Rhynchium paraceum whole genome CRISPR / Cas9 knockout plasmid library as well as construction and application of whole genome CRISPR / Cas9 knockout plasmid library

Abstract

The invention discloses an efficient, simple and convenient whole genome CRISPR / Cas9 knockout plasmid library for erencigia parviflora as well as construction and application of the whole genome CRISPR / Cas9 knockout plasmid library, and belongs to the technical field of biology. On the basis of the Eriphaga parviflora T2T genome sequence, a bioinformatics tool is utilized to accurately predict a knockout target spot, double sgRNA is designed to improve the knockout accuracy and efficiency, and meanwhile, the off-target risk is reduced; the method comprises the following steps: synthesizing a double sgRNA-pool chip, amplifying, recovering, connecting a carrier, transforming and the like, so that the phytoneum parvum CRISPR-Cas9 knockout plasmid library which is simple and convenient to operate and high in throughput is successfully constructed. In the double sgRNA design process, advanced tools are adopted to improve the prediction accuracy; after the library is constructed, a strict quality inspection step is also included, so that the library quality is ensured. The invention not only provides a new way for the gene editing of the erencephalium leptosphaerium, but also provides reference for the gene editing of other multi-copy and high-repetitive-sequence biological genes, has obvious effects in solving the off-target problem and improving the editing efficiency and accuracy, and has important scientific significance and application value for the research of functional genomics.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and specifically relates to a Physcomitrella patens whole-genome CRISPR / Cas9 knockout plasmid library and a construction and application thereof. Background Art

[0002] In plant genomics research and breeding programs, mutation is increasingly important as the core driving force for genetic improvement and new variety breeding. Traditional mutagenesis methods treat plant materials through physical means (such as ultraviolet rays, X-rays and gamma radiation, etc.) and chemical mutagens (such as ethyl methanesulfonate EMS, sodium azide, etc.) to induce DNA damage and subsequent mutations. Biological mutagenesis methods, especially Agrobacterium-mediated transfer DNA (T-DNA) insertion technology and gene silencing technology, also provide powerful tools for expanding the plant genetic mutation library. Although these traditional methods have enriched the genetic mutation library to a certain extent, they have limitations such as random and unpredictable mutagenesis process and difficulty in obtaining specific types of mutations.

[0003] With the rapid development of gene editing technology, the CRISPR / Cas9 system has shown great potential in the field of plant gene function analysis and crop genetic improvement due to its precise, efficient and flexible characteristics. However, the application of the CRISPR / Cas9 system in specific model plants such as Physcomitrella patens faces many challenges. Physcomitrella patens is an important model plant for plant gene function and evolution, and is also one of the most important chassis plants in synthetic biology. Although Physcomitrella patens has the advantages of simple structure, short growth cycle, and strong homologous recombination ability, its genes are mostly multi-copy, and there are a large number of repeated or similar sequences in the gene sequence, which makes it very easy to cause off-target phenomena during gene editing, increasing the difficulty of sgRNA design and selection. Therefore, the design of a whole-genome CRISPR / Cas9 knockout plasmid library for Physcomitrella patens has become a technical problem that needs to be solved urgently. At present, although a variety of gene editing technologies have been tried in Physcomitrella patens, they are often time-consuming and inefficient, making it difficult to achieve large-scale, high-throughput gene editing. This limits the research progress of Physcomitrella patens in the fields of functional genomics and biotechnology applications. It can be seen that developing a technology that can overcome the off-target problem of gene editing in Physcomitrella patens and achieve efficient and accurate whole-genome CRISPR / Cas9 knockout plasmid library design is of great significance for promoting the application of Physcomitrella patens in plant genomics research and breeding programs. Summary of the invention

[0004] In view of the off-target problems caused by multiple gene copies and high sequence repetitiveness in gene editing of Physcomitrella patens, the existing gene editing technology is time-consuming, inefficient, and difficult to achieve large-scale high-throughput editing in Physcomitrella patens. The present invention aims to provide a whole-genome CRISPR / Cas9 knockout plasmid library of Physcomitrella patens and its construction and application.

