A method for constructing a DNA vaccine co-expressing Marek's disease virus glycoproteins gC and gD

Abstract

The present invention discloses a method for constructing a DNA vaccine for co-expressing Marek's disease virus glycoprotein gC and gD. It belongs to the technical field of DNA molecular vaccines. It includes: Marek's disease virus glycoprotein gC and gD genes, IL-18 gene, self-cleavage polypeptides P2A and T2A, and eukaryotic expression vectors, and provides a construction method and application. The operation method of the present invention is simple, the preparation time is short, and large-scale production can be carried out; the homologous sequence between the vector and the target gene is recombined by a recombinase, and the PCR cloned product can be directly used for recombination, and the three target genes are expressed separately; it is conducive to the processing and presentation of the product of the antigen gene in the body; it is safe and reliable, and easy to store and transport. Animal experiments show that the weight of three yellow chickens immunized with DNA vaccines increases normally, no side effects occur, and the immunized chickens produce obvious humoral immunity and cellular immune responses.

Description

Technical Field

[0001] The invention relates to the technical field of DNA molecular vaccines, and more specifically to a method for constructing a DNA vaccine for co-expressing Marek's disease virus glycoproteins gC and gD. Background Art

[0002] Marek's disease (MD) is a common T lymphocyte proliferative tumor disease in chickens. It is caused by infection with the highly cell-bound α-herpes virus Marek's disease virus (MDV). The main characteristic pathological changes are mononuclear cell infiltration of peripheral nerves, iris, skin tissue and other solid visceral organs. Sick chickens show rapid formation of lymphoid tumors, immunosuppression and paralysis. MDV is an enveloped double-stranded linear DNA virus with a genome length of about 170kbp, containing 338 open reading frames (ORFs), of which 103 may be functional genes, encoding more than 60 viral proteins, and the most studied ones are oncogenic proteins Meq, pp38 and v-IL8, as well as envelope glycoproteins gB, gC, gE, gI, gM, etc., which are related to virus invasion and spread.

[0003] Traditional MD vaccines mainly target proteins involved in viral replication and cannot induce neutralizing immunity. Therefore, surviving wild-type strains may easily mutate, causing the virulence to gradually increase. Although vaccines are still one of the effective means of preventing and controlling MD, the continuous emergence of very virulent plus MDV (vv+MDV) in recent years has broken through the protective effect of the best existing vaccines, resulting in more and more chickens being infected with MDV, including breeders, laying hens, and high-quality chickens raised for a long time in southern my country, posing a threat to my country's poultry industry that cannot be ignored. In addition, the use of multi-unit vaccines can lead to B lymphocyte dysfunction, resulting in decreased immunity in chickens. Except for turkey herpes virus, other MD vaccines have strict live cell binding and must be stored in liquid nitrogen, which increases the transportation cost of the vaccine.

[0004] Therefore, the development of new MD vaccines using genetic recombination technology is expected to make up for the shortcomings of existing vaccines, improve the ability of chickens to resist MD, and enhance breeding efficiency.

[0005] Glycoprotein C (gC) encoded by MDV is a multifunctional protein of the α-herpesvirus subfamily. It is encoded and synthesized by the homologous gene of the herpesvirus UL44 and is related to the attachment, stability and virulence of the virus. Studies have confirmed that gC is closely related to the horizontal transmission of MDV, and the horizontal transmission ability of viral mutants lacking the gC gene is significantly reduced. Glycoprotein D (gD) is also one of the most conserved glycoproteins in the herpesvirus family. It is encoded by the US6 gene. In the process of virus invasion of the body, in addition to binding to cell receptors (NECTIN-1 or HVEM), it also activates the downstream components of the viral fusion apparatus. At the same time, gD has high immunogenicity.

[0006] Although glycoproteins gC and gD play an important role in the pathogenesis of MD, the expression of conjugated gC produced by the currently widely used attenuated commercial vaccines (such as CVI988, 814 strains, etc.) after infecting cells is very low, and gD expression is almost undetectable. One of the important defects of existing MD attenuated vaccines is that they cannot provide complete protection, that is, they cannot prevent viral infection and body detoxification. This may be closely related to the abnormal expression of key glycoproteins gC and gD, resulting in insufficient immune response to gC and gD.

