Preparation and application of a DNA nanostructure capture probe lateral flow chromatography test strip

Abstract

The present invention discloses the preparation and application of a DNA nanostructure capture probe lateral flow chromatography test strip, which belongs to the field of molecular biological detection and includes the following steps: 1) synthesis and modification of colloidal gold nanoparticles, 2) preparation of tetrahedral nanostructure probes, and 3) preparation of a test strip, which includes a sample pad, a gold label pad, a nitrocellulose membrane and a water absorbent pad. The test strip biosensor shows high sensitivity and great application potential in the actual detection of exosome microRNA‑150‑5p. Therefore, the discovered and verified DNA nanostructure probe provides a general method for constructing a biosensing interface on a test strip platform, which can be applied to nucleic acid marker detection and non-nucleic acid marker detection such as cells, exosomes, proteins and small molecules, and has excellent application prospects for on-site analysis or bedside detection. The constructed ratiometer test strip provides a new POCT detection method for exosome microRNA detection.

Description

Technical Field

[0001] The invention relates to the technical field of molecular biosensing, in particular to the preparation and application of a DNA nanostructure capture probe lateral flow chromatography test strip. Background Art

[0002] Lateral flow test strips (LFTS) are an important point-of-care testing (POCT) platform. Due to their superior portability, reliability, ease of use, rapid detection time and cost-effectiveness, test strip sensors show great potential in local clinics, home diagnosis, regional airports and remote areas for use by untrained personnel with limited instrument resources. In addition to the most well-known home pregnancy test, LFTS is also widely used as a rapid test for tumors, bacteria, viruses and toxins. In particular, LFTS, as the most promising field format, has shown great application value in the rapid diagnosis of the highly contagious SARS-CoV 2 virus. Among these sensing strategies, the commonly used LFTS assay formats are sandwich and competitive assays based on antibody-antigen reactions, called lateral flow immunoassays (LFIA). However, the use of antibodies as sensing elements in LFIA usually has some limitations, including high production costs, long production time and poor thermal stability. In addition, the production of antibodies against non-immunogenic or toxic targets is difficult. Recently, researchers have attempted to adopt nucleic acid-based sensing strategies as an alternative. Such aptamers (unique nucleotides selected by systematic evolution of ligands through exponential enrichment procedures) are used to detect non-nucleic acid targets instead of antibodies. Meanwhile, a variety of nucleic acid amplification strategies have been adopted in LFTS to detect nucleic acid and non-nucleic acid targets of tumors and pathogens related to human and environmental health. Oligonucleotides used in the test have the characteristics of high reproducibility, high stability and low production cost, and are easy to modify or customize with functional groups, including cleavage, deletion, substitution, fusion and elongation, which largely solves the limitations existing in antibody-dependent lateral flow immunoassays. In nucleic acid-based LFTS, synthetic oligonucleotides are usually designed as barcodes on test lines and quality control lines for identifying capture conjugates, biorecognition elements or amplification elements. However, the barcode capture probe needs to be linked to a protein molecule in advance to form a protein-nucleic acid complex to avoid its self-mobility as the sample flows through. Even if used as a recognition or amplification element, the oligonucleotide usually needs to be modified with at least one functional molecule to react with the antibody or streptavidin immobilized in the sensing interface area. The reliance on antibodies or other protein molecules for the construction of the LFTS sensing interface makes its application less practical or user-friendly when considering the recognition capture step. In theory, the multi-analyte detection capability of LFTS is limited by the types of antibodies used as capture molecules in the sensing interface region.

[0003] DNA nanotechnology is a nanoscale self-assembly technology that uses DNA molecules as building blocks and DNA programmability, combined with reduced costs and improved DNA synthesis quality, allowing us to rationally design and precisely control nucleic acid molecular circuits, machines, and nanostructures. Among DNA circuits, catalytic hairpin assembly (CHA) circuits are an attractive isothermal amplification method for enzyme-free, efficient, and amplified detection of target targets in in vitro diagnostics, RNA imaging (Qing et al., 2021; Li et al., 2022), or sensing detection of other molecules recognized by nucleic acid aptamers in living cells. By introducing a trigger sequence, the CHA circuit undergoes a programmed process of continuous opening and assembly of the hairpin structure through a series of strand displacement reactions, thereby achieving CHA-based isothermal signal amplification in a short time. DNA tetrahedron (DT) is one of the simplest DNA polyhedrons assembled from four single-stranded DNAs, originally reported by Turberfield and colleagues. This three-dimensional structure exhibits remarkable properties, including excellent addressability, controllability, cargo loading capacity, biocompatibility, and stability. It has been applied to electrochemical platforms for the detection of nucleic acids, proteins, small molecules, and cells. Further, DT has been extended to various biosensing strategies including fluorescence detection, electrochemiluminescence, transistor sensors, photoelectrochemical biosensors, intracellular imaging, cell membrane monitoring, and multiplex analysis of subcellular protein distribution.

[0004] However, DNA tetrahedron (DT) has not yet been proposed and explored for application in the construction of lateral flow chromatography test strip biosensor interface. Lateral flow chromatography test strip (LFTS) is an extremely simple and valuable rapid diagnostic technology. The present invention designs and constructs a DNA tetrahedron nanostructured probe sensing interface on the lateral flow chromatography test strip detection platform for the first time, and explores and confirms a new method for constructing a DNA nanostructured probe sensing interface through experimental research. The DNA nanostructured probe method solves the dependence on protein molecules such as antibodies or streptavidin in the construction of lateral flow chromatography test strip oligonucleotide sensing interface, greatly improving the application simplicity and application expansibility of nucleic acid strategy test strips. A variety of DNA nanostructured probe sensing interfaces can be constructed through strategies such as programmed design or chemical modification to achieve specific detection of nucleic acid markers and various non-nucleic acid targets such as cells, proteins and small molecules. Furthermore, combined with different nucleic acid amplification strategies, ultra-sensitive detection of nucleic acid markers and non-nucleic acid markers can be achieved at the DNA nanostructured probe sensing interface.

[0005] Exosomes are vesicles with an average diameter of 30-150 nm and are important biomarkers for liquid biopsy. Exosomal microRNA (exo-miRNA), as a nucleic acid component in exosomes, may provide multiple sets of molecular diagnostic information. We first proposed a DNA nanostructured probe sensing interface on a nitrocellulose membrane of a lateral flow chromatography test strip to immobilize functionalized gold nanoparticles (AuNPs) flowing through it, and developed a ratiometric test strip for sensitive detection of exo-miRNA by combining the DNA tetrahedral nanostructured probe sensing interface with CHA isothermal amplification technology. By taking advantage of the DT properties, such as spatial controllability, stability, probe loading capacity, and probe protection against nuclease-mediated degradation, the nanostructured probes are easy to hyperlink with the designed streptavidin-coated colloidal gold (SA-AuNPs), forming red lines in the test area and the quality control area. The DNA nanostructured probe solves the problem of nucleic acid capture probes moving with the sample. CHA isothermal amplification technology enhances the visual signal in exo-miRNA detection. Ratiometric test strip sensors allow us to read the concentration of exo-miRNA by eye or to quantify exo-miRNA with high sensitivity using a test strip analyzer. Summary of the invention

[0006] The purpose of the present invention is to overcome the above-mentioned background technical difficulties and provide a preparation method and application of a DNA nanostructure capture probe lateral flow chromatography test strip.

