°C and 180 rpm.

[0057] B. Expansion training:

[0058] The E. coli activated overnight was inoculated into LB liquid culture medium at a ratio of 1:50, and cultured in a shaking incubator at 37°C and 180 rpm. The culture was stopped when the OD600 value of the bacterial liquid reached 0.6-0.8.

[0059] C. Induction:

[0060] Add the inducer IPTG (isopropyl-β-D-thiogalactoside) to the bacterial solution to a final concentration of 1 mM, add 2.5 mM ferrous sulfate and 10 mM heme, and then culture at 25 °C, 120 rpm, in a shaker for 18 h to obtain a cell pellet.

[0061] D. Bacteria collection:

[0062] The cell precipitate was suspended in a phosphate buffer solution at pH 8.0 and then centrifuged. This step was repeated three times to collect the bacterial precipitate, which was red in color.

[0063] contain KS The BL21(DE3) bacterial solution containing Bfr protein is as follows Figure 2 As shown, the mixed solution is pink.

[0064] (4) Purification of bacterial ferritin

[0065] A. Cracking:

[0066] The above-mentioned bacteria were washed once with Tris-HCl buffer (pH 8.0), and after centrifugation, the cell pellet was suspended in lysis buffer on ice for 0.5-1 h.

[0067] Lysis buffer configuration: pH 8.0, Tris-HCl buffer concentration of 25~100 mM, NaCl concentration of 25~150mM, Triton X-100 solution volume ratio of 0.1~0.5%, DTT 2~5 mM, DNA hydrolase 0-5 ug / mL, protease inhibitor mixture 5-10 ug / mL. All operations were performed on ice.

[0068] B. Cell disruption

[0069] Use an ultrasonic cell disruptor to lyse the cells. The ultrasonic power is 420 W, input for 4 s, and the interval is 6 s, for a total of 20-30 min. Stop when the solution shows an interface of bacterial liquid separation.

[0070] C. Bacterial liquid separation:

[0071] Use a centrifuge to collect the bacterial lysis supernatant, which is now brown-red in color. Centrifugal conditions: 30 min, 10,000 rpm, 4 °C.

[0072] D. Primary purification

[0073] The materials required in the protein purification process include His-tag Purification Resin (referred to as gel) and empty affinity chromatography column tubes.

[0074] The specific operation is as follows: add 4 mL of bacterial lysate supernatant to every 1 mL of gel to make the gel and bacterial lysate supernatant evenly mixed. Then slowly incubate on a shaker at 4 ℃ for at least 1 hour. Finally, load the lysate supernatant and gel mixture into the empty column tube of the affinity chromatography column, let the liquid in the column flow out under the action of gravity, and the gel is trapped in the chromatography column.

[0075] ①Washing

[0076] The gel was washed with 100, 200, 400, and 600 mM NaCl solutions, commonly known as column washing. Each concentration was washed twice, and the washing volume was twice the column volume. The Tris-HCl in the buffer was 25-100 mM, pH 7.6.

[0077] ② Wash the impurities again

[0078] Wash with washing buffer, the washing buffer system is: 50 mM Tris-HCl buffer, pH 7.6, 100 mM NaCl, 5 mM imidazole. Perform at least 5 times, and the amount of washing buffer each time is half of the column volume.

[0079] ③ Elution of target protein

[0080] Use half column volume of eluent each time for elution.

[0081] Elution buffer configuration: 50 mM Tris-HCl buffer, pH 7.6, 100 mM NaCl, 20~500 mM imidazole. Since bacterial ferritin is red, the elution is completed when the His-tag Purification Resin shows its original blue color.

[0082] The SDS-PAGE image of the recombinant protein obtained at this time is as follows Figure 3 As shown, Figure 3 The molecular weights of the target protein are as follows: 10, 15, 25, 35, 45, 60, 75, 100, 140, and 180 KDa. It can be seen from the figure that the molecular weight of the target protein band is approximately 18.3 KDa, which is consistent with the theoretical molecular weight of the target protein, indicating that bacterial ferritin was successfully purified.

[0083] Transmission electron microscopy image of bacterial ferritin after primary purification Figure 4 As shown in the figure, it can be seen that it contains spherical and chain-shaped bacterial ferritin, among which the spherical ones are the completed bacterial ferritin, and the chain-shaped ones are bacterial ferritin monomers or polymers.

