A peanut salt-tolerant gene AhLRR-RLK265 and its application

Abstract

The invention discloses a peanut salt-tolerant gene AhLRR‑ RLK265 And its application. The peanut salt tolerance gene AhLRR‑ RLK265 The nucleotide sequence is shown in SEQ ID No.1, the encoded amino acid sequence is shown in SEQ ID No.2, and under salt stress conditions, AhLRR‑RLK265 The gene expression in peanut seedling leaves increased by nearly 50 times, and then the gene was amplified, digested, constructed into an expression vector, and infected with Agrobacterium to transfer into the model plant Arabidopsis. AhLRR‑RLK265 The root length and germination rate of the genetic Arabidopsis thaliana were significantly better than those of the wild type, proving that AhLRR‑RLK265 The gene is a salt tolerance gene. AhLRR‑RLK265 The functional identification of the gene not only enriches the genetic resources for peanut salt-tolerance breeding, but also has important theoretical significance and application value.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology and specifically relates to a peanut salt-tolerant gene AhLRR-RLK265 and its applications. Background Art

[0002] peanut( Arachis hypogaea L.) belongs to the Fabaceae family, Arachis Arachis ), is one of my country's important oil and cash crops, and occupies an important position in the national economy. Peanuts are rich in fat and protein, and are an important source of edible oil and protein for humans. my country's peanut planting area ranks second in the world, and its annual output accounts for 40% of the global total output, ranking first in the world. Salt-alkali stress seriously affects the growth and development of peanuts, causing a large reduction in agricultural production, and is an important factor restricting the further development of my country's peanut industry. According to incomplete statistics, my country has a total area of ​​about 33 million hm2 of saline-alkali land. 2 , and there is a trend of continuous expansion, most of which have not yet been utilized. With the continuous increase in demand for peanuts, making full use of my country's saline-alkali land, expanding the peanut planting area, and increasing peanut production are issues that scientific researchers urgently need to solve. Therefore, the cultivation of new salt-alkali tolerant peanut varieties is crucial to the development of the peanut industry. Compared with traditional breeding, the use of molecular biology technology to cultivate new salt-alkali tolerant peanut varieties has the advantages of short cycle and high efficiency. The mining and utilization of salt-alkali tolerant genes is also of great significance for the cultivation of salt-tolerant varieties.

[0003] At present, there are still few genes with salt tolerance in peanuts. It is urgent to discover and identify peanut salt tolerance genes to provide genetic resources and theoretical basis for peanut molecular assisted breeding. Summary of the invention

[0004] The invention provides a peanut salt-tolerant gene AhLRR-RLK265 and its applications, AhLRR-RLK265 The transgenic strains obtained after gene transformation into Arabidopsis thaliana had significantly better root length and germination rate than the wild-type strains, proving that the gene can effectively improve the salt tolerance of plants.

[0005] In order to achieve the above-mentioned invention object, the present invention adopts the following technical solutions:

[0006] The invention provides a peanut salt-tolerant gene AhLRR-RLK265 , whose nucleotide sequence is shown in SEQ ID No.1.

[0007] Furthermore, the peanut salt-tolerant gene AhLRR-RLK265 The encoded amino acid sequence is shown in SEQ ID No.2.

[0008] The present invention also provides the peanut salt-tolerant geneAhLRR-RLK265 Application in improving plant salt tolerance.

[0009] Furthermore, the application comprises the following steps:

[0010] (1) Amplification of peanut salt tolerance genes AhLRR-RLK265 ;

[0011] (2) Cloning of peanut salt tolerance gene AhLRR-RLK265 , after enzyme digestion and purification, connected to the expression vector to obtain an overexpression recombinant vector;

[0012] (3) transforming the overexpression recombinant vector into Agrobacterium to obtain an overexpression recombinant strain;

[0013] (4) Transforming the overexpression recombinant strain into plants, screening and obtaining AhLRR-RLK265 Transgenic lines to improve plant salt tolerance.

[0014] Further, for amplifying the peanut salt-tolerant gene AhLRR-RLK265 The primers are as follows:

[0015] AhLRR-RLK265-F: GGATCC ATGACACAAGCTTCTTGTTTTAATT;

[0016] AhLRR-RLK265-R: GAGCTC CTATGTTGTTCGCTTGGACAAT.

[0017] Furthermore, the reaction conditions for amplification in step (1) are: pre-denaturation at 98°C for 30 s; denaturation at 98°C for 10 s, annealing at 58°C for 10 s, and 72°C for 50 s, for 30 cycles; and post-extension at 72°C for 10 min.

[0018] Furthermore, the expression vector in step (2) is a pCambia2300EC vector, which contains a 35S promoter and a NOS terminator.

[0019] Furthermore, the AhLRR-RLK265 Compared with the wild-type strain, the root length and germination rate of the transgenic strain were significantly increased.