[0007] In order to achieve the above purpose, the technical solution adopted is:

[0008] A method for preparing a lateral flow chromatography test strip based on a DNA nanostructure capture probe, characterized in that it comprises the following steps:

[0009] 1) Synthesis and modification of colloidal gold nanoparticles

[0010] Synthesized spherical colloidal gold nanoparticles AuNPs were prepared by reducing HAuCl4 solution with citrate, and AuNPs were mixed with K2CO3 solution and streptavidin at concentrations of 0.5 mM and 2 μg / mL, respectively; the mixture was then shaken on a mixer for 60 min, and bovine serum albumin with a final mass concentration of 0.1% was added as a blocking agent at room temperature for 20 min; the mixture was then centrifuged at 12000 rpm for 15 min to collect the red precipitate, thus obtaining streptavidin-modified colloidal gold nanoparticles SA-AuNPs;

[0011] 2) Preparation of tetrahedral nanostructured probes

[0012] The nucleic acid encoding of the capture probe was designed for the four strands of the DNA tetrahedron, so that the capture probe region was complementary to the partial region sequence of the hairpin probe H1; the four strands used to form the tetrahedral nanostructure probe were mixed in equal molar amounts in a buffer solution of 20 mm Tris, 50 mm MgCl2, pH 8.0 at 95°C, and then cooled to 4°C;

[0013] 3) Preparation of test strips

[0014] The laminar flow chromatography test strip consists of four parts: a sample pad, a gold label pad, a nitrocellulose membrane, and a water-absorbing pad; all four components are mounted on a common backing layer; the sample pad made of glass fiber is soaked in a buffer containing 20 mM Tris-HCl, 0.5% Tween-20, 2.0% sucrose by mass concentration, and 150 mM NaCl pH 7.3; then, the sample pad is dried at 37°C for 2 hours; the gold label pad is prepared by dispensing 5 μL of streptavidin-labeled colloidal gold solution SA-AuNPs onto the glass fiber pad, and the pad is dried at 35°C for 1 hour and then stored at 4°C;

[0015] To construct a DNA tetrahedral nanoprobe sensing interface, use a pipette to apply 1 μL of tetrahedral capture probe as a spot on the test area, then dry the membrane at 37 °C for 1 hour, assemble the sample pad, gold label pad, nitrocellulose membrane, and absorbent pad on a plastic adhesive backing with 1-2 mm overlap, and cut the assembled plate into 3 mm wide test strips.

[0016] Furthermore, in the step 3), a DNA tetrahedral nanoprobe sensing interface is constructed, including a test area and a quality control area detection line, which is executed by a HM3035 XYZ platform dispenser, dispensing 2 μM DNA tetrahedral nanostructure probe or 2 μM biotinylated tetrahedral nanostructure probe at a speed of 2 μL / cm, and the distance between the test area and the quality control area is about 5 mm.

[0017] And the application of the above-mentioned lateral flow chromatography test strip based on DNA capture probe for visual detection of exosomal microRNA.

[0018] The present invention proposes a novel ratiometric test strip sensor based on DNA tetrahedron nanostructured probes and catalytic hairpin self-assembly. The sensor increases the intensity of red visual signal in the test line and reduces the red visual signal in the quality control line. DNA tetrahedrons have been widely used to explore various biosensors for in vitro diagnosis and in situ detection of cells and cell surfaces. At present, DNA nanostructured probes have not been used in lateral flow chromatography test strips, which are very important rapid sensing detection platforms for the actual detection of different target species in clinical practice. This study first proposed a new method for preparing a sensing detection interface in the sensing detection area of ​​the test strip using DNA tetrahedron nanostructured probes, which solved the preparation problem that nucleic acid probes must be connected to protein molecules to form macromolecular complexes. Due to the use of CHA circuits and ratio strategies, a minimum detection limit of 54.75 fM was achieved in a wide linear range of 100 fM to 10 nM. The test strip biosensor showed high sensitivity and great application potential in the actual detection of exosomal microRNA-150-5p. Therefore, the DNA nanostructure probe discovered and verified provides a universal method for constructing a biosensing interface on a test paper platform, which can be applied to the detection of nucleic acid markers and non-nucleic acid markers such as cells, exosomes, proteins and small molecules, and has excellent application prospects for on-site analysis or bedside detection. The ratiometer test strip constructed provides a new POCT detection method for the detection of exosome microRNA. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 The present invention demonstrates the feasibility of the lateral laminar flow test paper based on the DNA tetrahedral nanostructure probe.

[0020] Figure 2 The present invention conducts in-depth research on lateral laminar flow test paper based on tetrahedral nanostructure capture probes by changing different experimental conditions.

[0021] Figure 3 Preparation and characterization of modified AuNPs in the present invention.

[0022] Figure 4 The present invention is a feasibility study on the exosome microRNA-150-5p ratiometer test strip sensor based on tetrahedral nanostructure probes and CHA circuits.

[0023] Figure 5 This is a sensitivity analysis of the test paper of the present invention.

[0024] Figure 6 This is the specific analysis of the test paper of the present invention.

[0025] Figure 7 This is the detection of exosomal mocroRNA-150-5p in HK-2 cells in the present invention.

[0026] Figure 8 The real-time fluorescence quantitative PCR method of the present invention is to determine miRNA-150-5p in total RNA extracted from HK-2 cell exosomes.

[0027] Figure 9 The present invention provides a design strategy for a lateral flow chromatography test strip based on a DNA tetrahedral nanostructure capture probe.

[0028] Figure 10 Schematic diagram of a ratiometric test strip sensor for detecting exosomal microRNA-150-5p based on a tetrahedral nanostructure capture probe and a catalytic hairpin assembly circuit according to the present invention. DETAILED DESCRIPTION

[0029] The technical scheme of the present invention is clearly and completely described below in conjunction with the specific embodiments of the present invention. The described embodiments are only part of the embodiments of the present invention, not all. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative work are within the scope of protection of the present invention.

