A method for rapid identification of pecan gene function based on TRV-VIGS technology and its application

Abstract

The present invention provides a method for rapidly identifying the gene function of thin-shelled pecan based on TRV-VIGS technology and its application, belonging to the field of forestry genetic engineering technology. The present invention uses the function of TRV1 to assist the diffusion of TRV2 to achieve the effect of silencing the target gene at the whole plant level. The method for rapidly identifying the gene function of thin-shelled pecan based on TRV-VIGS technology of the present invention has the significant advantages of low cost, low difficulty, short cycle, high throughput, convenient material collection, rapid identification of gene function, and silencing duration of up to 4 months, providing a powerful tool for large-scale research on the gene function of thin-shelled pecan.

Description

Technical Field

[0001] The invention belongs to the technical field of forestry genetic engineering, and in particular relates to a method for rapidly identifying the gene function of Carya sylvestris based on TRV-VIGS technology and an application thereof. Background Art

[0002] Virus-induced gene silencing (VIGS) is a type of post-transcriptional gene silencing (PTGS). VIGS is an RNA silencing technology developed based on the natural mechanism of plants to resist the invasion of exogenous nucleic acids. When a recombinant viral vector carrying a target gene is introduced into a host plant, it can induce the degradation of mRNA in the plant that is consistent with or highly homologous to the target gene. VIGS is one of the most effective technologies for verifying gene function using reverse genetics strategies. Compared with gene editing and transgenic methods, it has the advantages of simple operation, short time, low cost, and high throughput.

[0003] The artificially modified tobacco rattle virus (TRV) is currently the most widely used VIGS vector. Compared with other viral vectors, TRV vectors can effectively transmit silencing signals to the growth points of plants, and also have many advantages such as high silencing efficiency, good sustainability, and mild host plant virus symptoms. At present, TRV has been widely used in the VIGS system of herbaceous plants and has also been successfully applied in some woody plants.

[0004] At present, the genome of thin-shelled pecan has been published, and transcriptome sequencing data has also shown a blowout growth. However, due to the immaturity of the genetic transformation system of thin-shelled pecan, the research on its gene function lags far behind the development of gene mining technology. At present, there are two difficulties in using the TRV-VIGS system to study the gene function of thin-shelled pecan: first, it is difficult to inject TRV infection fluid into the plant; second, it is difficult to cause gene silencing after the injection of TRV infection fluid. The basic premise of using the VIGS system to study gene function is to be able to inject TRV infection fluid into the plant. Compared with other plants, the leaf surface of thin-shelled pecan is smooth and leathery, which makes it difficult to inject infection fluid into the body. In addition, whether the TRV-VIGS system works is closely related to the growth period of the seedling. Improper selection cannot cause target gene silencing. Therefore, this field urgently needs to establish a set of efficient, stable and reliable methods for rapid identification of gene function of thin-shelled pecan based on TRV-VIGS technology. Summary of the invention

[0005] In view of this, the object of the present invention is to provide an efficient, stable and reliable method for rapidly identifying the gene function of walnuts based on TRV-VIGS technology.

[0006] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0007] The present invention provides a method for rapidly identifying the gene function of Carya syringae based on TRV-VIGS technology, comprising the following steps:

[0008] (1) constructing a recombinant vector of pTRV2-target gene and pTRV2-indicator gene;

[0009] (2) The recombinant vectors of pTRV2-target gene and pTRV2-indicator gene, pTRV2 empty vector, and pTRV1 were transformed into Agrobacterium GV3101 to prepare four VIGS transformation bacterial solutions;

[0010] (3) The transformation bacterial solution containing pTRV1 was mixed with the transformation bacterial solutions containing pTRV2 empty vector, pTRV2-target gene, and pTRV2-indicator gene, respectively, and allowed to stand to obtain three infection solutions;

[0011] (4) Select thin-shelled pecan seedlings with 2 to 4 true leaves and no compound leaves, and inject the above three infection solutions into the back of 1 to 3 true leaves at the base of the seedlings, respectively. After the leaves of the indicator plants undergo photobleaching, use the empty-load plants as a control and conduct functional analysis on the target plants.

