Recombinant VII type collagen with whitening effect as well as preparation method and application of recombinant VII type collagen

Abstract

The invention provides recombinant VII type collagen with a whitening effect as well as a preparation method and application thereof, and belongs to the technical field of bioengineering. Research finds that the recombinant VII type collagen with a whitening effect, the expression quantity of the recombinant VII type collagen is improved by taking a genetic engineering technology as a means, and expression production of the recombinant VII type collagen is carried out by using a pichia eukaryotic expression system; the recombinant VII type collagen disclosed by the invention is expressed in pichia pastoris, can be efficiently secreted and expressed outside cells, and is not easy to degrade in a purification stage, so that the purification difficulty is reduced; the recombinant VII type collagen has an excellent whitening effect, is suitable for sensitive skin, does not cause skin irritation, itching and scorching hot, and has good practicability.

Description

Technical Field

[0001] The invention belongs to the technical field of bioengineering, and in particular relates to recombinant type VII collagen with whitening effect, and a preparation method and application thereof. Background Art

[0002] Collagen is the main component of the human body and has many functions, such as multiple biological functions, biocompatibility, and degradability. The molecular weight is above 300,000, and the three peptide chains are firmly bonded together. It is difficult for the human body to digest and absorb directly. It must be decomposed into simple small molecule amino acids by proteases in the digestive tract before it can be absorbed by the intestine. Compared with collagen, collagen polypeptide has a smaller molecular weight, has good biological functionality and higher transdermal properties, and the absorption rate can reach 95% to 100%. It is widely used in cosmetics, medicine, and food.

[0003] Collagen small molecule peptides are easy to absorb and have good transdermal properties. They can help maintain the elasticity and moisture of the skin, promote the renewal and repair of skin cells, thereby helping to improve skin quality, reduce wrinkles and fine lines, and have significant effects in skin anti-oxidation, anti-aging, soothing and whitening. The skin is the largest organ in the human body, covering the entire surface of the human body. In addition to receiving sensory stimulation, it also has the functions of isolation and protection. With age, cell renewal becomes slower, and hormone changes are directly reflected in the skin. The formation of free radicals affects the speed of normal skin aging, by attacking the skin structure, destroying collagen and elastic fibers, and impairing hydration, which manifests as poor complexion, sagging skin and changes in wrinkles. Skin color is mainly related to melanin content. Melanin deposition in cells is related to melanosome structure, transport, enzymes and transcription. The mechanism of action of whitening products based on the formation principle of melanin: 1) reducing exogenous stimulation signals, 2) inhibiting tyrosinase activity, 3) inhibiting melanin synthesis signal pathway, 4) inhibiting melanosome maturation, 5) inhibiting melanosome transport, etc. Traditional drugs include glucocorticoids, hydroquinone, and aminomercuric chloride, which inhibit melanocyte maturation or interfere with the process of melanin production by brightening the skin, but their adverse reactions are obvious, including stinging, contact dermatitis, irritation, high toxicity and sensitivity. New whitening skin care product raw materials competitively bind to melanocyte MC1-R and MC4-R receptors, inhibit α-MSH melanocyte-stimulating hormone, and further prevent the production of tyrosinase, thereby reducing excessive melanin production and deposition; or selectively inhibit the activity of tyrosinase (TYR) to reduce pigmentation while avoiding cytotoxicity.

[0004] In the field of skin care, capsaicin receptor (TRPV1) is closely related to burning, irritation, sensitivity and pain of the skin. As an irritant target, it plays an important role in sensitive skin and inflammatory response. TRPV1 can activate sensory nerve endings, causing burning and itching, while delaying skin barrier repair, and is an important pathway for causing skin discomfort. It exists in sensory nerve endings and skin cells, such as keratinocytes, fibroblasts, mast cells and endothelial cells of dermal capillaries, and is sensitive to a variety of physical and chemical irritants. Antagonists of TRPV1 receptors are used to relieve skin discomfort caused by TRPV1 stimulation, and are also a hot spot for the development of cosmetic raw materials and products. At present, there is extensive research on ingredients that inhibit TRPV1 receptors. Palmitoyl tripeptide-8 and palmitoyl tetrapeptide-7, products for sensitive skin, have anti-allergic and soothing effects, but the immunogenicity of in vitro synthesized peptides is low, the production cost is high, and the effect is slow to appear. Therefore, it is necessary to develop collagen peptides with safety and effectiveness.

[0005] Anchoring fibers are attachment structures that mediate epidermal adhesion in human skin, of which type VII collagen (Col7) is the main component of anchoring fibers (AFs). Type VII collagen connects the basal layer to the underlying tissue by interacting with other types of collagen and parts of the extracellular matrix. In the absence of Col7, the secretion of ECM-related proteins is reduced, while endoplasmic reticulum stress associated with Col1 is increased and the TGFβ signaling pathway is elevated. Alterations in Col7 structure and expression may affect the functional disruption of the interaction with ECM components, leading to the separation of the epidermis from the dermis, resulting in dystrophic epidermolysis bullosa (DEB), which is associated with persistent wound nonhealing. Col7 is required for the re-epithelialization of laminin 332 at the dermal-epidermal junction. Its absence will disrupt the organization of laminin 332 during wound healing, thereby disrupting the expression of integrin α6β4 in basal keratinocytes and negatively affecting laminin 332 / integrin. The loss of a single structure Col7 will cause cellular inflammation and promote progressive fibrosis driven by keratinocytes. The organic matrix of the inner layer of mature enamel (DEJ) contains macromolecular Col7. The Col7 fibers embedded in the enamel not only contribute to the structural elasticity of the enamel, but also may play a role in the bonding between the enamel and the dentin. Currently, there are not many expression systems for expressing type VII collagen. The reason is that the cost of mammalian cell culture is high, the growth cycle is slow, the expression level is 15-20 mg / l, the expression level is low, and although it is secreted into the supernatant, there are many purification steps and product losses, which cannot be industrialized. The yield in the large intestine expression system has increased, but it has not reached the scale of commercial production. The yields of the above two expressions are low, the protein stability is poor and easy to degrade, and it is limited to the scale of laboratory research. Patent CN 118324898 A uses Pichia pastoris as a recombinant expression strain to express type VII collagen. The expression of type VII collagen is a macromolecule, which has the effects of promoting cell proliferation, promoting cell migration, and promoting cell differentiation. It is not shown in the efficacy of skin care products and the efficacy of combining with bioactive molecules.

[0006] Therefore, it is necessary to develop recombinant small molecule collagen with whitening, anti-aging, anti-wrinkle and soothing effects. Summary of the invention

[0007] In view of some deficiencies in the prior art, the present invention provides a recombinant type VII collagen with whitening effect, a preparation method and an application thereof; the present invention discovers a recombinant type VII collagen with whitening effect through research, and uses genetic engineering technology as a means to increase the expression amount of the recombinant type VII collagen, and uses a eukaryotic Pichia pastoris expression system to express and produce the recombinant type VII collagen; the recombinant type VII collagen of the present invention is expressed in Pichia pastoris, can be efficiently secreted and expressed outside the cell, is not easily degraded during the purification stage, and reduces the difficulty of purification; the recombinant type VII collagen has excellent whitening, anti-aging, anti-wrinkle or soothing effects, is suitable for sensitive skin, will not cause skin irritation, itching or burning, and has good practicality.

[0008] In order to achieve the above technical objectives, the present invention adopts the following technical means:

[0009] The present invention first provides a recombinant type VII collagen with whitening efficacy, wherein the recombinant type VII collagen comprises a binding site for a whitening action site; the whitening action site comprises one or more of MC1-R, MC4-R, GRM6, TRPM1 or MET.