[0020] Furthermore, the plants are peanut and Arabidopsis thaliana.

[0021] The present invention also provides the peanut salt-tolerant gene AhLRR-RLK265 Application in breeding salt-tolerant peanut varieties.

[0022] Compared with the prior art, the present invention has the following advantages and beneficial effects:

[0023] The present invention screened a peanut gene whose expression level was significantly increased under salt stress through transcriptome sequencing analysis. AhLRR-RLK265 The results of quantitative PCR showed that the expression of the gene in peanut seedling leaves increased by nearly 50 times under salt stress. The gene was then cloned, an overexpression vector was constructed, and the overexpression recombinant strain was transformed into Arabidopsis to obtain the transgenic Arabidopsis plant AhLRR-RLK265-OE. AhLRR-RLK265-OE The root length and germination rate under salt stress were significantly better than those of the wild type. AhLRR-RLK265 The gene is a salt tolerance gene. AhLRR-RLK265 The functional identification of the gene not only enriches the genetic resources for peanut salt-tolerance breeding, but also helps to analyze the diverse functions of peanut LRR-RLK receptor protein kinases, which has important theoretical significance and application value. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 Under salt stress AhLRR-RLK265 Gene expression level, where the vertical axis is the relative expression level and the horizontal axis is the treatment time; the treatment concentration is 200 mM NaCl solution; 0, 6, 24, 48 are the time after salt stress treatment (hours).

[0025] Figure 2 and Figure 3 For transfer AhLRR-RLK265 Identification of genes for salt tolerance in Arabidopsis thaliana, OE3 and OE5 is transgenic Arabidopsis thaliana, and WT is non-transgenic wild-type Arabidopsis thaliana. DETAILED DESCRIPTION

[0026] The technical solution of the present invention is further described in detail with reference to the following specific examples.

[0027] In the following examples, unless otherwise specified, the experimental methods used are all conventional methods, and the materials and reagents used can be purchased from biological or chemical reagent companies.

[0028] Example 1

[0029] The present invention screened a peanut gene whose expression level was significantly increased under salt stress through transcriptome sequencing analysis. AhLRR-RLK265 , whose nucleotide sequence is shown in SEQ ID No.1, and the encoded amino acid sequence is shown in SEQ ID No.2. Then RT-qPCR verification found that under salt stress conditions, AhLRR-RLK265 The gene expression in peanut seedling leaves increased by nearly 50 times, and it was preliminarily determined that the gene played an important role in peanut's response to salt stress. AhLRR-RLK265The gene fragment was constructed by enzyme digestion and ligation, and then transferred into the model plant Arabidopsis thaliana by Agrobacterium infection to obtain the transgenic plant. AhLRR-RLK265 The gene was found to significantly improve the resistance of transgenic Arabidopsis to salt stress, thus proving that AhLRR-RLK265 The gene is a salt tolerance gene. AhLRR-RLK265 The functional identification of the gene not only enriches the genetic resources for peanut salt-tolerance breeding, but also helps to analyze the diverse functions of peanut LRR-RLK receptor protein kinases, which has important theoretical significance and application value.

[0030] The following is the salt tolerance gene of peanut AhLRR-RLK265 Specific steps of the cloning method and its application:

[0031] 1. Peanuts AhLRR-RLK265 The gene coding region sequence was used as a reference to design specific primers AhLRR-RLK265-F and AhLRR-RLK265-R. The primer sequences are as follows:

[0032] AhLRR-RLK265-F: GGATCC ATGACACAAGCTTCTTGTTTTAATT;

[0033] AhLRR-RLK265-R: GAGCTC CTATGTTGTTCGCTTGGACAAT.

[0034] 2. Extract the mRNA from the seedling leaves of the peanut cultivar "Huayu 67" and reverse transcribe it into cDNA, which is used as a template for PCR amplification. Use the primers in step 1 for PCR amplification to obtain AhLRR-RLK265 Amplified fragment of the gene.

[0035] PCR amplification system: ddH2O 31 μL, Mg 2+ 10 μL of 5×HF buffer; 2 μL of 2.5 mM dNTPs; 2 μL of 5 μM AhLRR-RLK265-F and AhLRR-RLK265-R; 0.6 μL of DMSO; 0.5 μL of Phusion enzyme; and 2 μL of cDNA template.

[0036] The PCR reaction conditions were as follows: pre-denaturation at 98 °C for 30 s; denaturation at 98 °C for 10 s, annealing at 58 °C for 10 s, and 72 °C for 50 s, for 30 cycles; and post-extension at 72 °C for 10 min.