[0012] Preferably, step (1) comprises the following steps: extracting total RNA from walnuts, reverse transcribing to obtain cDNA, designing primers to amplify the target gene and indicator gene CDS sequences, connecting the amplified products to a T vector, and transferring them into Escherichia coli to obtain a recombinant plasmid with the target gene and indicator gene CDS fragments; after double enzyme digestion of the pTRV2 plasmid, recovering the linearized plasmid; designing specific primers to add recombination sites to the target gene and indicator gene, and using the recombinant plasmid as a template, amplifying the target gene and indicator gene pTRV2 recombinant fragments; connecting the recombinant fragments and the linearized plasmid with a recombinase to construct a recombinant plasmid, transforming Escherichia coli, selecting positive clones, and obtaining pTRV2-target gene and pTRV2-indicator gene recombinant plasmids.

[0013] Preferably, the indicator gene is the ChlH gene, and the CDS sequence of the ChlH gene is shown as SEQ ID NO.1; the primers for amplifying the CDS sequence of the ChlH gene are shown as SEQ ID NO.2 and SEQ ID NO.3.

[0014] Preferably, the specific primers for adding the recombination site of the indicator gene are shown as SEQ ID NO.4 and SEQ ID NO.5.

[0015] Preferably, the target gene includes the Carya vegetabilis PAL gene, and the function of the PAL gene is to regulate the synthesis of plant phenolic substances.

[0016] Preferably, the volume ratio of mixing in step (3) is 1:1.

[0017] Preferably, the walnut seedlings in step (4) are cultured according to the following method: the seeds are soaked in clean water, germinated at high temperature, and when the seeds grow radicles, they are transferred to nutrient pots and cultured at 24°C, 12h day / 12h night, and 600 μmol·m -2 ·s -1 When the seedlings grew two true leaves, the temperature was adjusted to 22°C and the light intensity was 150 μmol·m -2 ·s -1 After culturing for 2 days, the temperature and light intensity were restored to 24°C and 600 μmol·m -2 ·s -1 .

[0018] Preferably, in step (4), after the infection solution is injected into the back of 1 to 3 true leaves at the base of the seedling, the specific method of cultivation is: after dark cultivation of the injected thin-shelled pecans for 2 days, placing them in a light incubator for further cultivation, and watering them with 1 / 2 times Hoagland's nutrient solution during the seedling cultivation period.

[0019] Preferably, the temperature of the dark culture is 20°C; the conditions for continued culture are 24°C for 12 hours during the day / 16°C for 12 hours at night, and a light intensity of 600 μmol·m -2 ·s -1 , humidity 70%.

[0020] The present invention also provides an application of the method in improving the yield and / or quality of thin-shell pecans.

[0021] Beneficial effects of the present invention:

[0022] The present invention uses the function of TRV1 to assist the spread of TRV2 to achieve the effect of silencing the target gene at the whole plant level. The method of the present invention has the significant advantages of low cost, low difficulty, short cycle, high throughput, convenient material collection, rapid identification of gene function, and silencing duration of up to 4 months, providing a powerful tool for large-scale research on the gene function of walnut. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 is a diagram of the dynamic changes in the phenotype of the indicator plant after infection provided in Example 1 of the present invention, wherein: Figure 1 A is the phenotype of the plant 1 week after infection; Figure 1 B is the phenotype of the plant 2 weeks after infection; Figure 1 C is the plant phenotype 3 weeks after infection; Figure 1 D is the phenotype of plants 4 weeks after infection; Figure 1 E is the phenotype of plants 16 weeks after infection; Figure 1 F is the phenotype of plants 32 weeks after infection.