[0010] Preferably, the recombinant type VII collagen further comprises a binding site for one or more action sites of anti-aging, anti-wrinkle or soothing effects;

[0011] The action sites of anti-aging, anti-wrinkle or soothing effects include one or more of TRPV1, IL1R1, and MT-CO2.

[0012] Preferably, the sequence of the recombinant type VII collagen is as shown in i or ii:

[0013] i. The amino acid sequence is shown in SEQ ID No.1, SEQ ID No.2, SEQ ID No.3 or SEQ ID No.4;

[0014] ii. A protein derived from i, wherein the amino acid sequence in i is substituted, deleted or added with one or more amino acids and has human collagen activity.

[0015] The present invention also provides a nucleic acid encoding the above-mentioned recombinant type VII collagen with whitening effect, and the nucleic acid sequence is shown as SEQ ID No.5-SEQ ID No.8.

[0016] The present invention also provides a recombinant expression vector, which comprises the above nucleic acid.

[0017] The present invention also provides a recombinant engineered bacterium, comprising the above-mentioned nucleic acid molecule or the above-mentioned recombinant expression vector.

[0018] Preferably, the host bacteria of the recombinant engineered bacteria include one of Pichia pastoris, Saccharomyces cerevisiae and Hansenula.

[0019] Preferably, the host cell is Pichia pastoris, more preferably GS115-HCPB PPKEX2, with the deposit number being CGMCC No.25815.

[0020] Preferably, the recombinant engineered bacteria are deposited in the General Microbiological Center of China National Microbiological Culture Collection Administration with the deposit numbers CGMCC No.31991 and CGMCC No.31992.

[0021] The present invention also provides a method for preparing the above-mentioned recombinant type VII collagen with whitening effect, the preparation method comprising:

[0022] (1) selecting and designing a sequence of recombinant type VII collagen, and then constructing a collagen tandem sequence by tandemly repeating the recombinant type VII collagen as a basic unit;

[0023] (2) constructing a recombinant plasmid expressing the collagen tandem sequence, and linearizing the recombinant plasmid to obtain a linearized plasmid;

[0024] (3) electroporating the linearized plasmid into a host bacterium, screening and verifying to obtain a high-copy recombinant engineered bacterium;

[0025] (4) fermenting and inducing the expression of the high-copy recombinant engineered bacteria, and then purifying to obtain recombinant type VII collagen;

[0026] Preferably, in step (1), the recombinant type VII collagen comprises a binding site for a whitening action site; the whitening action site comprises one or more of MC1-R, MC4-R, GRM6, TRPM1 or MET.

[0027] Preferably, the recombinant type VII collagen further comprises a binding site for one or more action sites of anti-aging, anti-wrinkle or soothing effects;

[0028] The action sites of anti-aging, anti-wrinkle or soothing effects include one or more of TRPV1, IL1R1, and MT-CO2.

[0029] Preferably, in step (1), the sequence of the recombinant type VII collagen is as shown in i or ii:

[0030] i. The amino acid sequence is shown in SEQ ID No.1, SEQ ID No.2, SEQ ID No.3 or SEQ ID No.4;

[0031] ii. A protein derived from i, wherein the amino acid sequence in i is substituted, deleted or added with one or more amino acids and has human collagen activity.

[0032] Preferably, in step (1), the collagen tandem sequence comprises 8 to 10 basic unit recombinant type VII collagens; and there is a site for recognition and cleavage by Kex2 enzyme or Ste13 enzyme between two adjacent basic units.

[0033] Preferably, the recognition and cleavage site includes a KR or RR dibasic amino acid residue, followed by EA, EAEA or other amino acid residues that facilitate cleavage by Kex2 enzyme or Ste 13 enzyme.

[0034] Preferably, in step (1), the nucleic acid of the collagen tandem sequence comprises a nucleotide sequence as shown in SEQ ID No. 6 or SEQ ID No. 8, or a degenerate sequence thereof.

[0035] Preferably, in step (2), the vector of the recombinant plasmid includes pPICZαB, pFLDα, and pPIC9K, and the connection site is between XhoI and NotI.

[0036] Preferably, the vector is pPIC9K.

[0037] Preferably, in step (3), the host bacteria includes one of Pichia pastoris, Saccharomyces cerevisiae and Hansenula.

[0038] Preferably, in step (3), the recombinant engineered bacteria are deposited in the General Microbiological Center of China National Microbiological Culture Collection Administration with the deposit numbers CGMCC No.31991 and CGMCC No.31992.

[0039] The present invention also provides recombinant type VII collagen prepared according to the above method.

[0040] The present invention also provides the use of the recombinant type VII collagen in whitening, anti-aging, anti-wrinkle or soothing products.

[0041] The present invention also provides a whitening, anti-aging, anti-wrinkle or soothing product, which comprises the above-mentioned recombinant type VII collagen, or the type VII collagen encoded by the nucleic acid, or the recombinant vector, or the type VII collagen obtained by the method.

[0042] Compared with the prior art, the present invention has the following beneficial effects:

[0043] (1) The recombinant type VII collagen of the present invention contains one or more whitening, anti-aging, anti-wrinkle and soothing efficacy sites. The recombinant type VII collagen has excellent skin care efficacy and is suitable for sensitive skin without causing skin irritation, itching or burning. The recombinant type VII collagen of the present invention competitively binds to the melanocyte MC1-R and / or MC4-R receptors, inhibits α-MSH melanocyte stimulating hormone, and further prevents the production of tyrosinase, thereby reducing excessive melanin production and deposition; the recombinant type VII collagen of SEQ ID No. 1 and SEQ ID No. 3 simultaneously contain binding sites for the two whitening action sites MC1-R and MC4-R.

[0044] (2) The recombinant type VII collagen described in the present invention is expressed in Pichia pastoris, can be efficiently secreted and expressed outside the cell, has a clear amino acid sequence, a single band, no degradation, and is easily absorbed. The transdermal permeability, cell adhesion activity, cell migration and cell proliferation activity of the small molecule collagen are tested. The results show that the transdermal permeability is good while retaining the biological activity. The cell adhesion and migration activities are not weaker than those of natural macromolecular collagen. The tandem expression of small molecules increases the expression level, solves the product shortage of recombinant small molecule type VII collagen, and provides an alternative raw material for cosmetics.

[0045] (3) The present invention adopts a small molecule tandem expression method to express recombinant type VII collagen, and the method greatly improves the yield of recombinant type VII collagen. The technical solution of the present invention does not introduce exogenous proteins and does not use any in vitro enzymatic cleavage methods. During the process of intracellular secretion of recombinant type VII collagen, the residual amino acid residues of the enzymatic cleavage sites during the repeated tandem design will be removed to obtain recombinant type VII collagen without non-collagen sequences or with 100% homology to the corresponding region of natural collagen. The entire expression system avoids the cost and risk of exogenous protein residues caused by the use of protease cleavage in vitro, and can also shorten the time and cost of the subsequent purification process. BRIEF DESCRIPTION OF THE DRAWINGS

[0046] Figure 1 These are agarose gel verification pictures of the recombinant engineering strains; a is GS115-HCPB-kex2-pPIC9K-715, and b is GS115-HCPB-kex2-pPIC9K-719.

[0047] Figure 2 This is the supernatant of recombinant type VII collagen expression in a shake flask after 72 hours of induction; a in the figure is 715 and b is 719.

[0048] Figure 3The results of protein spectrum detection of recombinant type VII collagen; a is the protein list, b is the peptide coverage of 715 compared with the amino acid database, and c is the peptide coverage of 719 compared with the amino acid database.