[0005] In order to achieve the above object, the present invention adopts the following technical solutions: The present invention provides a method for constructing a Physcomitrella patens whole-genome CRISPR-Cas9 knockout plasmid library, comprising: S1, based on the genome sequence information of Physcomitrella patens T2T, double sgRNA was designed and synthesized; S2, add adapters to both ends of the dual sgRNA sequence to synthesize the dual sgRNA-pool chip; S3, amplifying the synthesized dual sgRNA-pool chip, recovering the amplified product, and obtaining the library amplification product; S4, connecting the library amplification product using a linearized CRISPR-Cas9 library vector, transforming into competent cells, and extracting to obtain an intermediate plasmid; S5, the intermediate plasmid and scaffold-ppU6 fragment were connected using ligase, transformed into competent cells again, and the plasmid was extracted to obtain the whole genome CRISPR-Cas9 dual sgRNA library of Physcomitrella patens.

[0006] In S1, the design of dual sgRNA includes: based on the genome gene sequence of Physcomitrella patens T2T, using bioinformatics tools to predict knockout efficiency and predict CRISPR-Cas9 knockout targets; screening the predicted CRISPR-Cas9 knockout targets; and designing corresponding dual sgRNAs based on the screened CRISPR-Cas9 knockout targets.

[0007] The bioinformatics tools are Rule Set 2 and AI-derived models of the bioinformatics website CRISPOR; the CRISPR-Cas9 knockout target is located in the coding region close to the gene promoter, with a GC content of 20% to 80% and a Tm value of 50 to 72°C.

[0008] In S1, the sequence of the dual sgRNA is shown as SEQ ID NO.1.

[0009] In S2, the sequence of the dual sgRNA-pool chip is shown as SEQ ID NO.2, and the sequences of the adapters at both ends are shown as SEQ ID NO.3-SEQ ID NO.4.

[0010] In S3, the primer sequences used for the dual sgRNA-pool chip amplification are shown in SEQ ID NO.5-SEQ ID NO.6.

[0011] Furthermore, the ligase is T4 ligase, and the competent cells are Stable electroporation competent cells.

[0012] The method also includes a quality control step of the dual sgRNA library.

[0013] Furthermore, the quality inspection includes: PCR amplification, Illumina sequencing and sequencing result analysis.

[0014] Furthermore, the PCR amplification uses the dual sgRNA library as a template, and the designed primer sequences are shown in SEQ ID NO.7 and SEQ ID NO.8.

[0015] The present invention provides a double sgRNA for constructing a whole-genome CRISPR-Cas9 knockout plasmid library of Physcomitrella patens. The double sgRNA is constructed by the above-mentioned construction method, and the sequence of the double sgRNA is shown in SEQ ID NO.1.

[0016] The present invention provides a double sgRNA-pool chip for constructing a whole-genome CRISPR-Cas9 knockout plasmid library of Physcomitrella patens. The double sgRNA-pool chip is based on the double sgRNA, and is obtained by adding adapters at both ends of the double sgRNA sequence. The sequence of the double sgRNA-pool chip is shown in SEQ ID NO.2, and the adapter sequences at both ends are shown in SEQ ID NO.3-SEQ ID NO.4.

[0017] The present invention provides a dual sgRNA library of CRISPR-Cas9 of the whole genome of Physcomitrella patens, wherein the dual sgRNA library is obtained based on the dual sgRNA-pool chip.

[0018] The present invention provides the use of the above-mentioned Physcomitrella patens whole-genome CRISPR-Cas9 sgRNA library in gene editing and screening of functional genes and / or related effect genes.

[0019] The method includes: constructing a CRISPR-Cas9 system containing Cas9 protein and sgRNA coding sequences; designing the above-mentioned Physcomitrella whole-genome CRISPR-Cas9 sgRNA library; transforming and introducing the constructed CRISPR-Cas9 system and the Physcomitrella whole-genome CRISPR-Cas9 sgRNA library into Physcomitrella cells; PCR amplification and sequencing identification, phenotypic observation, and analysis of the function and role of genes in organisms.