[0024] Figure 2 is a phenotypic diagram of an empty plant, an indicator plant, and a target plant provided in Example 1 of the present invention, wherein: Figure 2 A is an empty plant; Figure 2 B is the indicator plant; Figure 2 C is a PAL silenced plant.

[0025] Figure 3 This is a diagram of gene expression detection and total phenol content detection provided in Example 1 of the present invention, wherein: Figure 3 A is a graph showing the relative expression of ChlH; Figure 3 B is a graph of the relative expression of PAL; Figure 3 C is the total phenol content detection chart. DETAILED DESCRIPTION

[0026] The present invention provides a method for rapidly identifying the gene function of Carya syringae based on TRV-VIGS technology, comprising the following steps:

[0027] (1) constructing a recombinant vector of pTRV2-target gene and pTRV2-indicator gene;

[0028] (2) The recombinant vectors of pTRV2-target gene and pTRV2-indicator gene, pTRV2 empty vector, and pTRV1 were transformed into Agrobacterium GV3101 to prepare four VIGS transformation bacterial solutions;

[0029] (3) The transformation bacterial solution containing pTRV1 was mixed with the transformation bacterial solutions containing pTRV2 empty vector, pTRV2-target gene, and pTRV2-indicator gene, respectively, and allowed to stand to obtain three infection solutions;

[0030] (4) Select thin-shelled pecan seedlings with 2 to 4 true leaves and no compound leaves, and inject the above three infection solutions into the back of 1 to 3 true leaves at the base of the seedlings, respectively. After the leaves of the indicator plants undergo photobleaching, use the empty-load plants as a control and conduct functional analysis on the target plants.

[0031] In the present invention, step (1) preferably includes the following steps: extracting total RNA from walnuts, reverse transcribing to obtain cDNA, designing primers for amplifying the CDS sequences of the target gene and the indicator gene, connecting the amplified products to a T vector, and transferring them into Escherichia coli to obtain a recombinant plasmid with the target gene and the indicator gene CDS fragments; after double enzyme digestion of the pTRV2 plasmid, recovering the linearized plasmid; designing specific primers for adding recombination sites to the target gene and the indicator gene, and using the recombinant plasmid as a template to amplify the target gene and the indicator gene pTRV2 recombinant fragments; connecting the recombinant fragments and the linearized plasmid by a recombinase, constructing a recombinant plasmid, transforming Escherichia coli, selecting positive clones, and obtaining pTRV2-target gene and pTRV2-indicator gene recombinant plasmids.

[0032] The present invention has no special restrictions on the specific extraction method of total RNA of Carya calathea and the specific method of reverse transcription. In the present invention, the indicator gene is preferably the ChlH gene, and the CDS sequence of the ChlH gene is shown in SEQ ID NO.1; the primers for amplifying the CDS sequence of the ChlH gene are preferably shown in SEQ ID NO.2 and SEQ ID NO.3; the specific primers for adding recombination sites of the indicator gene are preferably shown in SEQ ID NO.4 and SEQ ID NO.5; preferably, the recombinant fragments of the target gene and the indicator gene pTRV2 are both about 300bp in size. In the present invention, the target gene preferably includes the PAL gene of Carya calathea, and the CDS sequence of the PAL gene is shown in SEQ ID NO.6; the function of the PAL gene is to regulate the synthesis of plant phenolic substances. In the present invention, the Escherichia coli is preferably Escherichia coli DH5α. The double enzyme digestion of the pTRV2 plasmid is preferably double enzyme digestion with BamHI and SacI. The present invention has no special restrictions on the specific PCR procedure and PCR reaction system for amplification.

[0033] In step (2) of the present invention, after the recombinant vectors of pTRV2-target gene and pTRV2-indicator gene, pTRV2 empty vector, and pTRV1 are transformed into Agrobacterium GV3101 respectively, four VIGS transformation bacterial solutions are preferably prepared using a suspension. The suspension is preferably prepared by adding 10mM MgCl2, 200μM AS, and 10mM MES to sterile water as the mother liquid. The concentration of the VIGS transformation bacterial solution is preferably OD 600 =0.7.