[0049] Figure 4 This is the electrophoresis detection diagram of recombinant type VII collagen.

[0050] Figure 5 This is the electrophoresis detection diagram of purified recombinant type VII collagen.

[0051] Figure 6 This is a diagram of cell adhesion activity detection.

[0052] Figure 7 This is the result of cell migration area ratio detection.

[0053] Figure 8 This is a picture of cell migration.

[0054] Fig. 9 This is a picture showing the inhibition rate of sample 719 on tyrosinase activity.

[0055] Fig.10 This is a graph showing the inhibition rate of melanin synthesis; in the graph, a is 715 and b is 719.

[0056] Fig.11 This is a graph showing the results of cell viability detection. DETAILED DESCRIPTION

[0057] The present invention is further described below in conjunction with the accompanying drawings and specific embodiments, but the protection scope of the present invention is not limited thereto. In the embodiments of the present invention, all that is not described in detail is accomplished by conventional experimental methods, and all that is not described in detail in the processes involved in the embodiments is understandable and easily implemented by those skilled in the art based on the product manual or basic knowledge in the art, and therefore will not be described in detail.

[0058] Embodiment 1:

[0059] S1. Design of amino acid sequence of recombinant type VII collagen:

[0060] A sequence of about 50 amino acids from the triple helix region of human type VII collagen (Q02388 CO7A1_HUMAN) was selected, KR was added to the C-terminus, EA was added to the N-terminus, and 6-10 copies were connected in series to make the target sequence size about 50KD to adapt to the optimal expression range of Pichia pastoris. After expression in Pichia pastoris, kex2 contained in Pichia pastoris itself cuts the KR carboxyl terminus in the amino acid junction KREA, ste13 cuts the nitrogen-terminal EA, and the overexpressed HCPB cuts the LinkerKR residue at the carboxyl terminus, cutting the tandem proteins into monomers, which are secreted outside the cell through the secretory signal peptide.

[0061] (1) An amino acid sequence containing multiple whitening sites, anti-aging and soothing sites is selected, wherein the whitening sites include MC1-R and MC4-R, etc.; the anti-aging and soothing sites include TRPV1 and IL1R1, etc., that is, 2731-2778AA of Q02388.CO7A1-HUMAN, LE is added to the C-terminus, and the obtained sequence is named 715, and the sequence is shown in SEQ ID No. 1.

[0062] On the basis of SEQ ID No.1, EA is added to the N-terminus and KR is added to the C-terminus to form a basic unit, and the basic unit is repeated 8 times to form an amino acid sequence as shown in SEQ ID No.2, i.e., a collagen tandem sequence.

[0063] SEQ ID No.1:

[0064] GPRGDPGERGPRGPKGEPGAPGQVIGGEGPGLPGRKGDPGPSGPPGPRGPLGDPGPRG PPGLPGLE;

[0065] SEQ ID No.2:

[0066] *.

[0067] (2) An amino acid sequence containing multiple binding sites of whitening action sites, anti-aging action sites and soothing action sites was selected, wherein the whitening action sites included binding sites of MC1-R, MC4-R and GRM6; the anti-aging action sites and soothing action sites included binding sites of TRPV1, IL1R1 and MT-CO2, i.e., 1619-1667AA of Q02388.CO7A1-HUMAN, LA was added to the C-terminus, and the obtained sequence was named 719, and the sequence is shown in SEQ ID No. 3.

[0068] On the basis of SEQ ID No. 3, EA is added to the N-terminus and KR is added to the C-terminus to form a basic unit, and the basic unit is repeated 10 times to form an amino acid sequence as shown in SEQ ID No. 4, i.e., a collagen tandem sequence.

[0069] SEQ ID NO.3:

[0070] GRPGPPGPVGPRGRDGEVGEKGDEGPPGDPGLPGKAGERGLRGAPGVRGLA;

[0071] SEQ ID NO.4:

[0072] *.

[0073] S2. Synthesis of DNA sequences and construction of recombinant plasmids:

[0074] Nanjing GenScript Biotech Co., Ltd. was commissioned to synthesize the nucleic acid sequences encoding the above-mentioned amino acid sequences SEQ ID No.1, SEQ ID No.2, SEQ ID No.3 and SEQ ID No.4, and the corresponding nucleic acid sequences are shown in SEQ ID No.5-SEQ ID No.8, respectively.

[0075] The synthesized gene fragments as shown in SEQ ID No.6 and SEQ ID No.8 were cloned into pPIC9K respectively, and the exogenous target protein sequences were cloned using XhoI and NotI as restriction sites, so that the target fragments were accurately inserted into the secretory vector reading frame containing the secretion signal α-factor, and recombinant plasmids expressing SEQ ID No.1 and SEQ ID No.3 were obtained, named pPIC9K-715 and pPIC9K-719.

[0076] SEQ ID No.5-SEQ ID No.8 are shown below, wherein "CTCGAG" is an XhoⅠ restriction site and "GCGGCCGC" is a NotⅠ restriction site.

[0077] SEQ ID NO.5:

[0078] GGCCCCGCGGCGATCCGGGAGAGCGGGGCCCCCGTGGACCTAAGGGTGAGCCTGGCGCTCCAGGACAGGTGATAGGTGGGGAGGGTCCCGGACTGCCGGGGCGAAAAGGTGATCCTGGCCCGAGCGGTCCTCCTGGACCACGAGGGCCTTTGGGAGATCCCGGGCCTAGAGGACCGCCGGGACTGCCGGGCCTAGAA;

[0079] SEQ ID NO.6:

[0080]

[0081] SEQ ID NO.7:

[0082] GGCGCCCCGGTCCCCCTGGGCCTGTAGGTCCTCGTGGCCGAGACGGGGAGGTCGG

[0083] TGAAAAGGGCGACGAGGGACCACCTGGTGATCCTGGTCTACCGGGTAAAGCGGTGAG

[0084] AGAGGTTTACGTGGCGCCCCAGGAGTGAGAGGCCTAGCCAAGAGGGAGGCAGGAAGG

[0085] CCGGGACCCCCCGGCCCAGTAGGCCCTCGCGGGAGAGATGGAGAGGTTGGCGAGAAA

[0086] GGCGACGAAGGTCCGCCCGGCGATCCAGGGCTGCCCGGGAAGGCGGGGGAACGGGGTTTACGTGGGGCTCGGGCGTCCGCGGGCTAGCA;

[0087] SEQ ID NO.8:

[0088] CTCGAGAAAACGTGAAGCCGGGGGCCCCCGGTCCCCCTGGGCCTGTAGGTCCTCCGTG

[0089] GCCGAGACGGGGAGGTCGGTGAAAGGGCGACGAGGGACCACCTGGTGATCCTGGTCT

[0090] ACCGGGTAAAGCGGGTGAGAGAGGTTTACGTGGCGCCCCAGGAGTGAGAGGCCTAGCC

[0091] AAGAGGGAGGCAGGAAGGCCGGGACCCCCCGGCCCAGTAGGCCCTCGCGGGAGAGAT

[0092] GGAGAGGTTGGCGAGAAAGGCGACGAAGGTCCGCCCGGCGATCCAGGGCTGCCCGGG

[0093] AAGGCGGGGGAACGGGGTTTACGTGGGGCTCCGGGCGTCCGCGGGCTAGCAAAGAGA

[0094] GAGGCGGGTCGTCCAGGGCCCCCCGGGCCGGTGGGACCGCGAGGTCGCGATGGCGAG

[0095] GTCGGGGAAAAAGGAGACGAGGGCCCGCCCGGGGACCCAGGGTTGCCTGGCAAAGCA

[0096] GGTGAACGAGGGTTAAGGGGAGCACCTGGCGTAAGAGGCCTAGCGAAGCGTGAAGCA

[0097] GGGCGGCCTGGACCGCCGGGCCCAGTAGGTCCAAGAGGACGCGACGGTGAAGTAGGC

[0098] GAGAAGGGGGACGAGGGTCCTCCAGGCGATCCAGGACTGCCAGGCAAAGCCGGCGAA

[0099] CGAGGTTTACGGGGTGCACCAGGAGTCCGAGGCCTCGCAAAGCGCGAGGCCGGCAGA

[0100] CCTGGCCCGCCAGGGCCCGTGGGGCCCCGCGGTCGTGATGGTGAAGTCGGGGAGAAGG

[0101] GTGATGAAGGCCCACCCGGTGATCCTGGCCTCCCAGGCAAAGCAGGGGAACGGGGGTT

[0102] GAGAGGGGCGCCAGGGGTAAGGGGATTGGCCAAGCGAGAGGCCGGTCGTCCTGGCCCT

[0103] CCTGGACCAGTGGGTCCAAGAGGAAGGGACGGTGAAGTTGGAGAGAAGGGCGATGAA

[0104] GGGCCACCGGGCGATCCCGGATTACCCGGAAAAGCAGGCGAGCGGGGCTTGCGGGGTG

[0105] CTCCCGGAGTTCGGGGACTAGCGAAGAGGGAAGCAGGGCGCCCTGGCCCCCCCGGCCC

[0106] AGTTGGACCCAGGGGACGGGACGGCGAGGTGGGTGAAAAGGGGGACGAGGGGCCTCC

[0107] AGGGGACCCGGGGCTCCCTGGGAAGGCGGGGGAACGAGGTCTTAGGGGTGCGCCAGG

[0108] CGTCAGGGGGCTGGCCAAACGCGAAGCGGGTCGGCCTGGTCCTCCTGGTCCGGTTGGG

[0109] CCCCGAGGAAGGGACGGTGAGGTGGGAGAAAAGGGGGATGAGGGGCCACCGGGTGAT

[0110] CCTGGATTGCCGGGCAAAGCTGGGGAAAGGGGCCTTCGTGGTGCGCCGGGGGTCAGAG

[0111] GACTTGCTAAACGCGAGGCTGGTCGTCCAGGTCCTCCTGGGCCCGTCGGACCTCGTGGT

[0112] CGGGATGGCGAAGTAGGAGAGAAAGGAGATGAGGGGCCCCCGGGTGATCCGGGACTG

[0113] CCTGGAAAAGCTGGAGAGCGGGGACTTCGCGGAGCCCCCGGAGTTCGAGGATTAGCTA

[0114] AACGTGAAGCCGGTCGCCCCGGACCCCCAGGCCCGGTTGGTCCGCGTGGGAGGGATGG

[0115] AGAAGTGGGTGAGAAGGGAGACGAAGGACCCCCGGGGGACCCGGGCTTACCTGGAAA

[0116] AGCTGGTGAACGAGGGCTGCGTGGTGCTCCGGGTGTGCGGGGTTTAGCTAAGAGATGAGCGGCCGC。

[0117] S3. Construction of recombinant engineering strains and screening of strains:

[0118] 10 μg of the recombinant plasmid obtained in step 2 was linearized with Sal I (Dalian TaKaRa Co.), digested in a metal bath at 37°C for 30 min, and the linearized plasmid was collected by ethanol precipitation to control the volume to about 20 μL.

[0119] The linearized plasmid was electroporated into the host strain Pichia pastoris GS115-HCPB-PPKEX2 (from strain number: CGMCC No. 25815) competent cells, and the electroporated bacterial solution was spread on MD plates to screen His-positive bacteria. Theoretically, 1-10% of His+ transformants will have more than one insertion. If the frequency of multi-copy insertion is 1%, then 1000 His+ transformants will be screened to obtain 10 Resistant colonies, so a large number of single colonies need to be selected for verification and screening.

[0120] The screening steps are:

[0121] Take 200 μL and spread it on MD plate, and culture it in 30℃ biochemical incubator for 2 days. The cells growing on MD plate are His+ transformants by default. Wash the cells on MD plate with sterile water and collect them in sterile EP tubes. After testing OD600, add 5*10 5 The individual bacteria were spread on YPDG (500μg / mL, 1mg / mL, G418) plates, left at room temperature for 10min, and inverted at 30℃ for 2-5 days until single colonies (positive transformants) appeared. The number of single colonies grown on high-concentration antibiotic plates was higher than that on low-concentration antibiotic plates, and high-copy recombinant engineered bacteria were obtained, named GS115-HCPB-PPKEX2 / pPIC9K-715 and GS115-HCPB-PPKEX2 / pPIC9K-719.

[0122] The high-copy recombinant engineered bacteria were sent to the General Microbiology Center of China Microorganism Culture Collection Administration, and the culture collection numbers are: CGMCC No.31991, CGMCC No.31992. Address: No. 3, Yard No. 1, Beichen West Road, Chaoyang District, Beijing; Deposit date: September 18, 2024, Classification name: Pichia pastoris Komagataella phaffii.

[0123] For each sequence, 16 single colonies were picked and placed in 200 mL YPD medium in a 96-well plate and cultured in a 30°C biochemical incubator for 24 h. 80 μL of the bacterial solution was taken to extract the template, and 2 μL of the extracted template was added to a PCR tube for polymerase chain reaction by PCR. After the reaction, the target band was verified by nucleic acid electrophoresis.

[0124] The primers in the above PCR reaction process are:

[0125] 5'AOX:GACTGGTTCCAATTGACAAGC (SEQ ID No. 9);

[0126] 3'AOX:GCAAATGGCATTCTGACATCC (SEQ ID No. 10);

[0127] The conditions of the PCR reaction were as follows: 94°C for 5 min; 94°C for 30 s, 55°C for 30 s, and 72°C for 2 min 15 s for 30 cycles.

[0128] The results of nucleic acid electrophoresis verification are as follows Figure 1 As shown, from Figure 1 It can be seen that the product size is 1900-2200bp, and the 719 target sequences have two close target bands. Some of them have no target bands in the figure. The positive strains with correct target bands in the nucleic acid electrophoresis diagram are selected for the next experiment.

[0129] S4. Induced expression and identification of recombinant collagen:

[0130] The GS115-HCPB-PPKEX2 / pPIC9K-715 and GS115-HCPB-PPKEX2 / pPIC9K-719 engineered bacteria verified by colony PCR were selected and inoculated into 15 mL of BMGY medium and cultured at 28-30°C and 220 rpm until OD600 was 2-15 (16-24 h). Centrifuge at 1500-3000g for 5 min at room temperature, collect the bacteria, resuspend the bacteria in BMMY medium to about 10 OD600, and continue to culture for 3 days in a biochemical incubator at 28-30°C and 220 rpm. Add 0.5% of the final volume of methanol every 24 h, sample after 72 h of induction, and collect the supernatant by centrifugation at 9000g for 5 min at room temperature. The collected expression supernatant was added with 2× loading buffer (Coomassie Brilliant Blue, denaturant DTT, SDS buffer), heated in a 100°C metal bath for 5 min, and then tested with GLASS gel precast gel Tricine protein gel. The test results were as follows: Figure 2 The results showed that the target band could be efficiently secreted and expressed outside the cell, and the molecular weight was consistent with the apparent migration characteristics of collagen, without degradation.