[0007] Interleukin-18 (IL-18) is an important cytokine produced by macrophages. It plays an important role in innate and acquired immunity and can act as an adjuvant in DNA vaccines to enhance humoral and cellular immune responses. Wenner (2003) injected chickens with a DNA vaccine expressing pcDNA3.1 / ChIL-18 and a Newcastle disease inactivated vaccine. The results showed that the combined injection of conventional ND inactivated vaccine and ChIL-18 gene recombinant eukaryotic expression plasmid significantly improved the T lymphocyte transformation function of chickens immunized with conventional ND inactivated vaccine alone.

[0008] Recombinant DNA vaccines are obtained by cloning foreign genes into eukaryotic expression vectors and injecting the recombinant plasmids into animals, so that the foreign genes are expressed in the body to form antigens and induce immune responses. Compared with traditional inactivated vaccines, recombinant DNA vaccines can not only induce humoral immune responses, but also induce cellular immune responses. Compared with traditional attenuated live vaccines, recombinant DNA vaccines have the advantages of safety, low cost, easy storage and simple preparation.

[0009] Therefore, how to provide a method for constructing a DNA vaccine that co-expresses Marek's disease virus glycoproteins gC and gD is an urgent problem that those skilled in the art need to solve. Summary of the invention

[0010] In view of this, the present invention provides a method for constructing a DNA vaccine that co-expresses Marek's disease virus glycoproteins gC and gD. The obtained vaccine has the characteristics of high safety, low cost, simple preparation, easy storage, and good immune effect.

[0011] In order to achieve the above object, the present invention adopts the following technical solution:

[0012] A DNA recombinant plasmid for co-expressing Marek's disease virus glycoprotein gC and gD comprises: Marek's disease virus glycoprotein gC and gD genes, IL-18 gene, self-cleaving polypeptides P2A and T2A, and a eukaryotic expression vector.

[0013] Preferably: the nucleotide sequence of the IL-18 gene is shown in SEQ ID No.1; the nucleotide sequence of the gC gene is shown in SEQ ID No.2; the nucleotide sequence of the gD gene is shown in SEQ ID No.3; the eukaryotic expression vector is pVAX1-3×MCS, including HA, 6×His, FLAG tags and self-cleaving polypeptides P2A and T2A sequences, the nucleotide sequence of the self-cleaving polypeptide P2A is shown in SEQ ID No.4; the nucleotide sequence of T2A is shown in SEQ ID No.5.

[0014] The beneficial effect lies in: inserting self-cleaving polypeptides P2A and T2A into the multiple cloning restriction site of pVAX1-3×MCS, and utilizing a common CMV promoter to drive the independent and equal expression of gC and gD proteins and IL-18 protein.

[0015] Preferably, the gC, gD and IL-18 gene fragments amplified by PCR are inserted into the eukaryotic expression vector pVAX1-3×MCS by in vitro homologous recombination.

[0016] Beneficial technical effects: The DNA recombinant plasmid expressing the Marek's disease virus glycoprotein gC-gD can express multiple glycoproteins to make up for the insufficient expression of glycoproteins in existing vaccines; when expressing two Marek's disease virus glycoprotein genes, the chicken interleukin-18 gene is added to enhance the immune response effect.

[0017] The present invention also provides a method for constructing any of the above-mentioned recombinant plasmids, comprising the following steps:

[0018] 1) Amplify the Marek's virus glycoprotein gC, gD and IL-18 genes by PCR;

[0019] 2) Use restriction endonucleases BgIⅡ, HindⅢ, and BamHI to linearize the eukaryotic expression vector in sequence;

[0020] 3) Connecting the gC, gD and IL-18 genes from step 1) to a eukaryotic expression vector by homologous recombination, inserting P2A between gC and IL-18, and inserting T2A between IL-18 and gD to form a recombinant plasmid.

[0021] The beneficial effect is that the gC, gD, and IL-18 genes are expressed under the drive of CMV, and the open reading frame is connected in series by the P2A sequence of gC and IL-18, and the T2A sequence of IL-18 and gD, that is, the DNA recombinant plasmid pVAXl-gC-ChIL18-gD expressing the Marek's disease virus glycoprotein gC-gD is obtained.

[0022] Preferably, the conditions for the enzyme digestion in step 2) are 37°C for 1h, 85°C for 15min, and the enzyme digestion system is 20 μL: restriction endonuclease BgII / HindIII / BamHI 1 μL, 10×Buffer 2 μL, pVAX1-3×MCS plasmid 10 μL, ddH 2 O 7 μL.