[0020] Compared with the prior art, the present invention has the following beneficial effects: The method for constructing a whole genome CRISPR / Cas9 knockout plasmid library of Physcomitrella patens provided by the present invention is simple and efficient in library construction process, reduces experimental difficulty and cost, and is conducive to wide application in scientific research and production. Based on the gene sequence information of Physcomitrella patens T2T genome, the knockout efficiency is predicted by bioinformatics tools, and CRISPR-Cas9 knockout targets are screened. According to the screened targets, corresponding double sgRNAs are designed. This design strategy improves the accuracy and efficiency of knockout and reduces the risk of off-target; through the steps of synthesizing double sgRNA-pool chips, amplification, recovery, connecting CRISPR-Cas9 library vectors, and transforming to Stable electroporation competent cells, a whole genome CRISPR-Cas9 knockout plasmid library of Physcomitrella patens is constructed. The process is simple and efficient, and can achieve large-scale high-throughput editing; the present invention not only provides a new method for gene editing of Physcomitrella patens, but also provides ideas and references for other biological gene editing of multi-copy and high-repetitive sequences, and has important scientific research value and application prospects.

[0021] Furthermore, in the dual-sgRNA design process, advanced tools such as Rule Set 2 and AI-derived models from the bioinformatics website CRISPOR were used to improve the accuracy and reliability of target prediction. After the library was constructed, a quality inspection step for the dual-sgRNA plasmid library was also included to ensure the quality and reliability of the library, providing strong support for subsequent gene editing experiments.

[0022] The whole-genome CRISPR-Cas9 sgRNA library of Physcomitrella patens constructed by the present invention has a library coverage of up to 99.96%, that is, most sgRNAs are successfully amplified and sequenced. At the same time, the library uniformity is also qualified, indicating that the distribution of sgRNA in the library is relatively uniform, without obvious deviation or enrichment. These advantages help to ensure that in subsequent gene editing experiments, efficient and accurate editing of target genes can be performed, large-scale high-throughput editing can be achieved, and a powerful tool for functional genomics research is provided.

[0023] The application provided by the present invention uses the whole genome CRISPR-Cas9 sgRNA library of Physcomitrella patens to achieve high-throughput gene editing and screening. The method can quickly and accurately identify functional genes and / or related genes that affect specific phenotypes; the integration of sgRNA and the accuracy of CRISPR / Cas9 knockout events are verified by PCR amplification and sequencing identification, ensuring the accuracy and reliability of gene editing; comprehensive phenotypic observations are carried out on the knockout plants, covering multiple aspects such as morphology, development and adversity response, which helps to more deeply understand the function and mechanism of action of the knockout genes. The application of the present invention provides new research tools and methods for the field of synthetic biology. By accurately editing and screening genes, the analysis and utilization of the gene functions of Physcomitrella patens can be accelerated. As a model plant, the breakthrough of its gene editing and screening technology helps to promote agricultural and biotechnology applications in related fields. The whole genome CRISPR-Cas9sgRNA library of Physcomitrella patens has shown significant technical advantages and broad application prospects in gene editing and screening of functional genes and / or related genes. The application of this technology not only helps to deeply analyze the functions and mechanisms of genes, but also provides strong support for the development of fields such as synthetic biology, agriculture and biotechnology. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 The invention provides a design of a Physcomitrella patens double sgRNA plasmid library; Figure 2 This is a spectrum of the Physcomitrella patens double sgRNA vector of the present invention; Figure 3 This is a bar graph of the sgRNA sequencing depth of the present invention; Figure 4 It is the slope diagram of sgRNA uniformity of the present invention; Figure 5 The present invention is a flow chart for the transformation, screening and identification of the mutant library of the Physcomitrella patens Cas9 stable expression plant. DETAILED DESCRIPTION

[0025] In order to enable those skilled in the art to better understand the scheme of the present invention, the technical scheme in the embodiments of the present invention will be clearly and completely described below in conjunction with the drawings in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work should fall within the scope of protection of the present invention.