[0084] E. Secondary purification

[0085] ① Dialysis

[0086] The purified bacterial ferritin was dialyzed with a dialysis buffer containing arginine, which helps stabilize and dissolve the protein. Dialysis conditions: the dialysis solution was changed every 4 hours, for a total of 4 dialysis cycles. The dialysis buffer was configured as follows: 50 mM NaH2PO4, 100 mM NaCl, pH 7.6, and 50 mM cosolvent arginine. The optimization effect of cosolvent arginine is shown in Figure 2. Figure 5 As shown, Figure 5 Medium M from small to large: 10, 15, 25, 35, 45, 60 KDa, Figure 5 It can be seen that when not dialyzed, a large amount of protein is lost due to precipitation, and the band shows that the protein concentration is significantly reduced; after adding arginine to the dialysate (arginine dialysis), the protein concentration is significantly increased and the band is wider.

[0087] ② Screening

[0088] The dialyzed protein was concentrated using an ultrafiltration tube to obtain bacterial ferritin with a relatively high concentration, and then the protein was purified twice using a molecular sieve chromatography column. The buffer system was 50 mM NaH2PO4, 100 mM NaCl, pH 7.6.

[0089] During the purification process KS The gel of Bfr was subjected to permeation chromatography, and the results were as follows Figure 6 As shown, two absorption peaks appeared, of which peak 1 (higher peak) was the fully assembled bacterial ferritin, and peak 2 (lower peak) was the bacterial ferritin monomer or polymer.

[0090] In the specific implementation, the method of increasing the protein concentration is as follows: when filling the gravity column, the filling volume of the purification resin can be appropriately reduced to increase the binding density of the target protein and the nickel column; at the same time, when eluting the target protein, the elution volume is reduced each time to slow down the elution speed of the target protein to increase the concentration of the target protein.

[0091] The final bacterial ferritin was scanned by transmission electron microscopy, and the transmission electron microscopy image is shown in the figure. Figure 7 As shown, bacterial ferritin is approximately 10-13 nm in size ( Figure 7 (a) shows that the assembled globulin was successfully purified. The unassembled protein is in the form of a chain ( Figure 7 (b)).

[0092] In vitro experiments:

[0093] Verify the activity of the purified assembled globulin by measuring the increase in UV absorbance at 340 nm. KS Kinetic parameters of ferritin oxidation activity of Bfr. The reaction volume was 1 mL. The buffer solution contained 100 mM MES, pH 6.5, freshly prepared FeSO4 solution, a final protein concentration of 0.5 μM, and FeSO4 of 125 μM. The control group was not added with bacterial ferritin. The iron ion concentration in the solution after the reaction was also measured.

[0094] The results are as follows Figure 8 As shown by Figure 8 (a) It can be seen that the addition of Fe 2+ back, KS The absorbance of the Bfr solution at 340 nm increased rapidly in the first 200 seconds, and the absorbance value gradually approached 0.25, while KS The absorbance of the control group of Bfr was almost zero. Figure 8 (b) It can be seen that KS Bfr solution Fe 2+ The content dropped sharply, and the results showed that KSBfr has good activity and possesses a functional ferroxidase center (FC).

[0095] Example 2

[0096] This example is the same as Example 1, except that when eluting the target protein, 50 mM arginine was directly added to the elution buffer, and no dialysis step was performed. Figure 5 Compared with arginine dialysis after purification (arginine dialysis), adding arginine during protein purification (arginine purification) did not produce any protein precipitation under the same conditions as the former, and the width of the gel strip was the same, indicating that adding arginine after or during purification can effectively prevent protein precipitation, and there is no difference in the effects of the two.

[0097] Finally, it should be noted that the above embodiments of the present invention are only examples for illustrating the present invention, and are not intended to limit the implementation methods of the present invention. For those skilled in the art, other different forms of changes and modifications can be made based on the above description. It is impossible to list all implementation methods here. Any obvious changes or modifications derived from the technical solution of the present invention are still within the scope of protection of the present invention.