[0030] We designed and constructed a lateral flow chromatography test strip sensing interface based on DNA tetrahedral nanostructure capture probes. Through experiments, we found and confirmed that the sensing interface can effectively capture colloidal gold (AuNPs) flowing through the sensing interface area. The lateral flow chromatography test strip sensing interface usually requires the fixation of protein molecules such as antigens or antibodies for the detection of corresponding antibodies or antigens, while for lateral flow chromatography test strips based on nucleic acid strategies, nucleic acid probes are usually pre-connected with protein molecules such as antibodies or streptavidin to form a macromolecular protein-nucleic acid complex to construct a test strip sensing interface for nucleic acid molecule recognition and capture to achieve detection. The present invention found that the nucleic acid probe encoding is designed in the DNA tetrahedral nanostructure to serve as a biological probe to identify and capture nucleic acid target molecules or non-nucleic acid target molecules, which solves the problem of dependence on protein molecules in the detection of lateral flow chromatography test strip sensing interface that nucleic acid probes must be pre-connected with protein molecules to form a protein-nucleic acid complex, thereby developing a new method for constructing a lateral flow chromatography test strip sensing interface based on DNA nanostructure probes. DNA nanostructure probes can be programmed to design nucleic acid sequences to identify and capture nucleic acid targets. DNA nanostructure probes can also be programmed to design functional nucleic acid molecules such as aptamers to identify proteins, cells, exosomes and small molecules. DNA nanostructure probes can also be chemically modified to connect small molecule chemicals to identify and capture more nucleic acid and non-nucleic acid targets. Through different extended designs, a new method is provided for the construction of lateral flow chromatography test strip sensing interfaces based on DNA nanostructure probes. Furthermore, the DNA tetrahedral nanostructure probe sensing interface and catalytic hairpin structure self-assembly (CHA) are used to detect exosomal microRNA (exo-miRNA). The DNA tetrahedral nanostructure probe is designed using nucleic acid barcode sequences or directly modified with biotin to construct the sensing interfaces of the test area and quality control area of ​​the test strip, respectively, to achieve molecular recognition capture and target molecule detection. The CHA catalytic hairpin structure self-assembly system consists of two substrate hairpin probes, which can form a stable duplex through a programmable assembly reaction triggered by exosomal microRNA. The duplex formed not only hybridizes with the DNA tetrahedral nanostructure probe through complementary sequences, but also binds to the streptavidin-modified colloidal gold (SA-AuNPs) through biotin. Through these recognition capture procedures, the test area will show a red line due to the fixation of SA-AuNPs on the DNA nanostructure probe sensing interface area. The remaining SA-AuNPs are captured by the biotinylated DNA tetrahedral sensing interface in the quality control area. Since the barcode tetrahedral probe and the biotinylated tetrahedral probe consume SA-AuNPs at the same time, the increase in the test line signal will cause the decrease in the signal on the quality control line, thus forming a ratiometric test strip.Using a strategy based on DNA tetrahedral nanostructured probe sensing interface to solve the problem of capture probes in the sensing interface region moving with the sample flow, the ratiometric test strip showed a minimum detection limit of 54.75 fM and high selectivity. The DNA nanostructured probe-based test strip is expected to become one of the most convenient biosensing platforms for untrained personnel, thereby providing a reliable method for the rapid and accurate diagnosis of nucleic acid biomarkers such as exosomal microRNA or nucleic acid biomarkers.

[0031] 1.1 Materials and reagents

[0032] Trisodium citrate (C6H5Na3O7), HAuCl4•3H2O, Tween-20, and tris-(hydroxymethyl)aminomethane (Tris) were ordered from Shanghai Shenggong Biotechnology Co., Ltd. Streptavidin was purchased from Solarbio Technology Co., Ltd. Phosphotungstic acid hydrate was purchased from Adamas-beta. Sample pads, gold label pads, absorption pads, and backing layers were purchased from Shanghai Jieyi Company, and nitrocellulose membranes were purchased from Millipore. All oligonucleotides listed in Table 1 were synthesized and purified by Qingke Biotechnology Co., Ltd. The HM3035 XYZ platform purchased from Shanghai Jinbiao Company was used to prepare the test line and control line. The color intensity was measured by the GIC-H1 portable colloidal gold immunoassay analyzer from Suzhou Hemai Precision Instrument Co., Ltd. Atomic force microscope (AFM) images of DNA tetrahedrons were scanned by Bruker Dension Icon, Germany. Transmission Electron Microscope (TEM) images were acquired using a JEOL-1400Plus operating at 300 kV. Nanoparticle tracking analysis (NTA) was performed using a ZetaView PMX 110 (ParticleMetrix, Meerbusch, Germany). Agarose gel electrophoresis (AGE) was performed on an electrophoresis analyzer (Six One Instruments, China) and then imaged on a Bio-rad ChemDoc XRS (Bio-Rad, USA). Other reagents and chemicals were of analytical grade.

[0033] Table 1. Information of oligonucleotides used in this study.

[0034] Name Sequences MicroRNA-150-5p UCUCCCAACCCUUGUACCAGUG Mutation 1 <![CDATA[U A UCCCAACCCUUGUACCAGUG]]> Mutation 2 <![CDATA[UCUCCCAACC A SICK G CAGUG]]> Random UUUCGAAGUCAAAGACUUCAGA mir-21-5p UAGCUUAUCAGACUGAUGUUGA Strand A13-3B ACACTACGTCAGAACAGCTTGCATCACTGGTCACCAGAGTAAAAAAAAAACCCTAGTCATTGGAGGTGACAAAAA-TEG-Biotin Strand B13-3B ACGAGCGAGTTGATGTGATGCAAGCTGAATGCGAGGGTCCTAAAAA- TEG-Biotin Strand C13-3B TCAACTCGCTCGTAACTACACTGTGCAATACTCTGGTGACCAAAAA- TEG-Biotin Strand D13-3B TCTGACGTAGTGTATGCACAGTGTAGTAAGGACCCTCGCATAAAAA- TEG-Biotin Strand A13-T GCTTCATCTGACCTACTGTGAAAAAAAAAAACACTACGTCAGAACAGCTTGCATCACTGGTCACCAGAGTA Strand B13-T GCTTCATCTGACCTACTGTGAAAAAAAAAAACGAGCGAGTTGATGTGATGCAAGCTGAATGCGAGGGTCCT Strand C13-T GCTTCATCTGACCTACTGTGAAAAAAAAAATCAACTCGCTCGTAACTACACTGTGCAATACTCTGGTGACC Strand D13-T GCTTCATCTGACCTACTGTGAAAAAAAAAATCTGACGTAGTGTATGCACAGTGTAGTAAGGACCCTCGCAT Strand B13 ACGAGCGAGTTGATGTGATGCAAGCTGAATGCGAGGGTCCT Strand C13 TCAACTCGCTCGTAACTACACTGTGCAATACTCTGGTGACC Strand D13 TCTGACGTAGTGTATGCACAGTGTAGTAAGGACCCTCGCAT Hairpin 1-13 GGTCAGATGAAGCTCCCTTGTACCAGTGAGACTTCTAGACGTACTTGCTCACTGGTACAAGGGTTGGGAGA Hairpin 1-15 TAGGTCAGATGAAGCTCCCTTGTACCAGTGAGACTTCTAGACGTACTTGCTCACTGGTACAAGGGTTGGGAGA Hairpin 1-17 AGTAGGTCAGATGAAGCTCCCTTGTACCAGTGAGACTTCTAGACGTACTTGCTCACTGGTACAAGGGTTGGGAGA Hairpin 1-19 ACAGTAGGTCAGATGAAGCTCCCTTGTACCAGTGAGACTTCTAGACGTACTTGCTCACTGGTACAAGGGTTGGGAGA Hairpin 1-21 TCACAGTAGGTCAGATGAAGCTCCCTTGTACCAGTGAGACTTCTAGACGTACTTGCTCACTGGTACAAGGGTTGGGAGA Hairpin 2 Biotin-TEG-ACTTCTAGACGTACTTGCTTGTACCAGTGAGCAAGTACGTCTAGAAGTCTCACTGG Forward primer CGGGCTCTCCCAACCCTTGTA .