[0026] The present invention is further described in detail below in conjunction with the accompanying drawings: Example 1 See attached Figure 1This embodiment provides a whole genome CRISPR / Cas9 knockout plasmid library of Physcomitrella patens, and the specific steps are as follows: 1. Design of dual sgRNA Data source: Based on the sequence information of Physcomitrella patens T2T genome (V6 version), Design tools: Use Rule Set 2 and AI-derived models from the bioinformatics website CRISPOR to predict knockout efficiency Design principles: Design CRISPR / Cas9 knockout targets, which are located in the coding sequences (CDS) region close to the gene promoter, with a GC content limited to 20% to 80% and a Tm value limited to 50~72℃.

[0027] Screening criteria: retain the 10 knockout targets with the highest efficiency under the two knockout efficiency prediction rules, and use the CFD score to predict the off-target efficiency after collection. For each gene, retain the two knockout targets with the lowest off-target efficiency. The specific screening criteria are: for each gene, select sgRNA with a length of 20 nts and a PAM sequence of NGG, consider a maximum of 4 bases for the off-target site, the mismatch and off-target scores are less than 1, Rule Set 2 predicts an editing efficiency greater than 0.5, and AI-derived models predict two sgRNAs with an editing efficiency greater than 0.4.

[0028] Design results: A total of 28,518 protein-coding genes were targeted, with a total of 57,036 sgRNAs.

[0029] 2. Synthesis of dual sgRNA-pool chip (1) Sequence design: Add linkers at both ends of the dual sgRNA sequence to form a dual sgRNA-pool chip sequence.

[0030] (2) Linker sequence: Contains flanking sequences for Gibson cloning and a BsmBI restriction site between the two sgRNA sequences for secondary insertion of the scafford-ppU6 fragment.

[0031] (3) Synthesis: After 3 weeks of synthesis, a 10 pmol chip was obtained.

[0032] Specific steps: Add adapters to both ends of the designed dual sgRNA sequence, and synthesize the dual sgRNA sequence with adapters into a dual sgRNA-pool chip.

[0033] The double sgRNA sequence is: NNNNNNNNNNNNNNNNNNGTTTTGAGACGCGTCTCCCCATNNNNNNNNNNNNNNNNNN (as shown in SEQIDNO.1); The 5' end linker sequence is TATAGGAAGGTGGAGGACTTACAACCCAT (as shown in SEQ ID NO. 3); The 3' end linker sequence is gttttagagctagaaatagcAAGTT (as shown in SEQ ID NO.4); The double sgRNA-pool chip sequence is: TATAGGAAGGTGGAGGACTTACAACCCATNNNNNNNNNNNNNNNNNGTTTTGAGACGCGTCTCCCCATNNNNNNNNNNNNNNNNNNgttttagagctagaaatagcAAGTT (as shown in SEQIDNO.2).

[0034] 3. Construction of double sgRNA plasmid library Clone the dual sgRNA-pool chip synthesized in step 2 into the 5'HR-ppU6-scaffold-3'HR vector and insert the scaffold-ppU6 fragment between the two sgRNAs, including: (1) Vector construction See attached Figure 2 , use HR-L and U6 to construct a promoter, connect these components through Scaffold, and add the dual sgRNAs (i.e., sgRNA1 and sgRNA2) designed and synthesized in step 1.

[0035] (2) Cloning The synthesized dual-sgRNA-pool chip was cloned into the 5'HR-ppU6-scaffold-3'HR vector; Insert the scaffold-ppU6 fragment between the two sgRNAs.

[0036] The specific steps are as follows: ① Use specific primers to enrich the chip, first dissolve the dry powder library with deionized water, and then perform PCR reaction. The primers used in the PCR reaction include: Frist-insert-F:TATAACCCACATGGAATGGAGGTGGGTGTGAAGGCGGGTATATAGGAAGGTGGAGGACTT (as shown in SEQIDNO.5); Frist-insert-R:ACTTTTTCAAGTTGATAACGGACTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAAC (as shown in SEQ ID NO.6).