[0023] Preferred: Step 3) homologous recombination conditions: 37°C metal bath for 30 min, ice bath for 5 min; recombination system 20 μL: 5× homologous recombination enzyme ligation buffer 4 μL, homologous recombination enzyme 2 μL, linearized pVAX1-3×MCS plasmid 2 μL, target gene fragment gC / gD / IL-18 2 μL, ddH 2 O 10 μL.

[0024] The present invention also provides the use of any of the above recombinant plasmids in preparing a DNA vaccine for preventing Marek's disease virus.

[0025] Preferably: the homologous recombination plasmid is transformed into competent Escherichia coli DH5α, spread on an LB plate containing kanamycin, and cultured at 37°C for 12 to 16 hours, and the bacterial liquid is amplified in an LB liquid medium containing kanamycin at 37°C for 12 to 16 hours, and the plasmid is extracted to obtain a recombinant DNA plasmid. The DNA plasmid that correctly expresses the target protein is identified by sequencing, that is, a DNA vaccine expressing Marek's disease virus glycoproteins gC and gD.

[0026] Preferably, the DNA vaccine is coated with the transfection agent PEI.

[0027] Furthermore, the transfection agent PEI is (Polyethylenimine, polyethyleneimine).

[0028] Preferred: Vaccine: The immunization route is intramuscular injection.

[0029] The beneficial effect is to improve the delivery efficiency of DNA vaccines.

[0030] It can be seen from the above technical scheme that compared with the prior art, the present invention discloses a method for constructing a DNA vaccine that co-expresses Marek's disease virus glycoprotein gC and gD, and the technical effect achieved is that the present invention is mainly composed of Marek's disease virus glycoprotein gC, gD gene, IL-18 gene, P2A sequence, T2A sequence and eukaryotic expression vector pVAX1-3×MCS. Accordingly, a corresponding DNA vaccine of Marek's disease virus glycoprotein gC-gD and a preparation method thereof are established. It has the following outstanding advantages:

[0031] 1) Traditional MD vaccines are mainly composed of weak strains of MDV, and the virulence of the strains can be weakened by physical, chemical or condition-changing methods to prepare vaccines. Since MDV is a cell-bound virus, it needs to be continuously cultured and proliferated in cells. The process is long and complicated, costly, and easily causes exogenous contamination by microorganisms, viruses, bacteria, etc. Once the strain mutates or the virulence increases, the vaccine loses its immune effect. The present invention only requires connecting the gene fragment encoding chicken interleukin-18 with the gC and gD genes encoding the Marek's disease virus glycoprotein gene fragment, as well as the self-cleaving polypeptide P2A and T2A sequences, and cloning them into the eukaryotic expression vector pVAX1-3×MCS (the backbone plasmid pVAX1 was purchased from Thermo Fisher Scientific (China) Co., Ltd.; the artificial sequence (3×MCS) was expressed by Nhe I and Apa After double restriction digestion with I, the cells were connected to the pVAX1 vector, and the eukaryotic expression vector pVAX1-3×MCS was obtained. The sequence of 3×MCS was: GCTAGCGTTGCAATTAAGCTTGGTACCGAGCTCTACCCATACGACGTCCCAGACTACGCTGGAAGCGGAGCTACTAACTTCAGCCTGCTGAAGCAGGCTGGAGACGTGGAGGAGAACCCTGGACCTGGATCCACTTGGAATTCCACCGCGCTGCAGACCCACCACCACCAC CACCACGGAAGCGGAGAGGGCAGAGGAAGTCTGCTAACATGCGGTGACGTCGAGGAGAATCCTGGACCTAGATCTTGCACAGCACAGCCATGGGCTCTCGAGTCTAGAGACTACAAGGATGACGATGACAAGGGGCCC), and the ligation process was conventional (the pVAX1 vector and 3×MCS sequence were double-digested, and the digestion conditions were: incubated in a 37°C water bath for 1 h; the digestion system was 10 μL: pVAX1 vector 7 μL, Nhe I 1μL, ApaI 1μL, FD.Greenbuffer 1μL; 3×MCS sequence product 7μL, Nhe I 1μL, Apa I 1μL, FD.Greenbuffer1μL. The obtained double enzyme digestion products were connected and placed in a 4° refrigerator overnight. The connection system was 10μL: T4 ligase 1μL, 10×T4 DNA ligase buffer 1μL, pVAX1 vector 2μL, target gene 3×MCS 6μL), transformed into competent Escherichia coli DH5α, and the plasmid was extracted by conventional methods to obtain the DNA vaccine of Marek's disease virus glycoprotein gC-gD.The operation method is simple, the preparation time is short, and mass production can be carried out. In addition, in addition to conventional injection, the vaccine can also be introduced into the body through particle bombardment technology, oral administration, intranasal instillation, etc.