[0035] 1.2 Synthesis and modification of colloidal gold nanoparticles

[0036] According to previous literature, HAuCl4 solution was reduced by citrate to prepare synthetic spherical colloidal gold nanoparticles (AuNPs). AuNPs were mixed with K2CO3 solution and streptavidin to reach concentrations of 0.5 mM and 2 μg / mL, respectively. The mixture was then shaken on a mixer for 60 min, and then bovine serum albumin with a final concentration of 0.1% (w / v) was added as a blocking agent at room temperature for 20 min. Subsequently, the mixture was centrifuged at 12000 rpm for 15 min to collect the red precipitate, which was streptavidin-modified colloidal gold nanoparticles (SA-AuNPs). Finally, the synthesis and modification of AuNPs were characterized by TEM images and UV-visible spectroscopy.

[0037] 1.3 Preparation of tetrahedral nanostructured probes

[0038] The nucleic acid encoding design of the capture probe was carried out for the four strands of the DNA tetrahedron, so that the capture probe region was complementary to the partial region sequence on the hairpin probe (H1). The four strands used to form the tetrahedral nanostructured probe were mixed in equal molar amounts in a buffer (20 mm Tris, 50 mm MgCl2, pH 8.0) at 95 °C and then cooled to 4 °C. The formed tetrahedral nanostructured probe was stored at 4 °C for future use.

[0039] 1.4 Agarose gel electrophoresis

[0040] To verify the assembly of DNA tetrahedral nanostructure probes and CHA circuits, 2% agarose gel electrophoresis was used for analysis. Electrophoresis was performed at 100 V in 1× TBE buffer (90 mM Tris-borate and 1 mM EDTA, pH 8.0) for about 35 min. Next, the gel was photographed under UV light by a Bio-Rad ChemDoc XRS imaging system (Bio-Rad, USA).

[0041] 1.5 Atomic force microscopy (AFM) imaging

[0042] For imaging, 10 μL of DNA sample was deposited on a polished silicon wafer for 10 min, washed with 30 μL of water, and then dried at 37 ° C. AFM images were acquired using a Bruker Dension Icon scanner from Germany.

[0043] 1.6 Preparation of ratiometric lateral flow biosensor strips

[0044] The laminar flow chromatography test strip consists of four parts: sample pad, gold label pad, nitrocellulose membrane and absorbent pad. All these components are mounted on a common backing layer. The sample pad made of glass fiber was soaked in a buffer (pH 7.3) containing 20 mMTris-HCl, 0.5% Tween-20, 2.0% (w / v) sucrose and 150 mM NaCl. Then, the sample pad was dried at 37 °C for 2 h and stored in a desiccator at room temperature for future use. The gold label pad was prepared by dispensing 5 μL of streptavidin-labeled colloidal gold solution (SA-AuNPs) onto the glass fiber pad. The pad was dried at 35 °C for 1 h and stored at 4 °C. Two methods were used to construct the DNA tetrahedral nanoprobe sensing interface. In the first method, 1 μL of tetrahedral capture probe was applied as a droplet on the test area using a pipette. The second method, performed by the HM3035 XYZ platform dispenser, was used for test area and quality control area preparation for test lines. The test area and quality control area on the nitrocellulose membrane were prepared by dispensing 2 μM DNA barcode tetrahedral nanostructure probes or 2 μM biotinylated tetrahedral nanostructure probes at a rate of 2 μL / cm, respectively. The distance between the test area and the quality control area was about 5 mm. The membrane was then dried at 37°C for 1 hour. Subsequently, the sample pad, gold label pad, nitrocellulose membrane and absorbent pad were assembled on a plastic adhesive backing with a 1-2 mm overlap position to ensure the migration of the sample flow. Finally, the assembled plate was cut into 3 mm wide pieces. The test strip products were stored in a plastic box with desiccant at room temperature.

[0045] 1.7 Analysis Procedure for Ratiometric Lateral Flow Test Strip Sensor

[0046] Before detection, the hairpin probes of H1 and H2 were heated to 95 °C for 5 min, respectively, and then gradually cooled to 25 °C. Next, different concentrations of target miRNA-150-5p were mixed with the hairpin probe mixture of H1 (50 nM) and H2 (50 nM) in TaNK buffer (20 mM, pH 7.5, 140 mM NaCl, 5 mM KCl). Then incubated at 37 °C for 50 min to trigger the CHA reaction. The CHA solution (total volume, 50 μL) was then transferred to the sample pad of the test strip for analysis. After waiting for 10 min, the accumulation of colloidal gold (SA-AuNPs) in the test area and the quality control area resulted in obvious red bands. Visual detection of microRNA was achieved by observing the color of the test area of ​​the test strip with the naked eye. The signal intensity of the red bands in the test area and the quality control area of ​​the test strip was quantified using a portable colloidal gold immunoassay.

[0047] 1.8 Exosome isolation and exosomal RNA extraction

[0048] HK-2 cells were incubated in DMEM containing 1% streptomycin and penicillin and 10% FBS in a 5% CO2 incubator at 37°C. When the cells reached 80-90% of the culture flask, the cells were transferred to serum-free medium and incubated for another 48 hours, and then the cell culture supernatant was collected. The supernatant was collected according to the differential ultracentrifugation method. Centrifugation was performed at 800g for 5 min at 4°C and at 2000g for 10 min at 4°C to remove cell debris. After filtering with a 0.22μm filter, the supernatant was then centrifuged at 174 900g for 90 min at 4°C to obtain the precipitated exosomes. The sedimented exosomes were resuspended with 40 mL phosphate-buffered saline (PBS) and centrifuged again at 174 900g for 90 min at 4°C. Finally, the supernatant was removed and the exosomes were resuspended in PBS for further study. For TEM characterization of HK-2 exosomes, the diluted samples were directly adsorbed on carbon-coated copper grids and then negatively stained with 2% phosphotungstic acid solution for transmission electron microscopy. Meanwhile, the hydrodynamic radius and concentration of exosomes were tested by nanoparticle tracking analysis (NTA) on Zetaview and the corresponding software ZetaView (version 8.05.14 SP7). Exosomal total RNA was extracted by MagIso DNA / RNA isolation kit (Xi'an Tianlong). The total RNA was divided into two aliquots and measured by qRT-PCR and ratiometric layer chromatography strips, respectively.