[0131] The expected target bands of 715 and 719 on the GLASS gel Tricine were cut out and digested with trypsin. The peptides of the recombinant collagen after trypsin digestion were detected by Nano-HPLC-MS / MS mass spectrometry (completed by Suzhou Putai Biotechnology Co., Ltd.), and the detected peptides were compared with the theoretical sequence. The test results are as follows: Figure 3 The target band was identified by protein gel mass spectrometry, and the mass spectrometry results showed that the similarity with the theoretical amino acid sequence of protein gel was more than 85%.

[0132] S5. High-density fermentation and purification test:

[0133] (1) The recombinant engineered bacteria selected in step 3 are subjected to a high-density fermentation test to express and produce collagen 715 and 719 on a large scale to obtain a fermentation broth containing recombinant collagen.

[0134] Among them, seed culture medium YPG: yeast powder 10g / L, peptone 20g / L, glycerol 10g / L;

[0135] Fermentation medium: NH4H2PO4 190.4 g / L, KH2PO4 10.06 g / L, CaSO4·2H2O 1.18 g / L, K2SO4 18.2 g / L, MgSO4·7H2O 14.9 g / L, glycerol 40 g / L; after high-temperature sterilization of the fermentation medium, PTM1 was added when the temperature dropped to room temperature, and the pH was adjusted to 5.0 with ammonia water.

[0136] Feed medium: 50% W / V glycerol, plus 12 mL PTM1 trace elements per liter;

[0137] Induction medium: 100% methanol, 12 mL of PTM1 trace elements per liter;

[0138] PTM1: Sterilize by filtering with a 0.22 μm filter membrane and store at 4°C.

[0139] The batch culture conditions and induced expression conditions of the engineering strains are as follows: the batch fed-batch culture method is adopted, and the culture temperature is 30°C. The engineering bacteria are inoculated into a 1L shake flask containing 200mL of seed culture medium YPG, and cultured at 220rpm and 30°C for 18-20h to OD600=2~10. A 5L fermenter (Baoxing Bio) is used, with a liquid volume of 2L of fermentation medium, and 2% glycerol is sterilized separately. Before inoculation, the speed is adjusted to 300rpm, the ventilation volume is 4L / min, and the temperature is 30°C. The pH is adjusted with an alkaline solution prepared with concentrated ammonia water, and the pH is set to 4.5. Then 0.9mL of PTM1 is first inoculated, and then the prepared 200mL seed liquid is inoculated into the tank (flame circle inoculation), and then the dissolved oxygen electrode is clicked to calibrate, and fermentation is started after calibration. When the dissolved oxygen drops to 30% for the first time during growth, the dissolved oxygen cascade speed function is used to maintain 30%; wait for the glycerol to be consumed, the dissolved oxygen rebounds, and the dissolved oxygen is greater than 70% (OD 600 Value is about 20), cancel the dissolved oxygen cascade speed, increase the stirring to 650rpm, use 30% linkage feeding for glycerol, and feed 80mL. Stop feeding glycerol, after the dissolved oxygen rebounds to more than 70%, set pH4 and temperature to 29℃, and use methanol and glycerol mixed carbon source (methanol: 50% glycerol = 7:3) for induction culture. Manually add 5mL, after the dissolved oxygen rebounds to more than 70%, set the feeding rate to 8mL / h, increase to 10mL / h after one hour, and increase again to 20mL / h after one hour. When the dissolved oxygen value is lower than 30%, stop feeding, wait for the dissolved oxygen to rebound, and feed linkage after the dissolved oxygen rises to 30%. After 40-60h of induction, the UV measurement of protein concentration is not obvious or decreases, and the tank can be released.

[0140] UV protein quantification formula: C (mg / mL) = 0.144*(A215-A225), A215<1.5.

[0141] The fermentation supernatant was collected and subjected to protein electrophoresis detection using GLASS gel precast Tricine (16.5%, Shanghai Wansheng Haotian). The sample volume was 5 μL. The test results were as follows: Figure 4 As shown in the figure, under high-density fermentation conditions, each sequence of collagen had almost only the target band after induction, and the main band of optical density analysis accounted for more than 85%.

[0142] (2) Purification:

[0143] Buffer A: 20 mM KH2PO4, pH 4.0;

[0144] Buffer B: 20 ​​mM KH2PO4, 1 M NaCl, pH 4.0.

[0145] The fermentation broth in step (1) was collected, and the cells and the fermentation supernatant were separated by centrifugation at 2000g, 30min, and 4°C. The cation exchange medium was balanced with buffer A (the chromatographic filler was UniGel-80sp produced by Suzhou Nano Micro, loaded on the XK50 / 30 chromatography column produced by Lisui Technology, and the GE AKTA Pure protein separation chromatography purification system was used) until the A215 absorbance and conductivity values ​​remained unchanged, and then the flow rate of 100us / cm was set for loading, and the loading volume was 0.5L / time. The ultraviolet A215 absorbance value was detected. When it rose, the sample was started. When the A215 absorbance value dropped, until the ultraviolet and conductivity dropped to the minimum and no longer changed, the sample was stopped. After the loading was completed, the sample was closed, and the cationic chromatography medium was balanced with buffer A. The eluate was collected, and after the components were detected and determined, dialyzed (the dialysate was ultrapure water), then concentrated and freeze-dried, and freeze-dried collagen sponges, i.e., 715 and 719, were collected.

[0146] Take the purified freeze-dried sponge and dissolve it in ultrapure water, and perform protein electrophoresis. Figure 5 As shown in the figure, it can be seen that bands 715 and 719 are clear and the content of the target band is high.

[0147] Example 2: Recombinant collagen cell adhesion activity experiment

[0148] In this example, natural collagen was used as a control, and collagen 715 and 719 (recombinant type VII collagen with amino acid sequences as shown in SEQ ID No. 1 and SEQ ID No. 3) were used as examples to examine the cell adhesion activity of the recombinant type VII collagen of the present invention.

[0149] The specific steps are as follows:

[0150] (1) Material preparation: Mouse embryonic fibroblast NIH / 3T3 (cell line from the Chinese Academy of Sciences Cell Bank (SCSP-515), culture and subculture methods refer to the cell instructions). Take 715 and 719 collagen freeze-dried sponges, positive natural collagen (Sigma, catalog number C7774-5MG).

[0151] Among them, the processing method of positive control natural collagen is as follows: weigh a 5mL sterile centrifuge tube, add human collagen in a clean bench and weigh it, subtract the weight to get the sample volume, dissolve it with ultrapure water and add acetic acid to pH 3.0 (concentration 5mg / mL), and a milky white solution can be obtained. The protein concentration is determined by the UV protein quantitative empirical formula: C (mg / mL) = 0.144*(A215-A225). When used, dilute the concentration to 0.5mg / mL with serum-free DMEM culture medium and filter sterilize with a 0.22μm sterile filter. (2) Coating preparation:

[0152] 100 μL of samples (standard / sample / blank control) were added to the 96-well plate. Standard: positive control native collagen 0.5 mg / mL (Sigma, catalog number C7774-5MG); Sample: 715 and 719 collagen 0.5 mg / mL; Blank: D-PBS phosphate buffer.

[0153] Prepare 4 wells for each sample coating, incubate in a 37°C, 5% CO2 (v / v) incubator for 1h-4h, remove excess coating solution from the wells, add 100μL 1% BSA-PBS solution, and incubate in a 37°C, 5% CO2 incubator for 1h. After removing the liquid in the wells, wash three times with D-PBS and discard the washing solution. Premix Hoechst-33342 fluorescent dye (10%) with complete culture medium, and dilute NIH / 3T3 cells to 5×10 4 100 μL of cells were added to the wells, covered with aluminum foil, and incubated at 37°C, 5% CO2 for 1 h.