[0037] The primers overlapped by 25 bp with the ends of the 5'HR-ppU6-scaffold-3'HR linearized vector digested with BsaI, and the primer concentration was 10 pmol / μL. PCR reaction system

[0038] PCR reaction procedure:

[0039] ② The amplified DNA product was purified and recovered, and ligated into the BsaI-digested 5'HR-ppU6-scaffold-3'HR vector using the Gibson assembly method (NEB).

[0040] BsaI digestion system

[0041] BsaI digestion procedure

[0042] Gibson Assembly System

[0043] Gibson Assembly Procedure

[0044] ③ The assembled product was transformed into Stable electroporation competent cells (NEB), and the intermediate plasmid was extracted.

[0045] ④ Use T4 ligase (NEB) to connect the intermediate plasmid digested with BsmBI enzyme and the scaffold-ppU6 fragment.

[0046] T4 connection system

[0047] T4 Connection Procedure

[0048] ⑤ The ligation mixture was transformed into Stable electroporation competent cells (NEB) again, and the final dual gRNA library plasmid was extracted.

[0049] Example 2 In this example, based on Example 1, after the construction of the Physcomitrella patens whole genome dual sgRNA CRISPR / Cas9 knockout plasmid library is completed, in order to ensure the quality and reliability of the library, a series of quality inspection steps need to be performed. The following is a detailed overview of the quality inspection process: 1. PCR amplification and sequencing preparation Using the plasmid library as a template, a high-fidelity enzyme was used to amplify amplicons suitable for Illumina sequencing.

[0050] 1. Primer Design Upstream primer: GGCTACCGTCTCCGTTTTAGAGCTAG (as shown in SEQ ID NO.7); Downstream primer: GGCTACCGTCTCGATGGGTTGTAAGT (as shown in SEQ ID NO.8) 2. PCR reaction system PCR reaction system

[0051] PCR reaction procedure

[0052] 3. Test results: The size of the amplified product is correct, the band is single, and it meets the sequencing standards.

[0053] 2. Illumina sequencing The amplicons were sequenced by Illumina sequencing platform to assess the coverage and homogeneity of the plasmid library.

[0054] Sequencing standards: The amplicons were sequenced using Illumina, ensuring that the plasmid library coverage was ≥98%, homogeneity was <10, and sequencing depth was 100X.

[0055] For detailed test results, please see the attached Figure 3 and attached Figure 4 shown.

[0056] 3. Analysis of sequencing results 1. Comparison information statistics By comparing and analyzing the Illumina sequencing results, the number of reads of sgRNA was counted, see Table 1.

[0057] Table 1: Comparison information statistics

[0058] Raw reads: total number of sgRNA raw reads; Raw base: the total number of bases obtained from the sgRNA raw read data; Q30: Q30 means that the probability of a single base error does not exceed 0.1%, that is, the sequencing accuracy is 99.9%. Generally speaking, the Q30 ratio of sequencing data must be greater than 80% to be used for subsequent analysis; Clean reads: the total number of high-quality reads after quality control processing; Percent: The percentage of Clean reads to Raw reads; Mapped reads: The number of reads that are completely aligned to the sgRNA Library; Mapping ratio: the ratio of reads that are completely mapped to the sgRNA Library; Total sgRNAs: the total number of sgRNAs in the sgRNA library; Zero sgRNAs: the number of sgRNAs lost in the sgRNA library; Coverage rate: Library coverage, that is, the ratio of the detected sgRNA to the total sgRNA. For library quality control, coverage > 90% is generally required.

[0059] From the data in Table 1, we can see that among the 57,048 sgRNAs in the whole genome library of Physcomitrella patens, 10% of the sgRNAs have reads ≤ 76, and 90% of the sgRNAs have reads ≤ 678, with a ratio of 8.92 times, indicating that the library uniformity is qualified. Among them, there are 11 sgRNAs with 0 reads and a coverage of 99.96%, that is, most of the sgRNAs were successfully amplified and sequenced.