[0049] Results and discussion

[0050] 2.1 Design principle of strip sensor based on tetrahedral capture probe

[0051] Due to the excellent properties of DNA tetrahedral nanostructures such as controllability, cargo loading capacity and mechanical stability, we proposed tetrahedrons as three-dimensional scaffolds for probes and fixed the assembled probe-loaded tetrahedral nanostructure probes in the sensing area to explore a new type of lateral flow chromatography test strip based on the DNA nanostructure probe sensing interface. Fig. 9The schematic diagram illustrates the principle of the lateral flow chromatography test strip sensor based on DNA tetrahedral nanoprobes. Based on the tetrahedral scaffold sequence, the 3' end of each of the four strands A, B, C, and D was designed and modified with biotin. Single-stranded DNA was dropped on a nitrocellulose membrane at a high concentration of 20 μM as a probe to prepare the sensing interface. In addition, tetrahedral nanostructured probes were assembled using strands A, B, C, and D, and then the nanostructured probe sensing interface was prepared on the nitrocellulose membrane. In order to test the recognition and capture ability of these different probes, streptavidin-functionalized gold nanoparticles (SA-AuNPs) were designed and prepared. It is assumed that when the functionalized AuNPs pass through the sensing area, the probes will bind to the AuNPs through the biotin-streptavidin reaction. After a few minutes, a red line will be observed due to the aggregation of AuNPs. Since the single-stranded capture probe will move even if it reacts with AuNPs when the sample flows through, it is predicted that the aggregation of AuNPs will rarely occur, so no red line is displayed in the sensing detection area. In contrast, it is assumed that tetrahedral nanoprobes may produce different phenomena from single-stranded probes in the sensing detection area. The hypothesis is based on a gold nanoparticle modified with a large amount of streptavidin, one streptavidin reacts with four biotins, and one biotin molecule loaded on the four vertices of a tetrahedron can react with streptavidin. In this case, the high molecular weight three-dimensional SA-AuNPs / tetrahedral nanostructure complex can quickly aggregate through the biotin-streptavidin reaction. This polymerization process is called "hyperlinking reaction". As a result, a deep red detection line is displayed at this position when the sample solution flows through the sensing area of ​​the DNA nanostructure probe constructed on the lateral flow chromatography test strip.

[0052] like Fig. 9 , is a lateral flow chromatography test strip design strategy based on DNA tetrahedral nanostructured capture probes.

[0053] 2.2 Feasibility of lateral laminar flow test strips based on DNA tetrahedral nanostructure probes

[0054] In order to evaluate the feasibility of lateral flow chromatography test strips based on DNA tetrahedral nanostructured capture probes, a comparative analysis of single-stranded capture probes and tetrahedral capture probes was performed. Figure 1As shown in a, in the presence of chains A, B, C and D respectively, there is no red band or only an almost negligible red band in the sensing detection area even at 20 μM (very high probe concentration). These results indicate that the single-stranded capture probe is difficult to stay and aggregate in the sensing detection area after reacting with the functional gold nanoparticles (SA-AuNPs). Surprisingly, in the presence of 2 μM tetrahedral capture probe, a clear red line was observed. The signal read by the naked eye showed that the biotin anchored at the vertices of the DNA tetrahedron reacted with the streptavidin coated on the AuNPs to produce a huge AuNPs / tetrahedral nanostructure complex, which aggregated in the sensing area and did not move forward with the sample flow. The test strip signal is recorded in the form of intensity values ​​in Figure 1b. In addition, the assembly of the tetrahedral nanostructure was verified by gel electrophoresis and atomic force microscopy. As Figure 1 As shown in Figure c, the bands in lanes 1, 2, 3, and 4 represent chains A, B, C, and D, respectively, which are set as position control. The band in lane 5 is a mixed assembly of chains B and C, which migrates slower than the bands in lanes 2 and 3. The band in lane 6 is a mixed assembly of chains B, C, and D, and its migration speed is slower than that in lane 5. The band in lane 7 is a mixed assembly of chains A, B, C, and D, and migrates the slowest. The continuously slowing migration rate indicates that a larger DNA hybrid has been formed, and the DNA tetrahedral nanostructure probe has been successfully assembled as expected. In order to reveal the assembled DNA tetrahedral nanostructure probe, we further applied atomic force microscopy (AFM) to image the DNA complex. In the AFM image, single DNA nanostructure particles of uniform size are randomly distributed ( Figure 1 d). The DNA particles resemble the expected tetrahedral shape. Therefore, the constructed DNA tetrahedral nanostructure probe can be applied to lateral flow chromatography test strips, which is the first exploration and successful verification, which is expected to provide a potential method for the detection of various target molecules on lateral flow chromatography test strips based on nanostructured probes.

[0055] like Figure 1 , is the feasibility of the lateral laminar flow test strip based on DNA tetrahedral nanostructure probes of the present invention. (a) The determination recognition capture ability is evaluated by using single-stranded A, B, C, D and DNA tetrahedral nanostructure probes as capture probes, thereby changing the color of the strip sensor. (b) The corresponding signal intensity of various capture probe test strips. (c) Electrophoresis verification of DNA tetrahedral nanostructure probe assembly. (d) AFM image of DNA tetrahedral nanostructure probe.

[0056] To further explore the principle of lateral flow chromatography test strips based on tetrahedral nanostructured probes and achieve an optimal sensing system, we tested different experimental conditions. Figure 2 a shows that the red test line changes with the change of the number of biotin on a tetrahedron. When the biotin on one tetrahedron of the test strip a is zero ( Figure 2 a), no red line can be observed, proving that the tetrahedron has no effect on the migration of streptavidin-labeled gold nanoparticles (SA-AuNPs) in the absence of capture molecules, and no unwanted nonspecific red bands are generated. When biotin is loaded on the vertices of the tetrahedron, a red line appears as the number of biotin molecules on the vertices of the strip be increases, and the red detection line becomes dark and clear ( Figure 2 a). The comparison data of tetrahedron without biotin and with biotin confirm that the appearance of red detection line is due to the specific capture of AuNPs by tetrahedral nanostructure probes, which aggregates them in the sensing detection area. The enhanced band signal can be attributed to the increase in the number of biotin. When more biotin is loaded on a tetrahedron, the tetrahedral nanostructure probe and streptavidin-labeled gold nanoparticles (SA-AuNPs) form larger complex aggregations. Based on these results, the functionalized tetrahedron with four capture probes has the first priority in biosensing. Figure 2 The gel results in b correspond to Fig. Figure 2 The biotinylated tetrahedrons used in a. The assembly process of different biotinylated tetrahedrons Figure 1 c, and the sequences used in the assembly are listed in Table S1. It was found that these bands showed shorter electrophoretic distances with the continuous assembly, proving that DNA tetrahedrons loaded with different biotin numbers were constructed as expected. Furthermore, the concentration of biotinylated tetrahedrons was also optimized. Figure 2 As shown in Figure c, the readout signal becomes clear with a continuous increase in tetrahedron concentration from 0.5 to 4.0 μM and approaches a plateau at a concentration of 2.0 μM. Therefore, in subsequent experiments to develop an exosomal microRNA detection method on a lateral flow chromatography test strip detection platform, 2.0 μM tetrahedral nanostructure capture probe was selected as the optimal concentration for the construction of the sensing interface of the test area and the quality control control area.

