Novel coronavirus RBD-specific monoclonal antibodies and their applications

Abstract

The present invention belongs to the field of monoclonal antibody technology, and specifically discloses a novel coronavirus RBD-specific monoclonal antibody and the application of the novel coronavirus RBD-specific monoclonal antibody. The present invention has important scientific significance and application prospects for the prevention, clinical treatment and development of diagnostic reagents for diseases caused by the novel coronavirus SARS-CoV-2.

Description

[0001] This invention application is a divisional application with an application date of August 19, 2020, application number 202010839862.9, and invention name “COVID-19 RBD-specific monoclonal antibodies and applications”. Technical Field

[0002] The present invention belongs to the technical field of monoclonal antibodies, and in particular relates to novel coronavirus RBD-specific monoclonal antibodies and applications. Background Art

[0003] Antibodies are immunoglobulin molecules composed of four polypeptide chains, including two heavy chains (H chains) and two light chains (L chains). The H chain consists of a heavy chain variable region (VH) and a heavy chain constant region, which consists of three regions: CH1, CH2, and CH3. The L chain consists of an L chain variable region (VL) and a light chain constant region, which consists of a CL region. VH and VL can be further divided into hypervariable regions called complementarity determining regions (CDRs) and alternately distributed conserved regions called framework regions (FRs).

[0004] Current research has found that the new coronavirus (SARS-CoV-2) has four main structural proteins, namely spike protein (S protein), nucleocapsid protein (N protein), membrane protein (M protein) and envelope protein (E protein). The S protein has two subunits: S1 and S2. The receptor binding site (RBD) is located on the S1 subunit. Its main function is to recognize host cell surface receptors and mediate fusion with host cells.

[0005] The plasma of patients who have recently been cured and discharged from the hospital contains high concentrations of specific antigen-neutralizing antibodies. After being injected into the patient's body, it can neutralize the new coronavirus pathogen and mediate an effective immune response. Therefore, the use of convalescent plasma is expected to provide an effective treatment for patients infected with the new coronavirus, reduce mortality, and ensure the safety of patients' lives.

[0006] The Chinese invention patent application with application publication number CN111303280A discloses a fully human monoclonal antibody with high neutralizing activity against SARS-CoV-2. The above patent provides a fully human monoclonal antibody with the recognition region being the S1 non-RBD region. However, since the novel coronavirus invades host cells by binding to the host cell's ACE2 via RBD, the fully human monoclonal antibody obtained in the above patent has limited blocking effect on the virus. In addition, the above patent obtains antibody cDNA by labeling plasma cells. However, compared with plasma cells, memory B cells respond quickly after activation, so memory B cells can induce a faster and stronger humoral immune response than the primary response, while the humoral immune response induced by plasma cells is limited. Summary of the invention

[0007] The purpose of the present invention is to provide a novel coronavirus RBD-specific monoclonal antibody and application thereof that targets RBD and can induce a stronger humoral immune response.

[0008] In order to achieve the above-mentioned object, the present invention provides a novel coronavirus RBD-specific monoclonal antibody, specifically, the heavy chain variable region amino acid sequence of the antibody is shown in SEQ ID NO: 21; the light chain variable region amino acid sequence can also be shown in SEQ ID NO: 22 (monoclonal antibody 11-CQTS151). The heavy chain variable region amino acid sequence can also be shown in SEQ ID NO: 23; the light chain variable region amino acid sequence can also be shown in SEQ ID NO: 24 (monoclonal antibody 12-CQTS152). The heavy chain variable region amino acid sequence can also be shown in SEQ ID NO: 25; the light chain variable region amino acid sequence can also be shown in SEQ ID NO: 26 (monoclonal antibody 13-CQTS154). The heavy chain variable region amino acid sequence can also be shown in SEQ ID NO: 27; the light chain variable region amino acid sequence can also be shown in SEQ ID NO: 28 (monoclonal antibody 14-CQTS155). The heavy chain variable region amino acid sequence can also be shown in SEQ ID NO: 29; the light chain variable region amino acid sequence can also be shown in SEQ ID NO: 30 (monoclonal antibody 15-CQTS157). The heavy chain variable region amino acid sequence may also be shown as SEQ ID NO:31; the light chain variable region amino acid sequence may also be shown as SEQ ID NO:32 (monoclonal antibody 16-CQTS159). The heavy chain variable region amino acid sequence may also be shown as SEQ ID NO:33; the light chain variable region amino acid sequence may also be shown as SEQ ID NO:34 (monoclonal antibody 17-CQTS160). The heavy chain variable region amino acid sequence may also be shown as SEQ ID NO:35; the light chain variable region amino acid sequence may also be shown as SEQ ID NO:36 (monoclonal antibody 18-CQTS161). The heavy chain variable region amino acid sequence may also be shown as SEQ ID NO:37; the light chain variable region amino acid sequence may also be shown as SEQ ID NO:38 (monoclonal antibody 19-CQTS163). The heavy chain variable region amino acid sequence may also be shown as SEQ ID NO:39; the light chain variable region amino acid sequence may also be shown as SEQ ID NO:40 (monoclonal antibody 20-CQTS164).