[0154] The specific detection steps are:

[0155] Use an inverted microscope to capture at least 4×4 digital tile images (fluorescence) of each of the 3 wells. Each well is filled with D-PBS to form a "reverse meniscus", purged of bubbles and covered with sealing film. Centrifuge the plate (inverted) at a relative centrifugal force (RCF) of 300g at 22°C for 5 minutes. After centrifugation, discard the sealing film, remove the supernatant from the well, wash once with D-PBS, and add 100μL D-PBS. For each of the 3 wells, a total of 25 fluorescent tile digital images are taken (at least 4×4 matrix is ​​recommended, with 10% tile overlap), and approximately 2400 to 3600 cells are counted for each sample (800-1200 cells / well × 3 wells). Measure 3 replicate samples. The fourth well is used to adjust the microscope parameters and its measurement values ​​are not used. The measurement results are shown in the figure. Figure 6 shown.

[0156] Adhesion experiments of NIH / 3T3 and HaCat cells Figure 6 It can be seen that the sample has stronger adhesion after coating and is better than the blank control group. In NIH / 3T3 cells, the experimental group is more obvious than the blank control group. This is because the 715 sequence contains active binding sites such as whitening sites and active binding sites of complement C1s. Complement C1s is a subunit with catalytic activity in the classical activation pathway and has a significant effect on promoting cell adhesion. The adhesion experiment results show that 719 has a good promoting effect on cell adhesion.

[0157] The efficacy of the 719 sequence is similar to that of 715, and it has a binding site for matrix metalloproteinase-12. Matrix metalloproteinase-12 is an important enzyme protein in the degradation process of the extracellular matrix. It enables white blood cells, fibroblasts and tumor cells to penetrate the matrix by degrading matrix proteins, and participates in inflammatory reactions and tissue repair. Using matrix metalloproteinases (MMPs) as therapeutic targets, designing and searching for antagonists against MMPs, especially drugs that can selectively inhibit MMPs, or drugs that can competitively bind to MMPs is a hot topic in tumor treatment in recent years. The active binding site contained in the 719 polypeptide can competitively bind to matrix metalloproteinase-12, thereby inhibiting white blood cells, fibroblasts and tumor cells from penetrating the matrix. It can be seen that the recombinant type VII collagen of the present invention has cell adhesion similar to that of natural collagen.

[0158] Example 3: Recombinant collagen cell migration experiment

[0159] In this example, NIH / 3T3 cells consistent with those in Example 2 were used to examine the cell migration ability of 715 and 719 collagen freeze-dried sponges and positive control natural collagen (Sigma, catalog number C7774-5MG).

[0160] (1) Experimental preparation: First, use a marker pen to draw horizontal lines evenly on the back of a 6-well plate, using a ruler. Draw lines approximately every 0.5 cm to 1 cm across the wells, with 3 lines drawn across each well. Add approximately 5 × 10 5 cells.

[0161] (2) Scratch test: On the second day of cell culture, use the tip of the gun to measure the ruler and try to scratch perpendicular to the horizontal line on the back. The tip of the gun should be vertical and not tilted. Then rinse the cells with PBS three times, remove the scratched cells, and add serum-free culture medium containing the test sample as the experimental group, with a concentration of 0.05% (mass volume ratio). Place in a 37°C, 5% CO2 incubator for culture, take samples at 0 and 24 hours, and take pictures.

[0162] (3) Data processing: The scratch area of ​​each image was calculated using ImageJ image processing software, and the migration rate of each group of cells was calculated by dividing the total area of ​​the migrating cells in the fixed scratch area by the initial area of ​​the fixed scratch area. The time was used as the horizontal axis and the migration area ratio was used as the vertical axis (unit %). The photos of the experimental group and the control group at the initial time 0 and the end of the experiment were compared. The data differences of each experimental group were analyzed using a one-way ANOVA and the chi-square test. The experimental results are shown in Figure 2. Figure 7 and Figure 8 shown.

[0163] Combination Figure 7 and Figure 8It can be seen that after 24 hours of the migration experiment of NIH / 3T3 and HaCat cells, the cell migration rate of sample group 715 was higher, and 719 had a cell migration promoting effect that was better than the blank control group and similar to the positive control group. This shows that as time goes by, cells continue to grow, and under physiological conditions, the promoting effect of the experimental group samples on cell migration is more obvious, which can effectively promote the migration of cells to biomaterials.

[0164] Example 4: Investigation of the ability to inhibit cell tyrosinase activity

[0165] Melanin is a high molecular biological pigment synthesized by melanocytes, distributed in the dermis of the skin, and the quantity and quality of melanin in the skin are important factors determining skin color. The synthesis of melanin is mainly regulated by tyrosinase, which is the rate-limiting enzyme for the initial reaction of melanin synthesis in an organism. In this embodiment, mouse melanoma cell B16 (derived from C57BL / 6J mouse melanoma, article number: CM3076) is used as the research object, and the inhibition rate of intracellular tyrosinase activity by recombinant type VII collagen of the present invention is determined, so as to evaluate the whitening effect of the recombinant type VII collagen.

[0166] The specific steps are as follows:

[0167] In this example, the blank control was cell culture medium and cells without samples, the positive control was 100 μg / mL α-arbutin, and the experimental groups were 0.01%, 0.03% and 0.1% recombinant type VII collagen 715 and 719.

[0168] B16 cells were cultured at 1×10 4 / well density plated 96-well cell culture plates, PBS rinsed after 24 hours and replaced with experimental group samples diluted with 1640 medium, the blank control group added the same volume of 1640 medium, the positive control group added 100μg / mL α-arbutin and 1640 medium, and each concentration was set up with 3 replicates. After 72 hours of incubation in the cell culture incubator, the supernatant was discarded, rinsed once with PBS, and then 100μL of PBS containing 1% TritonX-100 was added to each well, placed at -80℃ for 30 minutes, incubated at 37℃ to completely rupture the cells, and 50μL of 1×10 -2 mol / L L-DOPA, incubate at 37°C for 30 min, and measure the absorbance at 492 nm.

[0169] Wherein, tyrosinase activity inhibition rate = (1-absorbance of sample group / absorbance of control group)*100%.

[0170] The significant difference P value analysis was performed using GraphPad Prism software. The tyrosinase activity inhibition rate of the positive control was 11.43% ± 3.57%, which was significantly different from that of the blank control (P value 0.00516), indicating that the experimental system was effective; recombinant type VII collagen 715 had no inhibitory effect on tyrosinase activity at the tested concentrations of 0.01%, 0.03%, and 0.1%; 719 had an inhibitory effect on tyrosinase activity at the tested concentrations of 0.01%, 0.03%, and 0.1%.

[0171] from Fig. 9 It can be seen that the tyrosinase activity inhibition rate of the positive control group was 46.12% ± 6.61%, which was significantly different from the blank control (P value < 0.001), indicating that the test system was effective. The tyrosinase activity inhibition rate of 719 at a test concentration of 0.01% was 24.42% ± 9.08%, the tyrosinase activity inhibition rate at a test concentration of 0.03% was 34.50% ± 4.08%, and the tyrosinase activity inhibition rate at a test concentration of 0.1% was 42.64% ± 6.40%, all of which were higher than the blank control. Using GraphPad Prism software, the t-test method was used to analyze the tyrosinase activity inhibition rates of the blank control, positive control, and test samples, and 719 had a significant inhibitory effect on tyrosinase.

[0172] In summary, the recombinant type VII collagen of the present invention can reduce excessive melanin production and deposition by inhibiting the activity of tyrosinase, thereby achieving a whitening effect, and can be used to prepare products with whitening function.