[0032] 2) The DNA vaccine of Marek's disease virus glycoprotein gC-gD of the present invention is a eukaryotic expression plasmid recombined with Marek's disease virus glycoprotein gC, gD gene and IL-18 gene. The construction vector needs to insert three target genes. The commonly used cloning technology cannot accurately modify the target gene. For example, the double enzyme digestion method is used for construction. Since there are too many target genes, the same restriction sites may appear in different target genes, which makes it easy to cut the target fragment into small fragments when the target fragment is digested, and the complete target fragment cannot be obtained. The present invention uses the homologous recombination method to construct the recombinant plasmid pVAX1-gC-ChIL18-gD. Homologous recombination is not limited by the restriction sites between the target gene fragment and the vector. It mainly uses the recombinase to recombine the homologous sequence between the vector and the target gene. The PCR cloning product can be directly used for recombination, so the target fragment does not need to have the same sticky end as the vector. At the same time, the self-cleaving polypeptide 2A structure is introduced during the vector construction, so that the three target genes are expressed separately, different proteins are transcribed simultaneously, and different proteins are formed during the translation process.

[0033] 3) The DNA vaccine of Marek's disease virus glycoprotein gC-gD of the present invention is a eukaryotic expression plasmid recombined with Marek's disease virus glycoprotein gC and gD antigen genes, which can express the antigen genes in the host after immunizing the body in the form of intramuscular injection, thereby inducing the body to produce an immune response. During preparation, the chicken IL-18 gene is combined with the antigen gene, which is conducive to the processing and presentation of the product of the antigen gene in the body, inducing the body to produce a stronger cellular immune response, thereby producing a better immune effect.

[0034] 4) The Marek's disease virus three-gene DNA vaccine was coated with the transfection agent PEI and immunized three-yellow chickens by intramuscular injection. PEI can improve the efficiency of vaccine delivery.

[0035] 5) The DNA vaccine of the Marek's disease virus glycoprotein gC-gD of the present invention does not contain live Marek's disease virus, is safe and reliable when used, does not have the risk of spreading the virus, and is easy to store and transport. Experiments have shown that the vaccine can effectively enhance the immune response of three yellow chickens at the humoral immunity and cellular immunity levels. BRIEF DESCRIPTION OF THE DRAWINGS

[0036] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on the provided drawings without paying creative work.

[0037] Figure 1 The attached drawing shows the 3×MCS part of pVAX1-3×MCS provided by the present invention, wherein the plasmid linearization sequence (A) and the sequence order map (B).

[0038] Figure 2 The attached drawings are a DNA vaccine plasmid map (A) of the Marek's disease virus glycoprotein gC-gD provided by the present invention and an agarose gel electrophoresis diagram of the PCR identification results (B), wherein lane 1: IL-18; lane 2: gC; lane 3: gD.

[0039] Figure 3 The attached drawings are the expression diagrams of glycoprotein gC and gD verified by IFA (A, B) and Western Blotting (C) experiments of DNA vaccine of Marek's disease virus glycoprotein gC-gD provided by the present invention.

[0040] Figure 4 The accompanying drawings are a flow chart (A) of the DNA vaccine for immunizing three yellow chickens with the Marek's disease virus glycoprotein gC-gD provided by the present invention and a table (B) of the anti-gC serum positive rate detected by ELISA.

[0041] Figure 5 The accompanying figure shows the separation of blood lymphocytes from three yellow chickens after immunization with the DNA vaccine of Marek's disease virus glycoprotein gC-gD provided by the present invention, and the detection of CD3 by flow cytometry three-color analysis + 、CD4 + The ratio of T lymphocytes (A) and CD4 + One-way analysis of variance was performed on T lymphocytes (B).

[0042] Figure 6 The accompanying figure shows the separation of blood lymphocytes from three yellow chickens after immunization with the DNA vaccine of Marek's disease virus glycoprotein gC-gD provided by the present invention, and the detection of CD3 by flow cytometry three-color analysis + 、CD8 + The proportion of T lymphocytes (A) and CD8 + One-way analysis of variance was performed on T lymphocytes (B).

[0043] Figure 7 The accompanying drawing is a bar graph showing weight analysis of three yellow chickens immunized with the DNA vaccine of Marek's disease virus glycoprotein gC-gD provided by the present invention. DETAILED DESCRIPTION

[0044] The following will be combined with the drawings in the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0045] The embodiment of the present invention discloses a method for constructing a DNA vaccine for co-expressing Marek's disease virus glycoproteins gC and gD.