[0034] In step (3) of the present invention, the transformation bacterial solution containing pTRV1 is mixed with pTRV2 empty load, pTRV2-target gene, and pTRV2-indicator gene transformation bacterial solutions in a volume ratio of preferably 1:1, and the standing is preferably at room temperature and away from light for 3 hours to obtain three infection solutions.

[0035] In step (4) of the present invention, the thin-shelled pecan seedlings are preferably cultured according to the following method: the seeds are soaked in clean water, germinated at high temperature, and when the seeds grow radicles, they are transferred to nutrient pots and cultured at 24°C, 12h day / 12h night, and 600 μmol·m -2 ·s -1 When the seedlings grew two true leaves, the temperature was adjusted to 22°C and the light intensity was 150 μmol·m -2 ·s -1 After culturing for 2 days, the temperature and light intensity were restored to 24°C and 600 μmol·m -2 ·s -1 . In the present invention, the number of days for soaking in clean water is preferably 5 days, the temperature for germination is preferably 30°C, and the substrate used for germination is preferably perlite. After the infection solution in step (4) is injected into the back of 1 to 3 true leaves at the base of the seedlings, the specific method of cultivation is preferably: after dark culturing of the injected thin-shelled pecans for 2 days, place them in a light incubator for continued cultivation, and irrigate with 1 / 2 times Hoagland nutrient solution during seedling cultivation. The temperature of dark cultivation is preferably 20°C; the conditions for continued cultivation are preferably 24°C 12h day / 16°C 12h night, and a light intensity of 600μmol·m -2 ·s -1 , humidity 70%. In the present invention, the variety of the thin-shell pecan is preferably 'Boni' or 'Shaoxing' variety.

[0036] In thin-shelled pecans, it is difficult to grasp the best time to inject seedlings. When thin-shelled pecan seedlings with too early growth period are selected, the infection solution is difficult to inject and spread in the leaves; if it is too late, the plant has strong disease resistance and TRV is difficult to infect host cells. The method provided by the present invention can cultivate seedlings that can be injected with TRV infection solution, and clarifies the best time for seedling injection, making it feasible to use the TRV-VIGS system to study the gene function of thin-shelled pecans.

[0037] The present invention also provides an application of the method in improving the yield and / or quality of thin-shell pecans.

[0038] The technical solutions provided by the present invention are described in detail below in conjunction with the embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0039] The experimental methods used in the following examples include RNA extraction and reverse transcription, PCR amplification, vector construction, etc., which are conventional methods unless otherwise specified.

[0040] Unless otherwise specified, the materials and reagents used in the following examples can be obtained from commercial sources.

[0041] Example 1

[0042] The method for identifying the function of the phenylalanine ammonia lyase (PAL) gene of pecan using TRV-VIGS technology is as follows:

[0043] 1. Cultivation of experimental materials

[0044] Seeds of the 'Boni' variety of Hickory were soaked in water for 5 days and then germinated at 30°C. The germination substrate was perlite. When the seeds grew radicles, they were transferred to nutrient pots and placed in an artificial climate chamber. The conditions were: temperature 24°C, 12h day / 12h night, light 600μmol·m -2 ·s -1 When the seedlings grew two true leaves, the temperature was adjusted to 22°C and the light intensity was 150 μmol·m -2 ·s -1 After culturing for 2 days, the temperature and light intensity were restored to 24°C and 600 μmol·m -2 ·s -1 .