[0057] like Figure 2, the lateral laminar flow test strip based on tetrahedral nanostructure capture probe was studied in depth by changing different experimental conditions. (a) The red detection lines of the sensing interface test strip constructed by a single tetrahedron design loaded with 0, 1, 2, 3 and 4 biotins are shown in a, b, c, d and e. (b) Characterization of different tetrahedral nanostructure assemblies used in the test strip sensor by gel electrophoresis. (c) The red detection lines of the test strips with tetrahedral nanostructure probe concentrations of 0, 0.5, 1, 2, 3 and 4 μM are shown in a, b, c, d, e and f. (d) The signal intensity of the test strips corresponding to different concentrations of tetrahedral nanostructure probes with concentrations of 0, 0.5, 1, 2, 3 to 4 μM is shown in a, b, c, d, e and f.

[0058] In addition to the sensing interface constructed by the tetrahedral nanostructured probe, the preparation and modification of AuNPs were characterized, and the functionalized colloidal gold reporter system (SA-AuNPs) was studied. Figure 3 shown. Figure 3 The transmission electron micrograph in a shows that the spherical gold nanoparticles (AuNPs) have excellent dispersion and uniform size, with a diameter of about 30 nm. Figure 3 As shown in Figure b, due to the local surface plasmon resonance (LSPR) effect, the AuNPs solution is deep red (tube a) and has a maximum absorption peak at 520 nm (spectrum a). Both results confirm the successful preparation of AuNPs. However, after the addition of a high concentration of NaCl solution, the deep red solution turned blue and then colorless (tube b), and the absorption peak at 520 nm disappeared (spectrum b), indicating that AuNPs aggregated in a high concentration salt environment. After modification with streptavidin, the color of the streptavidin-labeled gold nanoparticle (SA-AuNPs) solution in tube c and the absorption peak in spectrum c did not change. In tube d and spectrum d, it was observed that the color and absorption peak of the SA-AuNPs solution were changed even in 0.5 M NaCl solution. The reason for these results is that under high salt conditions, protected by its external modified streptavidin, the SA-AuNPs are dispersed and do not aggregate, indicating that the modification step is successful. In addition, Figure 2 In c, SA-AuNPs are captured by biotinylated tetrahedral nanostructure probes through the streptavidin-biotin reaction to show a red detection line. This result also proves that the step of modifying nanogold with streptavidin is successful.

[0059] Figure 3. Preparation and characterization of AuNPs modification. (a) TEM characterization of prepared gold nanoparticles (AuNPs). (b) Characterization of the modification steps of AuNPs by changes in color and absorption peaks (tube a and spectrum a are AuNPs before adding salt solution, tube b and spectrum b are AuNPs under high salt conditions; tube c and spectrum c are streptavidin-modified gold nanoparticles (SA-AuNPs), tube d and spectrum d are SA-AuNPs solutions under high salt conditions).

[0060] 2.3 Detection principle of ratiometric test strip sensor for detecting exosomal microRNA

[0061] like Fig.10The detection principle of the ratiometric test strip sensor for detecting exosomal microRNA is shown. The sensor consists of two main components: (i) tetrahedral nanostructured capture probes and (ii) catalytic hairpin assembly (CHA) circuit. The tetrahedral nanostructured capture probe (DT) was designed so that chains A, B, C, and D did not have complex secondary structures. Then, two tetrahedral nanostructured capture probes, including tDT) and cDT, were designed as nanostructured capture probes for the test zone and control zone, respectively. tDT was constructed with four protruding capture probes at four vertices by programming a sequence at the 5' end of each chain. Similarly, cDT was constructed with four biotin groups at four vertices by adding four biotin groups at the 3' end of each chain. In the CHA circuit, two hairpin probes with stem-loop structures were designed, namely H1 and H2. H1 was programmed with a sequence at its 5' end that was complementary to the capture sequence at the vertex of tDT. H2 was labeled with biotin at its 5' end. In the absence of target microRNA-150-5p, H1 and H2 stably coexist in the buffer because the complementary sequences between them are blocked in the stem region. In the presence of target microRNA-150-5p, the two hairpin probes successively unwind and form a double-stranded hybrid. On the one hand, tDT captures the H1 / H2 hybrid through the complementary sequences between H1 and tDT. On the other hand, it further captures streptavidin-labeled gold nanoparticles (SA-AuNPs) through the biotin labeled on H2 to form a sandwich-like structure. Obviously, the H1 / H2 hybrid brings AuNPs and tDT together as a bridge, which leads to the aggregation of AuNPs when the sample solution flows through the test area, so that a red line can be observed. Specifically, H1 is first opened by microRNA-150, releasing its sequence on the stem. The release stem sequence of H1 is specified to bind H2 through strand displacement by toe, releasing microRNA-150 and generating H / H2 complex. In turn, the released target microRNA-150 initiates the next round of hybridization / displacement reactions, forming a CHA loop. After multiple rounds of CHA reactions, a large number of H / H2 hybrids are formed, which are captured by cDT through biotin anchored at the vertices to capture the streptavidin-labeled AuNPs on the test line, showing a red line as the detection line. As microRNA-150 increases, more H1 / H2 bridges are formed, resulting in a darker red line. Since streptavidin-labeled AuNPs are captured on the test line, the biotinylated tetrahedral nanostructure probes on the quality control control area capture fewer streptavidin-labeled AuNPs. Therefore, the increasing signal on the test line and the decreasing signal on the control line (the ratio of T / C) form a ratiometric test strip sensor.

[0062] like Fig.10, is a schematic diagram of a ratiometric test strip sensor for detecting exosomal microRNA-150-5p based on a tetrahedral nanostructure capture probe and a catalytic hairpin assembly circuit of the present invention.

[0063] 2.4 Feasibility of using ratio test strips to detect exosomal microRNA-150-5p

[0064] The tetrahedral capture probe and CHA circuit are the two main components of the ratiometric test strip sensor, so they were characterized by gel electrophoresis and AFM. Figure 4 The gel image in a reflects the assembly process of tDT. The bands in lanes 1 and 2 are chains B and C, respectively, and the bands in lanes 3, 4, and 5 are hybrids of chains B and C, chains B, C, and D, and chains B, C, D, and A. With the continuous assembly of tDT, the migration distance of the electrophoretic bands gradually shortens, indicating that larger hybrids have been formed as designed. From the slowest migration rate in lane 5, it can be concluded that tDT has been successfully constructed. Figure 4 The AFM image in b further demonstrates the tetrahedral nanostructure of tDT in terms of size and morphology. At the same time, gel electrophoresis was performed to test whether the CHA circuit worked as designed. Figure 4 As shown in Figure c, the bands in lanes 1 and 2 are H1 and H2, respectively. When microRNA-150 is added to H1, a band with slow migration is observed in lane 3, representing that microRNA-150 hybridizes with H1 to form a microRNA-150 / H1 complex with a high molecular weight. At this time, the hairpin structure of H1 is opened, and its support binding site on the stem is exposed to the extended single strand. The band in lane 4 represents the addition of H2 to the mixture of microRNA-150 and H1, with the shortest migration distance. The reason for this result is that the newly exposed single-stranded domain on H1 hybridizes to the hairpin H2 through the support domain, triggering the displacement of microRNA from H1 and forming a product double-stranded H1 / H2 complex with a larger molecular weight. Lane 5 is a reaction system containing H1 and H2, showing two independent bands corresponding to H1 and H2, indicating that H1 and H2 coexist in the absence of target microRNA. These results indicate that catalytic hairpin assembly (CHA) proceeds as designed. Finally, the feasibility of the ratiometric test strip sensor for detecting exosomal microRNA-150-5p was investigated on the test strip, and the results were as follows Figure 4As shown in d. In the presence of H1 or H2 alone, only one red quality control line was observed in bands a and b. In the presence of both H1 and H2, only one red quality control line was also observed in band d, demonstrating the stable coexistence of H1 and H2 in the reaction solution, avoiding the generation of nonspecific signals. The addition of microRNA-150-5p to the solution of H1 and H2 resulted in the appearance of two red lines in band c corresponding to the test area and the quality control area, respectively. The appearance of the test line is attributed to the generation of the H1 / H2 complex triggered by microRNA-150, which acts like a bridge to connect the streptavidin-labeled AuNPs to the tetrahedral nanostructure capture probe. When Figure 4 The increase in the test line signal intensity in c leads to a decrease in the quality control line signal, forming a ratiometric test strip sensor with an increase in the test line signal and a decrease in the quality control line signal. Therefore, the CHA circuit is specifically activated by the target microRNA-150-5p, and a ratiometric test strip sensor based on the DNA tetrahedral nanostructured probe sensing interface is designed and constructed as expected for the detection of exosomal microRNA-150-5p.