[0046] Example 1

[0047] Amplification of Chicken Interleukin-18 (IL18) Gene

[0048] 1) RNA was extracted using the Novozyme RNA extraction kit: 0.5 mg chicken bursa tissue was mixed with 50 μL of Buffer RL, transferred to a gDNA adsorption column, centrifuged at 12000 r / min for 30 s, the filtrate was collected, 0.5 times the volume of the filtrate was added with anhydrous ethanol and mixed, transferred to an RNA adsorption column, centrifuged at 12000 r / min for 30 s and the filtrate was discarded; 700 μL Buffer RW1 was added, centrifuged at 12000 r / min for 30 s and the filtrate was discarded; 700 μL Buffer RW2 was added, centrifuged at 12000 r / min for 30 s and the filtrate was discarded, 500 μL Buffer RW2 was added again, centrifuged at 12000 r / min for 2 min and the filtrate was discarded, then centrifuged at 12000 r / min for 1 min, and 50 μL RNase-free ddH 2 O, the extracted Total RNA was stored at -80℃ for later use.

[0049] 2) Use the Novozyme reverse transcription kit to prepare cDNA: 1 μg of chicken bursal tissue RNA obtained in step 1), 1 μL of random hexamers (50 ng / μL), RNase-free ddH 2Add 1 μL of 4×gDNA wiper Mix to the mixture, and place it in a 42°C water bath for 2 minutes. Mix the mixture in the previous step with 2 μL of 10×RT Mix and 2 μL of HiScript II Enzyme Mix. The reaction conditions are: 25°C for 5 minutes, 50°C for 45 minutes, and 85°C for 2 minutes to obtain cDNA from bursal tissue. Add 2 μL of cDNA to the following reagents: 10 μL of 2×Taq DNA polymerase, 6 μL of ddH 2 O, 1 μL of upstream primer (HD-ChIL-18-Fw), 1 μL of downstream primer (HD-ChIL-18-Rv), the reaction was carried out in a Veriti96PCR instrument (AB): 95°C pre-denaturation for 3 min; 95°C for 15 s, 56°C for 15 s, 72°C for 30 s, 35 cycles; 72°C final extension for 5 min. After the reaction was completed, the IL-18 gene fragment (as shown in SEQ ID No. 1) was obtained by gel recovery.

[0050] HD-ChIL-18-Fw: 5'-TGGAGGAGAACCCTGGACCTATGAGCTGTGAAGAGATCGC-3'

[0051] HD-ChIL-18-Rv: 5'-AGGCCGTGGAATTCCAAGTAGGTTGTGCCTTTCATTAT-3'.

[0052] The upstream and downstream primer sequences include the vector terminal homologous sequences, the same below.

[0053] Amplification of the glycoprotein gC and gD genes of Marek's disease virus

[0054] Use Tiangen DNA extraction kit to extract MDV 814 strain cell DNA: collect infected cells in a centrifuge tube, add 200μL buffer GA, and shake to suspend the cells; add 20μL Proteinase K solution and mix; then add 200μL buffer GB, mix and incubate at 70℃ for 10min, add 200μL anhydrous ethanol after brief centrifugation, and shake for 15s; transfer the above liquid to adsorption column CB3, centrifuge at 12000r / min for 30s, and discard the waste liquid; add 500μL buffer GD, centrifuge at 12000r / min for 30s, and discard the waste liquid; add 600μL rinse solution PW, centrifuge at 12000r / min for 30s, discard the waste liquid, repeat once; centrifuge at 12000r / min for 30s, discard the waste liquid, let it stand at room temperature for a few seconds to dry, and then add 30μL ddH 2 O elution, place at room temperature for 5 minutes, centrifuge at 12000r / min for 2 minutes, and store the extracted DNA product at -20℃ for later use. Add 2μL of DNA to the following reagents: 10μL of 2×Taq DNA polymerase, 6μL of ddHO 2

[0055] gC-Fw: 5'-AGCTGGCTAGCGTTGCAATTGCCACCATGCTCACGCCGCGTGTGTTA-3'

[0056] gC-Rv: 5'-GTATGGGTAGAGCTCGGTACCTAATCGAATATTTTTCGTGT-3'

[0057] gD-Fw: 5'-GTCGAGGAGAATCCTGGACCTATGAATAGATACAGATATGAA-3'

[0058] gD-Rv: 5'-AGCCCATGGCTGTGCTGTGCATAGGCGGGAATATGCCCGTCT-3'.