[0045] 2. Construction of TRV2 recombinant vector containing target gene (PAL) and indicator gene (ChlH)

[0046] (1) RNA extraction and first-chain cDNA synthesis

[0047] Leaves of the 'Pony' variety of Hickory nut were used as materials for RNA extraction. RNA extraction was performed according to the instructions of the BioTeke Universal Plant Total RNA Extraction Kit (spin column type). The first-strand cDNA synthesis was performed according to the instructions of PrimeScript RTase from Takara Biotechnology Co., Ltd. (TAKARA). The obtained cDNA was diluted 10 times and stored at -20°C for later use.

[0048] (2) Amplification of PAL and ChlH gene fragments

[0049] PAL and ChlH gene members were extracted from the genome database of Carya sylvestris. Based on the transcriptome expression data, the PAL members potentially related to the synthesis of phenolic substances and the ChlH members related to leaf yellowing were determined, and used as mRNA templates to design primers using Primer5 software. The upstream primer PAL-F1 for amplification of the PAL CDS sequence was: TTCAGAGCCCAAACAAGACC (SEQ ID No.7), and the downstream primer PAL-R1 was: CTCCTCCAAATGCCTCAGATC (SEQ ID No.8). The PCR product size was 563 bp, and the sequence was shown in SEQ ID No.6; the upstream primer ChlH-F1 for amplification of the ChlH CDS sequence was: GGAAGTGTTTGAAGCTTGTTGTG (SEQ ID No.2); the downstream primer ChlH-R1 was: TAGCTTGTTCTAGTGCGTGCTTC (SEQ ID No.3), and the PCR product size was 554 bp, and the sequence was shown in SEQ ID No.1. Using cDNA as a template, 2× PrimeStarMax enzyme was used to clone the target fragment and amplify it using a 25μl system. The amplification program was as follows: 94℃ pre-denaturation for 5min; 94℃ denaturation for 35s, 55℃ annealing for 35s, 72℃ extension for 40s, 32 cycles; 72℃ extension for 10min after the cycle. The PCR product was detected by electrophoresis and gel recovery was performed. The recovered product was connected to the blunt-end T vector, transferred into Escherichia coli DH5α, coated on LB plate culture medium containing 25mg / L ampicillin antibiotics, inverted and cultured at 37℃ for 12h, and monoclonal plaques were picked to 1ml liquid LB containing 25mg / L ampicillin antibiotics at 37℃, 200r / min shaking culture for 12h. The positive clones were screened by bacterial liquid PCR, and after sequencing verification, the recombinant plasmid with PAL and ChlH CDS fragments was obtained.

[0050] (3) Construction of recombinant vector

[0051] The pTRV2 plasmid was double-digested with BamHI and SacI, and the linear plasmid was recovered from the gel and stored at -20℃ for future use. According to the principle that the amplified product is about 300bp, specific primers for adding recombination sites were designed for PCR amplification. The PCR amplification system (25μl in total) was: 12.5μL of 2×PrimeSTARMAX Premix, 1μL of 10μM upstream primer, 1μL of 10μM downstream primer, 1μL of 50ng / μL template, and 9.5μL of ddH2O. The PCR amplification program was as follows: 94℃ pre-denaturation for 5min; 94℃ denaturation for 30s, 55℃ annealing for 30s, 72℃ extension for 30s, for a total of 32 cycles; 72℃ final extension for 3min. The upstream primer PAL-F2 for PAL recombination site addition is: AGGCCTCCATGGGGATCCCGAGGAATAAGGCCCTGC (SEQ ID No. 9); the downstream primer PAL-R2 is: CTCGAGACGCGTGAGCTCCAATATGTCCACGGCTTC (SEQ ID No. 10), and the PCR product size is 392 bp; the upstream primer ChlH-F2 for ChlH recombination site addition is: AGGCCTCCATGGGGATCCACAGAAGAATGAAAATG (SEQ ID No. 4); the downstream primer ChlH-R2 is: CTCGAGACGCGTGAGCTCTCAAGGAGATTCATCTG (SEQ ID No. 5), and the PCR product size is 297 bp. Using the recombinant plasmid with PAL and ChlH CDS fragments in step (2) as a template, the PAL and ChlH gene pTRV2 recombinant fragments were amplified respectively. The PCR amplification product was recovered by gel, and the PCR amplification product and the linear pTRV2 plasmid were connected using the SoSoo recombinase of Qingke Biotechnology. The product was spread on LB plate culture medium containing 50 mg / L kanamycin antibiotics, inverted and cultured at 37°C for 12 to 24 hours, and monoclonal plaques were picked and placed in 1 ml of liquid LB containing 50 mg / L kanamycin antibiotics and cultured at 37°C, 200r / min for 12 hours. The positive clones were screened by bacterial liquid PCR, and the recombinant vectors of pTRV2-PAL and pTRV2-ChlH were obtained after sequencing verification. The plasmid was extracted and stored at -20°C for future use.