[0060] Through the above quality inspection steps, it can be confirmed that the quality of the dual sgRNA plasmid library is reliable and meets the requirements of subsequent experiments. The coverage and uniformity of the library have reached the expected standards, and the sequencing results also verify this, which provides a solid foundation for subsequent experiments and ensures the accuracy and reliability of the experiments.

[0061] Example 3 In this example, based on Example 1-2, an application experiment was conducted on the whole genome CRISPR / Cas9 knockout plasmid library of Physcomitrella patens constructed by the present invention. Figure 5 .

[0062] 1. NotI digestion of plasmid library The constructed Physcomitrella patens whole genome CRISPR / Cas9 knockout plasmid library was digested with NotI enzyme to prepare for subsequent protoplast transformation.

[0063] NotI digestion system

[0064] NotI digestion procedure

[0065] 2. Preparation of Physcomitrella patens Protoplasts Protoplasts were prepared by enzymatic digestion of protonema of a strain of Physcomitrella patens Cas9 protein stably expressed in BCDATG medium for 5 days at room temperature in the dark using 1% collapsing enzyme.

[0066] 3. Protoplast Transformation The NotI digestion product was purified and recovered; 300 μL of the product was added to the protoplasts and incubated for 10 min; an equal volume of PEGT solution was added and incubated for 30 min to mediate DNA transfer into the protoplasts; the product was centrifuged at 180×g for 3 min and re-spun, and then poured onto PRMB medium for plating.

[0067] 4. Screening of transgenic lines After 7 days of culture, the cells on the plate were transferred to G418-resistant BCD (BCDAG without ammonium tartrate) medium for screening, and the surviving strains were considered transgenic strains.

[0068] The medium formula used in the transformation process is: Preparation of culture medium stock solution: Stock B (100×) High pressure steam sterilization

[0069] Stock C (100×) High pressure steam sterilization

[0070] Stock D (100×) Do not autoclave

[0071] Alternative TES (1000×) High pressure steam sterilization

[0072] 100mM CaCl2 (100×)

[0073] BCDATG medium (1 L):

[0074] BCDAG medium (1 L):

[0075] PRM / B medium (1 L):

[0076] 5. Identification of transgenic lines (1) Extracting DNA from transgenic strains; (2) Amplify the sgRNA region using specific primers Upstream primer: GGCTACCGTCTCCGTTTTAGAGCTAG (as shown in SEQ ID NO.9); Downstream primer: GGCTACCGTCTCGATGGGTTGTAAGT (as shown in SEQ ID NO.10) (3) Sequencing and identification of the amplified products.

[0077] PCR reaction system:

[0078] PCR reaction procedure:

[0079] 6. Identification of CRISPR / Cas9 Knockout Events The correctly identified sgRNA targeted gene was amplified; the CRISPR / Cas9 gene knockout event in Physcomitrella patens was confirmed by sequencing.

[0080] PCR reaction system

[0081] PCR reaction procedure

[0082] Test results PCR amplification and sequencing identification: The sgRNA integrated into the DNA of the Cas9 stably expressing plant of Physcomitrella patens was amplified and sequenced using PCR technology, and the homologous recombination event of the double sgRNA fragment and the targeted gene of the sgRNA were successfully identified; the targeting site of the sgRNA integrated into the CRISPR / Cas9 knockout plant of Physcomitrella patens was amplified and sequenced using PCR technology, and the CRISPR / Cas9 knockout event and its efficiency were successfully identified.

[0083] Phenotypic observation: Phenotypic observations were conducted on the plant morphology, leaf shape, protonema morphology, sporophyte of CRISPR / Cas9 knockout plants of Physcomitrella patens, as well as Physcomitrella patens in response to adverse stress, and the function of the knockout gene was identified.

[0084] By implementing the method of the present invention, a whole genome CRISPR / Cas9 knockout plasmid library of Physcomitrella patens was successfully constructed, and large-scale gene knockout was achieved. This method has the characteristics of high throughput and high efficiency, and provides a powerful tool for functional genomics research and biotechnology applications. The effectiveness and reliability of the knockout plasmid library were verified through PCR amplification, sequencing identification and phenotypic observation, laying a solid foundation for subsequent functional genomics research.