[0059] Example 2

[0060] Preparation of DNA vaccine of glycoprotein gC-gD of Marek's disease virus

[0061] 1) Linearization of pVAX1-3×MCS vector

[0062] The eukaryotic expression vector pVAX1-3×MCS was linearized by single restriction enzymes BgIⅡ, HindⅢ, and BamHI respectively; the enzyme digestion conditions were 37℃ for 1h and 85℃ for 15min, and the enzyme digestion system was:

[0063]

[0064] 2) Homologous recombination vector construction

[0065] The linearized vector pVAX1-3×MCS and the gC, gD and IL-18 gene fragments were subjected to homologous recombination using homologous recombinases, respectively, in a 37°C metal bath for 30 minutes and in an ice bath for 5 minutes to complete homologous recombination. The steps are to clone the gC, gD and IL-18 genes into the pVAX1-3×MCS vector in sequence, and by knocking out the stop codons between each other, inserting the P2A sequence (GCTACTAACTTCAGCCTGCTGAAGCAGGCTGGAGACGTGGAGGAGAACCCTGGACCT, as shown in SEQ ID No.4) between gC and IL-18, and inserting the T2A sequence (GAGGGCAGAGGAAGTCTGCTAACATGCGGTGACGTCGAGGAGAATCCTGGACCT, as shown in SEQ ID No.5) between IL-18 and gD, so that the three target genes can be expressed independently (see Figure 1 ). Recombination system:

[0066]

[0067]

[0068] 3) Transformation of homologous recombination products into competent Escherichia coli

[0069] The homologous recombination product was transformed into competent Escherichia coli DH5α, spread on LB plates containing kanamycin, and cultured at 37°C for 12 to 16 hours. Twenty single colonies were randomly selected and cultured in LB liquid medium containing kanamycin at 37°C for 12 to 16 hours for bacterial liquid amplification. The plasmid was extracted to obtain the recombinant DNA plasmid (pVAX1-gC-ChIL18-gD). Figure 2 A;

[0070] 4) Obtaining DNA vaccine of Marek's disease virus glycoprotein gC-gD

[0071] Sequencing and identification of the bacterial solution of the recombinant DNA plasmid;

[0072] The obtained recombinant plasmid was digested with restriction endonucleases BgII, HindIII, and BamHI, and the digested products were subjected to agarose gel electrophoresis. Specific bands at approximately 1503 bp, 1209 bp, and 594 bp were observed in the gel imaging system (see Figure 2 B), it indicates that the three gene fragments of gC, gD and IL-18 have been successfully inserted into the eukaryotic expression vector.

[0073] The empty vector and the eukaryotic expression vector pVAX1-gC-ChIL18-gD were transfected into HEK293T cells, respectively. After 48 hours, the transfected HEK 293T cells were collected for IFA and Western Blotting assay identification.

[0074] IFA test steps: HEK293T cells were cultured with 10% cell culture medium (10% fetal bovine serum, 1% penicillin-streptomycin double antibody, 89% DMEM), and the pVAX1-gC-ChIL18-gD plasmid was transfected into HEK293T cells using FUGEN@6 transfection agent, and IFA detection was performed 48 hours after transfection.

[0075] The basic operation is as follows: fix cells with 4% paraformaldehyde for 10 minutes; permeabilize with 0.1% TritonX-100 penetrant for 10 minutes; block with blocking solution for 10 minutes; incubate with primary antibody for 1 hour (1:100 mouse anti-HA or Flag, Shanghai Abmart Company); wash three times with PBS, 3 minutes each time; add secondary antibody and incubate in the dark for 1 hour (1:500 AlexaFluor488 goat anti-mouse IgG, catalog number: A0428; AlexaFluor 555 donkey anti-mouse IgG, catalog number: A0460, both purchased from Shanghai Bio-Tech Biotechnology Co., Ltd.); wash three times with PBS, 3 minutes each time; observe the results under an inverted fluorescence microscope.