[0052] 3. Preparation of VIGS conversion solution

[0053] The pTRV1, pTRV2, pTRV2-PAL and pTRV2-ChlH vectors were transformed into Agrobacterium GV3101 by freeze-thaw method, and spread on LB plate medium containing 50 mg / L kanamycin and 50 mg / L rifampicin antibiotics, and inverted cultured at 28°C for 24-36 hours. After the monoclonal plaques grow, the single clone is picked into 1 ml of liquid LB containing 50 mg / L kanamycin + 50 mg / L rifampicin antibiotics, and cultured at 28°C, 200 r / min shaking for 24 hours. The bacterial liquid was identified by PCR, and Agrobacterium positive strains containing pTRV1, pTRV2, pTRV2-PAL and pTRV2-ChlH plasmids were obtained respectively. The cells were transferred into induction LB medium (50 mg / L kanamycin + 50 mg / L rifampicin + 10 mM morpholineethanesulfonic acid + 20 μM acetosyringone) at a volume ratio of 1:50 and induced for 24 to 48 h.

[0054] After induction, centrifuge at 6000r / min for 15min to collect the cells. Use sterile water as the mother solution, add 200μM acetosyringone, 10mM magnesium chloride, and 10mM morpholineethanesulfonic acid to prepare the suspension, resuspend the cells, and adjust the OD 600 =0.7, and the VIGS transformation bacterial solution was obtained.

[0055] 4. Infection and cultivation of pecan seedlings

[0056] The pTRV1 transformation solution was mixed with the pTRV2, pTRV2-PAL, and pTRV2-ChlH transformation solutions at a volume ratio of 1:1 (i.e., the pTRV1 transformation solution was mixed with the pTRV2 transformation solution at a volume ratio of 1:1, the pTRV1 transformation solution was mixed with the pTRV2-PAL transformation solution at a volume ratio of 1:1, and the pTRV1 transformation solution was mixed with the pTRV2-ChlH transformation solution at a volume ratio of 1:1), and allowed to stand at room temperature in the dark for 3 hours. Select thin-shelled pecan seedlings with 2 to 4 true leaves and no compound leaves, use a syringe without a needle to draw an appropriate amount of the mixed transformation solution, and inject the infection solution into the back of 1 to 3 true leaves at the base of the seedlings. After culturing at 20℃ in the dark for 2 days, transfer to a light incubator for continued cultivation under the conditions of 24℃ for 12h day / 16℃ for 12h night, and a light intensity of 600μmol·m -2 ·s -1 , humidity 70%, watering with 1 / 2 times Hoagland nutrient solution during seedling cultivation.