[0065] Figure 4. Feasibility study of exosomal microRNA-150-5p ratiometric test strip sensor based on tetrahedral nanostructured probes and CHA circuits. (a) Assembly of tetrahedral nanostructured capture probes characterized by gel electrophoresis. (b) Characterization of tetrahedral nanostructured probes by AFM images. (c) Characterization of CHA circuits by gel electrophoresis. (d) Target response of ratiometric test strip sensor.

[0066] 2.5 Sensitivity analysis of ratiometric lateral flow chromatography test strip sensors

[0067] Under optimal conditions, the analytical performance of the ratiometric lateral flow chromatography test strip sensor was evaluated. As the concentration of the target miRNA-150-5p increased, the red signal intensity of the test line gradually increased, while the red signal intensity of the quality control line gradually decreased ( Figure 5 a). The ratio of T / C intensity is linearly correlated with the logarithm of miRNA-150 concentration in the range of 0.1 pM to 10 nM ( Figure 5 b). The linear equation is I = 0.26 lg c + 3.54, and the correlation coefficient is 0.99076. According to the signal-to-noise ratio = 3 principle, the minimum limit of detection (LOD) is 54.75 fM. The ratiometric lateral flow chromatography test strip sensor has a wide dynamic range, low detection limit and short measurement time, thus providing a new bedside detection method for the rapid detection of miRNA-150-5p.

[0068] like Figure 5, Sensitivity analysis, (a) 10 -13 , 10 -12 , 10 -11 , 10 -10 , 10 -9 and 10 -8 M The lateral flow chromatography test strip results corresponding to different concentrations of miRNA-150-5p and the corresponding red signal intensity of the test line and the quality control line. (b) The linear relationship between the intensity ratio (T / C) and the logarithm of the miRNA-150-5p concentration.

[0069] 2.6 Analysis of the specificity of ratiometric lateral flow chromatography test strip sensors

[0070] Specificity is another important factor in evaluating ratiometric test strip sensors for analyte detection. Four miRNA sequences, single-base mismatch miRNA (SM miR-150-5p), double-base mismatch miRNA, random miRNA, and miR-21-5p, were selected to test their specificity. Figure 6 As shown in the figure, the T / C ratio signal intensity corresponding to the SM miR-150-5p (band c) is much weaker than that of miR-150-5p (band b). In addition, compared with the fully matched target miR-150-5p, the T / C ratio signal intensity generated by the double-base mismatch target (band d), random microRNA (band e) and miR-21-5p (band f) is extremely low, equivalent to the blank signal (band a). The detection results show that the constructed ratiometric test strip biosensor has good specific resolution of microRNA-150-5p homologous sequences and has the performance of single-base mismatch discrimination.

[0071] like Figure 6 Specificity analysis, (a) Test strip results of different microRNA-150-5p mimic homologous sequences at 100 pM concentration and the corresponding red visualized signal intensity of the test line and the quality control line. (b) The intensity of the T / C ratio signal corresponding to the microRNA-150-5p mimic homologous sequence.

[0072] 2.7 Actual sample determination of exosomal mocroRNA-150-5p

[0073] In order to verify the analytical performance of the constructed ratiometric test strip sensor in actual samples, we quantified the target miR150-5p in the exosomes released by HK-2 cells. The relevant results are shown in Figure 7. TEM images show that HK-2 exosomes are dispersed biological nanoparticles with a diameter of 90-120nm ( Figure 7a). Nanoparticle tracking analysis (NTA) showed that the concentration of collected exosomes was 3.0×10 6 Particles / mL( Figure 7 b), and showed the size distribution of HK-2 exosomes centered at 113 nm. Next, we used ratiometric test strips to detect microRNA-150-5p in total RNA extracted from HK-2 exosomes. At the same time, the constructed ratiometric test strip method was compared with the qPCR results as a reference. Figure 7 As shown in c, the concentration of exosomal miR150-5p was calculated to be 1.43 pM, which is in good agreement with the 1.72 pM data measured by real-time fluorescence PCR ( Figure 8 ). Therefore, the ratiometric test strip based on the DNA nanostructure probe sensing interface has a high application potential in the actual detection of exosomal miR150-5p.

[0074] like Figure 7 Detection of exosomal mocroRNA-150-5p in HK-2 cells. (a) Transmission electron microscopy image of HK-2 exosomes. (b) Concentration and size distribution of HK-2 exosomes obtained by nanoparticle tracking analysis. (c) The constructed ratiometric test paper sensor detects mocroRNA-150-5p in total RNA extracted from exosomes by real (a) and fluorescence PCR (b).

[0075] like Figure 8 , Real-time fluorescence quantitative PCR assay for miRNA-150-5p in total RNA extracted from HK-2 cell exosomes. (a) PCR amplification curve generated by miRNA-150-5p standard (ae, 10 -13 , 10 -12 , 10 -11 , 10 -10 and 10 -9 M) and PCR amplification curve of miRNA-150-5p in total exosome RNA extracted from HK-2 cells (f). (b) Linear equation established by miRNA-150-5p standard.