[0076] Western Blotting test steps: HEK293T cells were cultured with 10% cell culture medium (10% fetal bovine serum, 1% penicillin-streptomycin double antibody, 89% DMEM), and pVAX1-gC-ChIL18-gD plasmid was transfected into HEK293T cells with FUGEN@6 transfection agent. Samples were collected 48 hours after transfection. Sample processing: First, RIPA lysis buffer and protease inhibitor mixture (PIC, EDTA, PMSF solution) were added, mixed thoroughly, incubated on ice for 30 minutes, 13000r / min, centrifuged for 3 minutes, and the supernatant was taken. One sample was treated with O-Glycosidase glycosidase, one sample was treated with PNGase-F glycosidase, and the remaining one was not treated. Samples without treatment: Add 5×SDS-Loading buffer and boil in a 100℃ metal water bath for 10 minutes; Samples treated with glycosidase: Mix 20μg of sample with 1μL of 10×glycoprotein denaturation buffer, add ddH 2 O to a volume of 10 μL, and boil in a 100°C metal water bath for 10 min; add 2 μL of 10× glycoprotein buffer, 2 μL of 10% NP, 2 μL of neuraminidine and 1 μL of O-Glycosidase / PNGase-F to a total volume of 20 μL; and incubate at 37°C for 1 h. The extracted protein samples were subjected to SDS-PAGE electrophoresis and semi-dry transferred to PVDF membrane at 100mA for 90min; blocked with 5% skim milk powder for 2h; incubated with primary antibody at 4°C overnight (1:2000 mouse anti-HA, catalog number: M20003; or Flag, catalog number: M20026; 1:3000 mouse Tubulin, catalog number: MA9124; purchased from Shanghai Abmart Company); washed three times with PBST, each for 10min; incubated with secondary antibody (1:5000 HRP-labeled goat anti-mouse IgG, catalog number: A0216, purchased from Shanghai Biyuntian Biotechnology Co., Ltd.) for 1h; washed three times with PBST, each for 10min; added ECL color developer and placed in UVP gel imaging system for development.

[0077] See Figure 3 The IFA results showed that after the primary antibody was mouse anti-HA and the secondary antibody was goat anti-mouse Alexa Fluor 488 incubated in the dark, a green specific fluorescence signal was observed under a fluorescence microscope, indicating that gC protein can be expressed in HEK 293T cells. After the primary antibody was mouse anti-Flag and the secondary antibody was donkey anti-mouse Alexa Fluor 555 incubated in the dark, a red specific fluorescence signal was observed under a fluorescence microscope, indicating that gD protein can be expressed in HEK 293T cells.

[0078] Western Blotting results showed that specific bands appeared at 70-95KDa and 70KDa for glycoprotein gC and gD, respectively, and the sizes were consistent with expectations, indicating that the target gene was successfully expressed. The size of the protein samples treated with O-Glycosidase did not change compared with the untreated group. The protein samples treated with PNGase F showed that specific bands appeared at 43-33KDa for gC and 55KDa for gD. The specific bands of the protein samples treated with PNGase F changed compared with those of the untreated ones, indicating that the main N-glycosidic bonds of glycoprotein gC and gD were glycosylated.

[0079] The recombinant DNA plasmid (named pVAX1-gC-ChIL18-gD) with correct protein expression after sequence determination, enzyme digestion identification, IFA and Western Blotting tests, that is, the DNA vaccine of Marek's disease virus glycoprotein gC-gD was obtained.

[0080] Example 3

[0081] Animal Immunization Test

[0082] Forty three-yellow chickens that were not vaccinated with MDV vaccine were randomly divided into four groups, with 10 chickens in each group, namely: empty vector control group, 50μg DNA vaccine / chicken, 25μg DNA vaccine / chicken coated with PEI, and 50μg DNA vaccine / chicken coated with PEI. The first immunization was carried out at 1 day old. The DNA vaccine of Marek's disease virus glycoprotein gC-gD was injected into the leg muscle of the immunized chickens, and the same volume of empty vector was injected into the leg muscle of the control chickens. The immunization group chickens were boosted at 14 days old. The immunization method and dose were the same as the first immunization at 1 day old. The control chickens were injected with the same volume of empty vector into the leg muscle. The body weight was weighed every week; blood was collected. The blood without anticoagulant treatment was centrifuged to obtain serum as the primary antibody. The expression of gC antigen was detected by indirect ELISA. The blood treated with anticoagulant was separated to obtain lymphocytes, and CD3 was detected by flow cytometry three-color analysis. + 、CD4+ 、CD8 + The proportion of T lymphocytes.