[0173] Example 5: Investigation of melanin synthesis inhibition rate

[0174] In this example, mouse melanoma cells B16 were used as the research object to measure the inhibitory effect of the recombinant type VII collagen of the present invention on melanin synthesis, thereby evaluating the whitening effect of the recombinant type VII collagen of the present invention.

[0175] The specific steps are as follows:

[0176] Blank control: cell culture medium and cells without sample;

[0177] Positive control: 100 μg / mL α-arbutin;

[0178] Experimental groups: 0.01%, 0.03% and 0.1% recombinant type VII collagen 715 and 719.

[0179] B16 cells were cultured at 1×10 4 / well density plate 6-well cell culture plate, culture for 24h, remove the culture medium, rinse with PBS, replace with different concentrations of samples diluted with 1640 culture medium (containing 2% serum). Set up 3 replicates for each concentration. After 72h of culture in the cell culture incubator, discard the supernatant, add 500μL of trypsin to each well for 1-2min, then add complete culture medium to terminate digestion, blow and mix the cells, collect the cell suspension in a centrifuge tube, take a small amount for cell counting, confirm that the number of cells in the blank control group, positive control group and experimental group is similar to eliminate the difference in melanin content caused by the difference in background cell number, so that each component of the experiment is at the same or similar cell number level to compare the melanin content.

[0180] Take 1 mL of cells collected after trypsin digestion and centrifuge at 3000r / min for 10 minutes, discard the supernatant, add 1 mL of 1 mol / L NaOH aqueous solution containing 10% (volume fraction) DMSO, seal the centrifuge tube with a sealing film and heat it in an 80°C water bath for 30 minutes, and measure the absorbance at 405nm. Among them, melanin synthesis inhibition rate = (1-absorbance of sample group / absorbance of control group)*100%.

[0181] The significant difference P value was analyzed by GraphPad Prism software. The melanin synthesis inhibition rate of blank control, positive control and test sample was analyzed by t test method. The significant difference was as follows Fig.10 shown.

[0182] from Fig.10 As can be seen from a, the melanin synthesis inhibition rate of the positive control is 36.58% ± 4.72%, which is significantly different from the blank control (P value 0.00017), indicating that the test system is effective. The melanin synthesis inhibition rate of recombinant type VII collagen 715 at a test concentration of 0.01% is 27.63% ± 9.64%, the melanin synthesis inhibition rate at a test concentration of 0.03% is 35.41% ± 10.28%, and the melanin synthesis inhibition rate at a test concentration of 0.1% is 45.33% ± 5.30%, all of which are higher than the blank control.

[0183] from Fig.10 b It can be seen that the melanin synthesis inhibition rate of the positive control (100 μg / mL α-arbutin) was 17.92% ± 10.37%, which was significantly different from the blank control (P value 0.04022), indicating that the test system was effective. The melanin synthesis inhibition rate of recombinant type VII collagen 719 at a test concentration of 0.03% was 12.37% ± 6.45%, and the melanin synthesis inhibition rate at a test concentration of 0.1% was 27.06% ± 7.02%, both higher than the blank control, while at a test concentration of 0.01%, there was no inhibitory effect on melanin synthesis.

[0184] Therefore, the recombinant type VII collagen 715 of the invention can inhibit melanin synthesis at the tested concentrations of 0.01%, 0.03% and 0.1% to achieve whitening effect, and significant differences are marked in the figure, among which the 0.1% concentration has the best inhibitory effect; 719 has an inhibitory effect on melanin synthesis at the tested concentrations of 0.03% and 0.1%, and the 0.1% concentration has a significant inhibitory effect on melanin compared with the blank control group. The 715 and 719 collagens can inhibit melanin synthesis to achieve whitening effect, and can be used to prepare products with whitening function.

[0185] Example 6: Detection of the antioxidant capacity of recombinant type VII collagen

[0186] DPPH free radical is a very stable nitrogen-centered free radical with a single electron. Its alcohol solution is purple and has strong absorption at 515nm. When an antioxidant is present, the DPPH free radical is scavenged, the color of its solution becomes lighter, and the absorbance at 515nm decreases. Within a certain range, the change in its absorbance is proportional to the degree to which the free radical is scavenged. DPPH free radical is one of the important indicators of antioxidant capacity. This example investigates the DPPH free radical scavenging rate of recombinant type VII collagen to evaluate its antioxidant capacity. The specific investigation steps are as follows:

[0187] (1) Preparation of samples and reagents:

[0188] Reagents were prepared according to the DPPH free radical scavenging ability test kit (colorimetric method, purchased from Bio-Tech (Shanghai) Co., Ltd., catalog number: D799007-0050). Recombinant type VII collagen 715 and 719 were prepared into sample solutions with concentrations of 5 mg / mL and 10 mg / mL respectively using the extraction solution provided in the kit.

[0189] Reagent 1: Anhydrous ethanol.

[0190] Reagent 2: (0.6mL EP tube is placed in an 8mL reagent bottle) Add 6.08mL of reagent 1 and shake to dissolve before use.

[0191] Working solution: Before use, prepare the working solution according to the ratio of reagent 2: reagent 1 (V:V) = 4:21 according to the required amount of the test, and use it immediately after preparation.

[0192] Reagent 3: 10 mg vitamin C, stored at 4°C. Add 1 mL of extract solution before use and shake thoroughly to dissolve; prepare a 10 mg / mL vitamin C solution for positive control.

[0193] (2) Reagent addition:

[0194] Blank tube: 25 μL of extraction solution plus 975 μL of working solution;

[0195] Experimental group: 25 μL sample solution plus 975 μL working solution to obtain experimental groups with different concentrations of recombinant type VII collagen 715 and 719;

[0196] Positive control group: 5 mg / mL and 1 mg / mL vitamin C solution plus 975 μL working solution;

[0197] Standard group: Vitamin C solutions with concentrations of 0.3, 0.25, 0.125, 0.0625, 0.03125, and 0.015625 mg / mL were prepared using the extract. 25 μL of vitamin C solutions of different concentrations were taken and mixed with 975 μL of working solution to obtain the standard group.

[0198] (3) Detection:

[0199] Preheat the spectrophotometer for more than 30 minutes and adjust the wavelength to 515nm. Add the solution to the above detection wells completely and mix well. Let it stand at room temperature and avoid light for 30 minutes, and detect the absorbance at 515nm. Zero it with anhydrous ethanol before detection. The blank tube only needs to be measured 1-2 times. The experimental results are shown in Table 1.

[0200] Table 1. DPPH free radical scavenging rate of recombinant type VII collagen

[0201]

[0202] As can be seen from Table 1, the main function of sequences 715 and 719 is whitening, and the antioxidant effect is not obvious. Compared with the existing antioxidant vitamin C, small molecule collagen peptides are more versatile and are synthesized in vitro using biotechnology, with better biosafety and immunity.

[0203] Embodiment 7:

[0204] Under the experimental conditions of this example, recombinant collagen 715 and 719 were used as samples to investigate the cytotoxicity of the recombinant type VII collagen of the present invention. Referring to the method provided by the standard YY / T 1849-2022 recombinant collagen, mouse melanoma cells B16 (derived from C57BL / 6J mouse melanoma, item number: CM3076) were used to perform biological function tests on recombinant type VII collagen.

[0205] The specific inspection steps are as follows:

[0206] Blank control: cell culture medium and cells without sample;

[0207] Positive control: 100 μg / mL α-arbutin;

[0208] Experimental groups: 0.01%, 0.03% and 0.1% recombinant type VII collagen 715 and 719.