[0076] in conclusion

[0077] In summary, the present invention proposes a novel ratiometric test strip sensor based on DNA tetrahedral nanostructured probes and catalytic hairpin self-assembly. The sensor increases the intensity of red visual signal in the test line and reduces the red visual signal in the quality control line. DNA tetrahedrons have been widely used to explore various biosensors for in vitro diagnosis and in situ detection of cells and cell surfaces. At present, DNA nanostructured probes have not been used in lateral flow chromatography test strips, which are very important rapid sensing detection platforms for the actual detection of different target species in clinical practice. This study first proposed a new method for preparing a sensing detection interface in the sensing detection area of ​​the test strip using DNA tetrahedral nanostructured probes, which solved the preparation problem that nucleic acid probes must be connected to protein molecules to form macromolecular complexes. Due to the use of CHA circuits and ratio strategies, a minimum detection limit of 54.75 fM was achieved in a wide linear range of 100 fM to 10 nM. The test strip biosensor showed high sensitivity and great application potential in the actual detection of exosomal microRNA-150-5p. Therefore, the DNA nanostructure probe discovered and verified provides a universal method for constructing a biosensing interface on a test paper platform, which can be applied to the detection of nucleic acid markers and non-nucleic acid markers such as cells, exosomes, proteins and small molecules, and has excellent application prospects for on-site analysis or bedside detection. The ratiometer test strip constructed provides a new POCT detection method for the detection of exosome microRNA.

[0078] It will be apparent to those skilled in the art that the present invention is not limited to the details of the exemplary embodiments described above and that the present invention can be implemented in other specific forms without departing from the spirit or essential features of the present invention. Therefore, the embodiments should be considered exemplary and non-restrictive in all respects, and the scope of the present invention is defined by the appended claims rather than the above description, and it is intended that all changes falling within the meaning and scope of the equivalent elements of the claims be included in the present invention.

[0079] In addition, it should be understood that although the present specification is described according to implementation modes, not every implementation mode contains only one independent technical solution. This description of the specification is only for the sake of clarity. Those skilled in the art should regard the specification as a whole. The technical solutions in each embodiment may also be appropriately combined to form other implementation modes that can be understood by those skilled in the art.

Claims

1. A method for preparing a lateral flow chromatography test strip sensor based on a DNA nanostructure capture probe, characterized in that: The following steps are involved: 1) Design catalytic hairpin assembly hairpin probes H1 and H2, where the complementary sequence between H1 and H2 is blocked in the stem region, and H2 is labeled with biotin at the 5' end. In the presence of the target to be detected, the two hairpin probes H1 and H2 are successively unzipped and form a double-stranded hybrid; 2) Synthesis and modification of colloidal gold nanoparticles Synthesized spherical colloidal gold nanoparticles AuNPs were prepared by reducing HAuCl4 solution with citrate, and AuNPs were mixed with 0.5 mM K2CO3 solution and 2 μg / mL streptavidin, and then the mixture was shaken on a mixer for 60 min, and bovine serum albumin with a final mass concentration of 0.1% was added as a blocking agent at room temperature for 20 min; the mixture was then centrifuged at 12000 rpm for 15 min to collect the red precipitate, thus obtaining streptavidin-modified colloidal gold nanoparticles SA-AuNPs; 3) Preparation of tetrahedral nanostructured probes The nucleic acid encoding of the capture probe was designed for the four strands of the DNA tetrahedron, so that the capture probe region was complementary to the partial region sequence of the hairpin probe H1; the four strands used to form the tetrahedral nanostructure probe were mixed in equal molar amounts in a buffer solution of 20 mm Tris, 50 mm MgCl2, pH 8.0 at 95°C, and then cooled to 4°C; 4) Preparation of test strips The lateral flow chromatography test strip consists of four parts: a sample pad, a gold label pad, a nitrocellulose membrane and a water-absorbing pad; all four components are mounted on a common backing layer; the sample pad made of glass fiber is soaked in a buffer containing 20 mM Tris-HCl, 0.5% Tween-20, 2.0% sucrose by mass concentration and 150 mM NaCl pH 7.3; then, the sample pad is dried at 37°C for 2 hours; the gold label pad is prepared by dispensing 5 μL of streptavidin-labeled colloidal gold solution SA-AuNPs onto the glass fiber pad, and the pad is dried at 35°C for 1 hour and then stored at 4°C; Construct a DNA tetrahedron nanoprobe sensing interface, use a pipette to drop 1 μL of tetrahedron capture probe on the test area, then dry the membrane at 37°C for 1 hour, assemble the sample pad, gold label pad, nitrocellulose membrane and absorbent pad on the plastic adhesive backing so that there is 1-2 mm overlap between the components, and then cut the assembled plate into 3 mm wide test strips.

2. A method for preparing a lateral flow chromatography test strip sensor based on a DNA nanostructure capture probe, characterized in that: The following steps are involved: 1) Design catalytic hairpin assembly hairpin probes H1 and H2, where the complementary sequence between H1 and H2 is blocked in the stem region, and H2 is labeled with biotin at the 5' end. In the presence of the target to be detected, the two hairpin probes H1 and H2 are successively unzipped and form a double-stranded hybrid; 2) Synthesis and modification of colloidal gold nanoparticles Synthesized spherical colloidal gold nanoparticles AuNPs were prepared by reducing HAuCl4 solution with citrate, and AuNPs were mixed with 0.5 mM K2CO3 solution and 2 μg / mL streptavidin, and then the mixture was shaken on a mixer for 60 min, and bovine serum albumin with a final mass concentration of 0.1% was added as a blocking agent at room temperature for 20 min; the mixture was then centrifuged at 12000 rpm for 15 min to collect the red precipitate, thus obtaining streptavidin-modified colloidal gold nanoparticles SA-AuNPs; 3) Preparation of tetrahedral nanostructured probes The nucleic acid encoding of the capture probe was designed for the four strands of the DNA tetrahedron, so that the capture probe region was complementary to the partial region sequence of the hairpin probe H1; the four strands used to form the tetrahedral nanostructure probe were mixed in equal molar amounts in a buffer solution of 20 mm Tris, 50 mm MgCl2, pH 8.0 at 95°C, and then cooled to 4°C; 4) Preparation of test strips The lateral flow chromatography test strip consists of four parts: a sample pad, a gold label pad, a nitrocellulose membrane and a water-absorbing pad; all four components are mounted on a common backing layer; the sample pad made of glass fiber is soaked in a buffer containing 20 mM Tris-HCl, 0.5% Tween-20, 2.0% sucrose by mass concentration and 150 mM NaCl pH 7.3; then, the sample pad is dried at 37°C for 2 hours; the gold label pad is prepared by dispensing 5 μL of streptavidin-labeled colloidal gold solution SA-AuNPs onto the glass fiber pad, and the pad is dried at 35°C for 1 hour and then stored at 4°C; A DNA tetrahedral nanoprobe sensing interface was constructed, including test area and quality control area detection lines, which were executed by the HM3035 XYZ platform dispenser, dispensing 2 μM DNA tetrahedral nanostructure probe or 2 μM biotinylated tetrahedral nanostructure probe at a speed of 2 μL / cm, respectively. The distance between the test area and the quality control area was about 5 mm. The membrane was then dried at 37°C for 1 hour, and the sample pad, gold label pad, nitrocellulose membrane and absorbent pad were assembled on the plastic adhesive backing so that there was a 1-2 mm overlap between the components. The assembled plate was then cut into 3 mm wide test strips.

3. An application of a sensor prepared by the method for preparing a DNA nanostructure capture probe lateral flow chromatography test strip sensor according to claim 1 or 2, characterized in that: The sensor is used for visual detection of exosomal microRNA.

Images