[0083] Indirect ELISA was used to detect the antigen expression of gC. It was found that 40% of the chickens in the 50 μg DNA vaccine group and the 25 μg DNA vaccine group coated with PEI could detect the antigen expression of gC in the second week (see Figure 4 ), it means that the vaccine can enhance the immune response of chickens at the humoral immunity level after immunization of three-yellow chickens;

[0084] Flow cytometry detection of CD3 + 、CD4 + 、CD8 + The proportion of T lymphocytes was found in the control group. + 、CD8 + The proportion of T lymphocytes was lower than that of the other three groups of immunized chickens, among which CD4 + The highest percentage of lymphocytes was in the 25 μg DNA vaccine group coated with PEI, reaching 63.76% (see Figure 5 );

[0085] CD8 + The highest percentage of lymphocytes was in the PEI-coated 25 μg DNA vaccine group, reaching 57.59% (see Figure 6 );

[0086] This indicates that the vaccine can enhance the immune response of chickens at the cellular immunity level after immunization of three-yellow chickens, and the 25μg DNA vaccine group coated with PEI has the best effect.

[0087] After vaccination, the chickens were weighed weekly and the average weight of each group was found to be roughly the same (see Figure 7 ), it means that the vaccine has no inhibitory effect on the body weight of three-yellow chickens;

[0088] Therefore: After the vaccine is used to immunize three-yellow chickens, it has no inhibitory effect on the weight of three-yellow chickens, and can enhance the immune response of chickens at the humoral immunity and cellular immunity levels.

[0089] The various embodiments in this specification are described in a progressive manner, and each embodiment focuses on the differences from other embodiments. The same or similar parts between the various embodiments can be referenced to each other.

[0090] The above description of the disclosed embodiments enables one skilled in the art to implement or use the present invention. Various modifications to these embodiments will be apparent to one skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the present invention. Therefore, the present invention will not be limited to the embodiments shown herein, but rather to the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. A method for constructing a DNA recombinant plasmid that co-expresses Marek's disease virus glycoproteins gC and gD, characterized in that: The following steps are involved: 1) Amplify the Marek's virus glycoprotein gC, gD and IL-18 genes by PCR; 2) Use restriction endonucleases BgIⅡ, HindⅢ, and BamHI to linearize the eukaryotic expression vector in sequence; 3) Connecting the gC, gD and IL-18 genes in step 1) to a eukaryotic expression vector by homologous recombination, inserting P2A between gC and IL-18, and inserting T2A between IL-18 and gD to form a recombinant plasmid; the nucleotide sequence of the IL-18 gene is shown in SEQ ID No.1; the nucleotide sequence of the gC gene is shown in SEQ ID No.2; the nucleotide sequence of the gD gene is shown in SEQ ID No.3; the eukaryotic expression vector is pVAX1-3×MCS, including HA, 6×His, FLAG tags and self-cleaving polypeptides P2A and T2A sequences, the nucleotide sequence of the self-cleaving polypeptide P2A is shown in SEQ ID No.4; the nucleotide sequence of T2A is shown in SEQ ID No.

5.

2. The construction method according to claim 1, characterized in that: Step 2) The enzyme digestion conditions are 37°C, 1h, 85°C, incubation for 15min, and the enzyme digestion system is 20μL: restriction endonuclease BgII / HindIII / BamHI 1μL, 10×Buffer 2μL, pVAX1-3×MCS plasmid 10μL, ddH2O 7μL.

3. The construction method according to claim 2, characterized in that: Step 3) The conditions of the homologous recombination are: 37°C metal bath for 30 min, ice bath for 5 min; 20 μL of recombination system: 4 μL of 5× homologous recombination enzyme ligation buffer, 2 μL of homologous recombination enzyme, 2 μL of linearized pVAX1-3×MCS plasmid, 2 μL of target gene fragment gC / gD / IL-18, and 10 μL of ddH2O.

4. The recombinant plasmid prepared by the construction method according to any one of claims 1 to 3.

5. Use of the recombinant plasmid according to claim 4 in the preparation of a DNA vaccine for preventing Marek's disease virus.

6. The use according to claim 5, characterized in that The recombinant plasmid was transformed into competent Escherichia coli DH5α, spread on an LB plate containing kanamycin, and cultured at 37°C for 12 to 16 hours. The bacterial liquid was amplified by culturing in LB liquid culture medium containing kanamycin at 37°C for 12 to 16 hours, and the plasmid was extracted to obtain the recombinant DNA plasmid. After sequencing and identification, the DNA plasmid that correctly expressed the target protein was the DNA vaccine expressing the Marek's disease virus glycoproteins gC and gD.

7. The use according to claim 6, characterized in that The DNA vaccine was coated with the transfection agent PEI.

8. The use according to claim 7, characterized in that The vaccine: The immunization route is intramuscular injection.

Images