[0057] 5. Gene function analysis

[0058] One week after infection of the indicator plant, immature leaves began to show photobleaching ( Figure 1 A), 2 to 3 weeks after infection, the photobleaching area gradually expanded, and wrinkles appeared on the leaf surface ( Figure 1 B and Figure 1 C). By 4 weeks after infection, the photobleaching of the indicator plants continued to intensify and the leaves began to droop ( Figure 1 D). At 16 weeks of infection, the degree of photobleaching had not decreased ( Figure 1 E). It can be seen that the method of the present invention can make gene silencing last for up to 4 months. Since then, the degree of photobleaching has decreased. By the 32nd week of infection, the degree of photobleaching has decreased by about 20% ( Figure 1 F) Select pTRV2, pTRV2-PAL and pTRV2-ChlH infected plants with wrinkled and drooping leaves 4 weeks after infection ( Figure 2 ), and RNA was extracted from immature leaves and reverse transcribed into cDNA. With PR26S and PP1 as internal references, fluorescent quantitative qPCR gene expression detection primers were set, PAL gene detection primers were PAL-qPCR-F: CCTGGGTTTGATTTCCTC (SEQ ID No.11) and PAL-qPCR-R: TGACTGACTGTGTTCTTGA (SEQ ID No.12); ChlH gene detection primers were ChlH-qPCR-F: TGGTATGAAGGAATGATG (SEQ ID No.13) and ChlH-qPCR-R: AGGAATTTGGATTTGTCT (SEQ ID No.14); PR26S gene detection primers were PR26S-F: CCCGAAGATGATTTGAAG (SEQ ID No.15) and PR26S-R: CCTTAATGCCACATAGAT (SEQ ID No.16); PP1 gene detection primer was PP1-F: TCAAGATTTGCGGTGATAT (SEQ ID No.17). No.17) and PP1-R: TTCCACGATCCACATAGT (SEQ ID No.18). Fluorescence quantitative qPCR was used to detect whether ChlH and PAL genes were silenced. The qPCR amplification system (20 μl in total) was: 10 μL of 2×SYBR Premix Ex Taq TM , 0.4μL 10μM upstream primer, 0.4μL 10μM downstream primer, 2μL 200ng / μL cDNA, 0.4μL ROX Reference Dye II, 6.8μL ddH2O. The PCR amplification procedure is as follows: 95℃ pre-denaturation for 3min; 95℃ denaturation for 10s, 60℃ annealing for 30s, a total of 32 cycles. The results showed that the expression of ChlH in the indicator plant and PAL in the plant infected with pTRV2-PAL decreased by 40% and 44%, respectively, and the degree of decrease was more than 1.5 times ( Figure 3 A and Figure 3 B).

[0059] Use the Solebow plant total phenol content detection kit to determine the phenol content. Refer to the instructions for specific operations. First, dry the leaves in a 60°C oven to constant weight. After passing through a 30-mesh sieve, weigh about 0.1g, add 2.5mL of extract, and extract by ultrasonic extraction. The ultrasonic power is 300W, the temperature is 60°C, and the extraction is 30min. Then centrifuge at 12000rpm, 25°C for 10min, take the supernatant, and dilute to 2.5mL with the extract for testing. Taking gallic acid as the standard solution, dilute the 5mg / mL gallic acid standard solution with distilled water to 0.15625, 0.078125, 0.039, 0.02, 0.01, 0.005, and 0.0025mg / mL. The detection operation is shown in Table 1 below:

[0060] Table 1 Specific operation method for determining phenol content

[0061]

[0062] Standard curve drawing: According to the concentration of the standard tube (y, mg / mL) and the absorbance ΔA standard (x, ΔA standard), a standard curve is established. According to the standard curve, ΔA determination (x, ΔA determination) is substituted into the formula to calculate the sample concentration (y, mg / mL). Calculation of total plant phenol content: Total phenol content (mg / g mass) = y×V extraction ÷ W = 2.5y ÷ W. In the formula, V is the volume of the extract, i.e. 2.5 ml; W is the sample weight, g.

[0063] The results showed that the phenol content in plants infected with pTRV2-PAL decreased by 38% compared with that in plants infected with pTRV2 ( Figure 3 C), indicating that the PAL gene is involved in the synthesis of phenolic substances in Carya syringae.