Claims

1. A method for separating and purifying bacterial ferritin from anaerobic ammonium-oxidizing bacteria, characterized in that: First KS The Bfr gene is amplified, cloned and expressed to obtain bacterial cells, which are then suspended with a lysis solution, ultrasonically lysed, centrifuged, and the supernatant is collected. Finally, the bacterial ferritin is obtained by separation and purification twice; KS The amino acid sequence encoded by the Bfr gene is shown in SEQ ID NO.1; The cloning and expression procedures are as follows: KS The Bfr gene was connected to the cloning vector pET-28a+ to obtain KS Bfr cloning plasmid; KS The Bfr clone plasmid was transferred into BL21 (DE3), then activated and cultured in LB medium containing kanamycin, and then transferred to fresh LB medium for amplification. When the OD600 value of the bacterial solution was 0.6-0.8, an inducer was added to the bacterial solution for induction culture, and finally the bacteria were collected. During the bacterial amplification culture, ferrous sulfate and heme were also added to the bacterial solution to increase KS The self-assembly ability of Bfr; The bacterial ferritin separation and purification comprises the following steps: S1 primary purification After mixing the gel and the supernatant, incubate on a shaker at 4°C for at least 1 h, then load into an empty column tube of an affinity chromatography column, and then sequentially use a washing buffer containing 100 mM, 200 mM, 400 mM, and 600 mM NaCl solutions for concentration gradient washing; then use the washing solution for at least 5 times, and then use the elution solution for elution to obtain a bacterial ferritin mixed solution; the gel is His-tag Purification Resin; the elution solution is configured as follows: 25-50 mM Tris-HCl buffer, pH 7.5-8.0, 25-100 mM NaCl, 20-500 mM imidazole, and a concentration of 25-50 mM arginine; S2 Secondary purification The bacterial ferritin purified once is dialyzed with a dialysis buffer containing arginine, and then the bacterial ferritin mixed solution is concentrated with an ultrafiltration tube, and finally separated with a molecular sieve chromatography column to obtain self-assembled spherical bacterial ferritin. The molecular sieve chromatography column buffer system is 50 mM NaH2PO4, 100 mM NaCl, pH 7.

6.

2. The method for separating and purifying bacterial ferritin of anaerobic ammonium-oxidizing bacteria according to claim 1, characterized in that: When amplified, KS The nucleotide sequence of the Bfr gene was used as a template, and PCR amplification was performed with primers 1 and 2. KS Bfr gene is Candidatus Kuenenia stuttgartiensis bacterial ferritin gene, KS The nucleotide sequence of the Bfr gene is shown in SEQ ID NO.2; The nucleotide sequences of primer 1 and primer 2 are shown in SEQ ID NO.3 and SEQ ID NO.4, respectively.

3. The method for separating and purifying bacterial ferritin of anaerobic ammonium-oxidizing bacteria according to claim 1, characterized in that: During bacterial amplification culture, the concentration of ferrous sulfate is 1~5 mM and the concentration of heme is 5~10 mM.

4. The method for separating and purifying bacterial ferritin of anaerobic ammonium-oxidizing bacteria according to claim 1, characterized in that: Lysis buffer configuration: pH 7.5~8.0 Tris-HCl buffer concentration is 25~100 mM, NaCl concentration is 25~150mM, Triton X-100 is 0.1%~0.5%, DTT is 2~5 mM, DNA hydrolase is 0~5 ug / mL, and protease inhibitor mixture is 5~10 μg / mL.

5. The method for separating and purifying bacterial ferritin of anaerobic ammonium-oxidizing bacteria according to claim 1, characterized in that: During ultrasonic lysis, the ultrasonic power was 420 W, input for 4 s, interval for 6 s, and a total of 20-30 min; during centrifugation, centrifugation was performed for 20-30 min at a speed of 10,000 rpm and a temperature of 4 °C; when the gel and supernatant were mixed, the volume ratio of the gel and the supernatant was 1:

4.

6. The method for separating and purifying bacterial ferritin of anaerobic ammonium-oxidizing bacteria according to claim 1, characterized in that: The washing solution is configured as follows: 25~50 mM Tris-HCl buffer, 25~100 mM NaCl, 0~5 mM imidazole, pH 7.5~8.0; when washing, the washing solution is used for at least 5 washes, and the amount of washing solution each time is half of the column volume.

Images