[0037] 3. Build AhLRR-RLK265The PCR amplified fragment obtained in step 2 was connected to the cloning vector pEASY-Blunt simple. After the sequencing was correct, the plasmid was extracted, double-digested with BamH I and Sac I, purified, and connected to the pCambia2300EC vector (which contains the 35S promoter and NOS terminator) digested with BamH I and Sac I. After the sequencing was correct, Agrobacterium GV3101 was transformed by the freeze-thaw method, and Arabidopsis thaliana was genetically transformed by the floral dip method to obtain the transgenic plant AhLRR-RLK265-OE.

[0038] 4. Analysis and identification AhLRR-RLK265 Salt tolerance

[0039] (1) Analyze the expression pattern in peanut seedling leaves under salt stress.

[0040] The seedlings of Huayu 67 were treated with 200 mM NaCl solution and analyzed by fluorescence quantitative PCR. AhLRR- RLK265 The expression level of the gene changes dynamically at 0h, 6h, 24h, and 48h.

[0041] Among them, the primer sequences of fluorescent quantitative PCR are:

[0042] AhLRR-RLK265-qF: CTCCTCGGCTTTGAGATCCC;

[0043] AhLRR-RLK265-qR:TCTCGAGCTTTGAACACGCT.

[0044] The results are as follows Figure 1 As shown, AhLRR-RLK265 After salt stress treatment, the expression levels increased significantly, reaching a peak at 48 hours, an increase of nearly 50 times, preliminarily verifying AhLRR-RLK265 Genes respond to salt stress, indicating AhLRR-RLK265 Genes involved in salt tolerance in peanut.

[0045] (2) Identification of salt tolerance of transgenic Arabidopsis thaliana.

[0046] Transgenic plants AhLRR-RLK265-OE The T3 generation seeds were sterilized and grown on normal 1 / 2MS solid culture medium for one week. Then, Arabidopsis seedlings with basically the same growth potential were selected and transferred to 1 / 2MS solid culture medium containing 150 mM NaCl for one week to identify their salt tolerance at the seedling stage. At the same time, wild-type Arabidopsis seeds (WT) were used as a control.

[0047] Transgenic plants AhLRR-RLK265-OEThe T3 seeds were sterilized and evenly spread on normal and 1 / 2MS solid culture media containing 150 mM NaCl. The seed germination rate was identified one week later. Wild-type Arabidopsis seeds (WT) were used as a control.

[0048] The results are as follows Figure 2 and Figure 3 As shown, after salt treatment, transgenic Arabidopsis OE3 and OE5 The root length and germination rate of transgenic Arabidopsis thaliana were higher than those of wild-type Arabidopsis thaliana WT, indicating that the salt tolerance of transgenic Arabidopsis thaliana was better than that of wild-type Arabidopsis thaliana. AhLRR-RLK265 Gene can improve salt tolerance in transgenic Arabidopsis.

[0049] The above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit the same. Although the present invention has been described in detail with reference to the aforementioned embodiments, it is still possible for a person skilled in the art to modify the technical solutions described in the aforementioned embodiments, or to replace some of the technical features therein by equivalents. However, these modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions claimed to be protected by the present invention.

Claims

1. Overexpression of peanut salt tolerance gene AhLRR-RLK265 The application in improving the salt tolerance of plants is characterized in that: The peanut salt tolerance gene AhLRR-RLK265 The nucleotide sequence is shown in SEQ ID No.1, and the amino acid sequence encoded by it is shown in SEQ ID No.2, which is used to amplify the peanut salt-tolerant gene AhLRR-RLK265 The primers are as follows: AhLRR-RLK265-F:GGATCCATGACACAAGCTTCTTGTTTTAATT; AhLRR-RLK265-R:GAGCTCCTATGTTGTTCGCTTGGACAAT; The plant is peanut or Arabidopsis thaliana.

2. The use according to claim 1, characterized in that: The application comprises the following steps: (1) Amplification of peanut salt tolerance genes AhLRR-RLK265 ; (2) Cloning of peanut salt tolerance gene AhLRR-RLK265 , after enzyme digestion and purification, connected to the expression vector to obtain an overexpression recombinant vector; (3) transforming the overexpression recombinant vector into Agrobacterium to obtain an overexpression recombinant strain; (4) Transforming the overexpression recombinant strain into plants, screening and obtaining AhLRR-RLK265 Transgenic lines to improve plant salt tolerance.

3. The use according to claim 2, characterized in that: The reaction conditions for amplification in step (1) are: pre-denaturation at 98°C for 30 s; denaturation at 98°C for 10 s, annealing at 58°C for 10 s, and 72°C for 50 s, for 30 cycles; and post-extension at 72°C for 10 min.

4. The use according to claim 2, characterized in that: The expression vector in step (2) is a pCambia2300EC vector, which contains a 35S promoter and a NOS terminator.

5. The use according to claim 2, characterized in that: Said AhLRR-RLK265 Compared with the wild-type strain, the root length and germination rate of the transgenic strain were significantly increased.

Images