[0209] (1) Test equipment and consumables

[0210] B16 (mouse melanoma cells), 1640 medium

[0211] 96-well cell culture plate, 6-well cell culture plate, microplate reader, CCK-8 kit

[0212] (2) Test methods

[0213] Cytotoxicity assay: B16 cells were cultured at 1×10 4 / well density plated 96-well cell culture plate, 24 hours later, PBS was washed and replaced with samples of different concentrations diluted with 1640 culture medium, and 3 replicates were set for each concentration. After 72 hours of cell culture incubator, CCK-8 was added, and cytotoxicity was detected at 450nm wavelength using an enzyme marker. The test results are shown in Fig.11 shown.

[0214] CCK-8 test results: Cell survival rate (%) = (As-Ab) / (Ac-Ab) × 100%

[0215] As is the absorbance of the sample to be tested, Ab is the absorbance of the blank sample group, and Ac is the absorbance of the negative sample group.

[0216] from Fig.11 It can be seen that 715 and 719 had no effect on cell activity at concentrations of 0.1%, 0.03% and 0.01%, and the absorbance values ​​were similar to those of the positive control group, indicating that they were not cytotoxic. They promoted cell growth at concentrations of 0.03% and 0.01%.

[0217] In summary, the present invention has discovered recombinant type VII collagen with whitening effect through research, and used genetic engineering technology as a means to increase the expression amount of recombinant type VII collagen, and used the eukaryotic Pichia pastoris expression system to express and produce recombinant type VII collagen; the recombinant type VII collagen of the present invention is expressed in Pichia pastoris, can be efficiently secreted and expressed extracellularly, is not easily degraded during the purification stage, and reduces the difficulty of purification; the recombinant type VII collagen has excellent whitening effect and is suitable for sensitive skin, will not cause skin irritation, itching, burning, and has good practicality.

[0218] The embodiments are preferred implementations of the present invention, but the present invention is not limited to the above-mentioned implementations. Any obvious improvements, substitutions or modifications that can be made by those skilled in the art without departing from the essential content of the present invention belong to the protection scope of the present invention.

Claims

1. Recombinant type VII collagen with whitening effect, characterized in that: The recombinant type VII collagen comprises a binding site for a whitening action site; the whitening action site comprises one or more of MC1-R, MC4-R, GRM6, TRPM1 or MET.

2. The recombinant type VII collagen with whitening effect according to claim 1, characterized in that: The recombinant type VII collagen also comprises a binding site for one or more action sites of anti-aging, anti-wrinkle or soothing effects; The action sites of anti-aging, anti-wrinkle or soothing effects include one or more of TRPV1, IL1R1, and MT-CO2.

3. The recombinant type VII collagen with whitening effect according to claim 1 or 2, characterized in that: The sequence of the recombinant type VII collagen is shown in i or ii: i. The amino acid sequence is shown in SEQ ID No.1, SEQ ID No.2, SEQ ID No.3 or SEQ ID No.4; ii. A protein derived from i, wherein the amino acid sequence in i is substituted, deleted or added with one or more amino acids and has human collagen activity.

4. The nucleic acid encoding the recombinant type VII collagen with whitening effect according to any one of claims 1 to 3, characterized in that: The nucleic acid sequences are shown as SEQ ID No.5-SEQ ID No.

8.

5. A recombinant expression vector, characterized in that: The recombinant expression vector comprises the nucleic acid of claim 4.

6. A recombinant engineered bacterium, characterized in that: Comprising the nucleic acid of claim 4 or the recombinant expression vector of claim 4.

7. The recombinant engineered bacterium according to claim 6, characterized in that The host bacteria of the recombinant engineering bacteria include one of Pichia pastoris, Saccharomyces cerevisiae and Hansenula.

8. The recombinant engineered bacterium according to claim 7, characterized in that The host cell is Pichia pastoris.

9. The recombinant engineered bacterium according to claim 8, characterized in that The host cell is GS115-HCPBPPKEX2, and its deposit number is CGMCC No.25815.

10. The recombinant engineered bacterium according to claim 6, characterized in that: The recombinant engineered bacteria are deposited in the General Microbiological Center of China Microorganism Culture Collection Administration, with the deposit numbers of CGMCC No.31991 and CGMCC No.31992.

11. The method for preparing the recombinant type VII collagen with whitening effect according to any one of claims 1 to 3, characterized in that: The preparation method comprises: (1) selecting and designing a sequence of recombinant type VII collagen, and then constructing a collagen tandem sequence by tandemly repeating the recombinant type VII collagen as a basic unit; (2) constructing a recombinant plasmid expressing the collagen tandem sequence, and linearizing the recombinant plasmid to obtain a linearized plasmid; (3) electroporating the linearized plasmid into a host bacterium, screening and verifying to obtain a high-copy recombinant engineered bacterium; (4) fermenting and inducing the expression of the high-copy recombinant engineered bacteria, and then purifying to obtain recombinant type VII collagen; 12. The preparation method according to claim 11, characterized in that: In step (1), the recombinant type VII collagen contains a binding site for a whitening action site; the whitening action site includes one or more of MC1-R, MC4-R, GRM6, TRPM1 or MET.

13. The preparation method according to claim 12, characterized in that: The recombinant type VII collagen also comprises a binding site for one or more action sites of anti-aging, anti-wrinkle or soothing effects; The action sites of anti-aging, anti-wrinkle or soothing effects include one or more of TRPV1, IL1R1, and MT-CO2.

14. The preparation method according to claim 12 or 13, characterized in that: The sequence of the recombinant type VII collagen is shown in i or ii: i. The amino acid sequence is shown in SEQ ID No.1, SEQ ID No.2, SEQ ID No.3 or SEQ ID No.4; ii. A protein derived from i, wherein the amino acid sequence in i is substituted, deleted or added with one or more amino acids and has human collagen activity.

15. The preparation method according to claim 11, characterized in that: In step (1), the collagen tandem sequence comprises 8 to 10 basic unit recombinant type VII collagens; and there is a site for recognition and cleavage by Kex2 enzyme or Ste13 enzyme between two adjacent basic units.

16. The preparation method according to claim 15, characterized in that: The recognition and cleavage sites include KR or RR dibasic amino acid residues, followed by EA, EAEA or other amino acid residues that facilitate cleavage by Kex2 enzyme or Ste 13 enzyme.

17. The preparation method according to claim 11, characterized in that: In step (1), the nucleic acid of the collagen tandem sequence includes a nucleotide sequence as shown in SEQ ID No. 6 or SEQ ID No. 8, or a degenerate sequence thereof.

18. The preparation method according to claim 11, characterized in that: In step (2), the vector of the recombinant plasmid includes pPICZαB, pFLDα, and pPIC9K, and the connection site is between XhoI and NotI.

19. The preparation method according to claim 18, characterized in that: The vector is pPIC9K.

20. The preparation method according to claim 11, characterized in that: In step (3), the host bacteria includes one of Pichia pastoris, Saccharomyces cerevisiae, and Hansenula.

21. The preparation method according to claim 11, characterized in that: In step (3), the recombinant engineered bacteria are deposited in the General Microbiological Center of China National Microbiological Culture Collection Administration with the deposit numbers CGMCC No.31991 and CGMCC No.31992.

22. Recombinant type VII collagen prepared by the method according to any one of claims 11 to 21.

23. Use of the recombinant type VII collagen according to any one of claims 1 to 3 or the recombinant type VII collagen prepared by the method according to any one of claims 11 to 21 in whitening, anti-aging, anti-wrinkle or soothing products.

24. A whitening, anti-aging, anti-wrinkle or soothing product, characterized in that: The product comprises the recombinant type VII collagen described in any one of claims 1 to 3, or the type VII collagen encoded by the nucleic acid described in claim 4, or the recombinant vector described in claim 5, or the type VII collagen obtained by the method described in any one of claims 11 to 21.

Images