[0085] The above contents are only for explaining the technical idea of ​​the present invention and cannot be used to limit the protection scope of the present invention. Any changes made on the basis of the technical solution in accordance with the technical idea proposed by the present invention shall fall within the protection scope of the claims of the present invention.

Claims

1. A method for constructing a whole genome CRISPR-Cas9 knockout plasmid library of Physcomitrella patens, characterized in that: include: S1, based on the genome sequence information of Physcomitrella patens T2T, double sgRNA was designed and synthesized; S2, add adapters to both ends of the dual sgRNA sequence to synthesize the dual sgRNA-pool chip; S3, amplifying the synthesized dual sgRNA-pool chip, recovering the amplified product, and obtaining the library amplification product; S4, connecting the library amplification product using a linearized CRISPR-Cas9 library vector, transforming into competent cells, and extracting to obtain an intermediate plasmid; S5, the intermediate plasmid and scaffold-ppU6 fragment were connected using ligase, transformed into competent cells again, and the plasmid was extracted to obtain the whole genome CRISPR-Cas9 dual sgRNA library of Physcomitrella patens.

2. The method for constructing a whole genome CRISPR-Cas9 knockout plasmid library of Physcomitrella patens according to claim 1, characterized in that: In S1, the design of dual sgRNA includes: based on the genome gene sequence of Physcomitrella patens T2T, using bioinformatics tools to predict knockout efficiency and predict CRISPR-Cas9 knockout targets; screening the predicted CRISPR-Cas9 knockout targets; and designing corresponding dual sgRNAs based on the screened CRISPR-Cas9 knockout targets.

3. The method for constructing a whole genome CRISPR-Cas9 knockout plasmid library of Physcomitrella patens according to claim 2, characterized in that: The bioinformatics tools are Rule Set 2 and AI-derived models of the bioinformatics website CRISPOR; the CRISPR-Cas9 knockout target is located in the coding region close to the gene promoter, with a GC content of 20% to 80% and a Tm value of 50 to 72°C.

4. The method for constructing a whole genome CRISPR-Cas9 knockout plasmid library of Physcomitrella patens according to claim 1, characterized in that: In S1, the sequence of the dual sgRNA is shown as SEQ ID NO.

1.

5. The method for constructing a whole genome CRISPR-Cas9 knockout plasmid library of Physcomitrella patens according to claim 1, characterized in that: In S2, the sequence of the dual sgRNA-pool chip is shown as SEQ ID NO.2, and the adapter sequences at both ends are shown as SEQ ID NO.3-SEQ ID NO.

4.

6. The method for constructing a whole genome CRISPR-Cas9 knockout plasmid library of Physcomitrella patens according to claim 1, characterized in that: In S3, the primer sequences used for the dual sgRNA-pool chip amplification are shown in SEQ ID NO.5-SEQ ID NO.

6.

7. The method for constructing a whole genome CRISPR-Cas9 knockout plasmid library of Physcomitrella patens according to claim 1, characterized in that: The method also includes a quality control step of the double sgRNA plasmid library.

8. A whole-genome CRISPR-Cas9 sgRNA library of Physcomitrella patens, characterized in that: The Physcomitrella patens whole-genome CRISPR-Cas9 sgRNA library is constructed by the construction method according to any one of claims 1 to 7.

9. Use of the Physcomitrella patens whole genome CRISPR-Cas9 sgRNA library according to claim 8 in gene editing, screening of functional genes and / or related effect genes.

10. The use according to claim 9, characterized in that: include: Constructing a CRISPR-Cas9 system comprising a Cas9 protein and an sgRNA coding sequence; designing the Physcomitrella patens whole-genome CRISPR-Cas9 sgRNA library as described in claim 8; transforming and introducing the constructed CRISPR-Cas9 system and the Physcomitrella patens whole-genome CRISPR-Cas9 sgRNA library into Physcomitrella patens cells; PCR amplification and sequencing identification, phenotypic observation, and analysis of the function and role of genes in organisms.

Images