[0064] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A method for silencing the PAL gene of Carya syringae based on TRV-VIGS technology, characterized in that: The steps include: (1) constructing a recombinant vector of pTRV2-target gene and pTRV2-indicator gene; (2) The recombinant vectors of pTRV2-target gene and pTRV2-indicator gene, pTRV2 empty vector, and pTRV1 were transformed into Agrobacterium GV3101 to prepare four VIGS transformation bacterial solutions; (3) The transformation bacterial solution containing pTRV1 was mixed with the transformation bacterial solutions containing pTRV2 empty vector, pTRV2-target gene, and pTRV2-indicator gene, respectively, and allowed to stand to obtain three infection solutions; (4) Select thin-shelled pecan seedlings with 2 to 4 true leaves and no compound leaves, inject the above three infection solutions into the back of 1 to 3 true leaves at the base of the seedlings, culture, and after the leaves of the indicator plants are photobleached, use the empty-loaded plants as controls to perform functional analysis on the target plants; The indicator gene is a CDS fragment of the ChlH gene, and the CDS sequence of the ChlH gene is shown in SEQ ID NO.1; the primers for amplifying the CDS sequence of the ChlH gene are shown in SEQ ID NO.2 and SEQ ID NO.3; The target gene is a CDS fragment of the PAL gene, and the CDS sequence of the PAL gene is shown in SEQ ID NO.

6.

2. The method according to claim 1, characterized in that Step (1) comprises the following steps: extracting total RNA of Carya sylvestris, reverse transcribing to obtain cDNA, designing primers to amplify the CDS sequences of the target gene and the indicator gene, connecting the amplified product to a T vector, and transferring it into Escherichia coli to obtain a recombinant plasmid 1 connected with the CDS fragments of the target gene and the indicator gene; after double restriction digestion of the pTRV2 plasmid, recovering the linearized plasmid; designing specific primers for adding recombination sites to the target gene and the indicator gene, and using the recombinant plasmid 1 as a template to amplify the target gene pTRV2 recombinant fragment and the indicator gene pTRV2 recombinant fragment; The target gene pTRV2 recombinant fragment and the indicator gene pTRV2 recombinant fragment were connected to the linearized plasmid respectively by recombinase to construct pTRV2-target gene recombinant plasmid and pTRV2-indicator gene recombinant plasmid, transformed Escherichia coli, selected positive clones, and obtained pTRV2-target gene recombinant plasmid and pTRV2-indicator gene recombinant plasmid.

3. The method according to claim 2, characterized in that The specific primers for adding recombination sites of the indicator gene are shown in SEQ ID NO.4 and SEQ ID NO.

5.

4. The method according to claim 1, characterized in that: The volume ratio of mixing in step (3) is 1:

1.

5. The method according to claim 1, characterized in that The thin-shelled pecan seedlings in step (4) are cultured according to the following method: the seeds are soaked in clean water, germinated at high temperature, and when the seeds grow radicles, they are transferred to nutrient pots and cultured at 24°C, 12h day / 12h night, and 600μmol·m -2 ·s -1 When the seedlings grew two true leaves, the temperature was adjusted to 22°C and the light intensity was 150 μmol·m -2 ·s -1 After culturing for 2 days, the temperature and light intensity were restored to 24°C and 600 μmol·m -2 ·s -1 .

6. The method according to claim 1, characterized in that After the infection solution in step (4) is injected into the back of 1 to 3 true leaves at the base of the seedlings, the specific method of cultivation is as follows: after dark cultivation of the injected thin-shelled pecans for 2 days, the pecans are placed in a light incubator for further cultivation, and irrigated with 1 / 2 times Hoagland nutrient solution during the seedling cultivation period.

7. The method according to claim 6, characterized in that The dark culture temperature was 20°C; the conditions for continued culture were 24°C for 12 h day / 16°C for 12 h night, and a light intensity of 600 μmol·m -2 ·s -1 , humidity 70%.

Images