[0009] The present invention also provides the novel coronavirus RBD-specific monoclonal antibody, and its use in the preparation of a reagent, vaccine or drug for detecting or diagnosing SARS-CoV-2, wherein the drug comprises the novel coronavirus RBD-specific monoclonal antibody and a pharmaceutically acceptable excipient, diluent or carrier; also provides a nucleic acid molecule encoding the novel coronavirus RBD-specific monoclonal antibody; also provides an expression cassette, a recombinant vector, a recombinant bacterium or a transgenic cell line containing the nucleic acid molecule; and also provides the use of the expression cassette, recombinant vector, recombinant bacterium or transgenic cell line in the preparation of a product.

[0010] The present invention also provides a product, including the above-mentioned novel coronavirus RBD-specific monoclonal antibody; the product has any of the following uses (b1)-(b4): (b1) binding to the novel coronavirus SARS-CoV-2; (b2) detecting binding to the novel coronavirus SARS-CoV-2; (b3) binding to the S protein of the novel coronavirus SARS-CoV-2; (b4) detecting the S protein of the novel coronavirus SARS-CoV-2.

[0011] Preferably, the novel coronavirus RBD-specific monoclonal antibodies are prepared by sorting RBD-specific memory B cells, and then obtaining antibody variable region cDNA through the mRNA of RBD-specific memory B cells.

[0012] The principles and beneficial effects of the present invention are:

[0013] (1) The monoclonal antibody provided by the present invention has RBD specificity. Compared with the monoclonal antibody targeting the non-RBD region of S1, the monoclonal antibody provided by the present invention binds to RBD, providing a wider application value for antibody drug screening, diagnosis, prevention and treatment of new coronary pneumonia.

[0014] (2) The monoclonal antibody provided by the present invention is obtained by sorting RBD-specific memory B cells. Compared with the prior art by sorting plasma cells, the monoclonal antibody prepared by the present invention can induce a stronger humoral immune response. In addition, the present invention only conducts subsequent RT-PCR, nested PCR and antibody function analysis on RBD-specific memory B cells, which greatly improves the specific binding ability of monoclonal antibodies to RBD. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] Figure 1 Figure 2 shows the cell sorting of RBD-specific memory B cells analyzed by flow cytometry.

[0016] Figure 2 Figure 2 shows the cell sorting of RBD-specific memory B cells analyzed by flow cytometry.

[0017] Figure 3This is the gel electrophoresis diagram of the PCR product of single cell antibody gene;

[0018] Figure 4 It is the agarose gel electrophoresis image after PCR amplification of the antibody gene expression cassette containing CMV promoter, WPRE-γ or WPRE-κ element;

[0019] Figure 5 This is a graph showing the RBD-specific detection results. DETAILED DESCRIPTION

[0020] The following will be combined with the accompanying drawings of the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0021] Example 1

[0022] This embodiment provides a novel coronavirus RBD-specific monoclonal antibody, the amino acid sequence of the heavy chain variable region is shown in SEQ ID NO: 21; the amino acid sequence of the light chain variable region is shown in SEQ ID NO: 22.

[0023] This embodiment also provides the use of the above-mentioned novel coronavirus RBD-specific monoclonal antibody in the preparation of reagents or drugs for detecting or diagnosing SARS-CoV-2.

[0024] In actual production, the RBD-specific monoclonal antibody obtained in this embodiment can be used to prepare a nucleic acid molecule, or to prepare an expression cassette, a recombinant vector, a recombinant bacterium or a transgenic cell line containing the nucleic acid molecule, or to prepare a pharmaceutical composition, which includes the above-mentioned novel coronavirus RBD-specific monoclonal antibody and a pharmaceutically acceptable excipient, diluent or carrier.

[0025] When used, the related products prepared by the RBD-specific monoclonal antibody obtained in this embodiment can have any of the following uses (b1)-(b4): (b1) binding to the new coronavirus SARS-CoV-2; (b2) detecting the binding to the new coronavirus SARS-CoV-2; (b3) binding to the S protein of the new coronavirus SARS-CoV-2; (b4) detecting the S protein of the new coronavirus SARS-CoV-2.

[0026] Embodiment 2-10

[0027] The difference between Example 2-10 and Example 1 is that the amino acid sequences of the variable regions of the RBD-specific monoclonal antibodies are different. The amino acid sequences of the variable regions of Example 2-10 are shown in the following table:

[0028]

[0029]

[0030] The RBD-specific monoclonal antibodies provided in the above Examples 1-10 were all obtained by the following method: first, single RBD-specific memory B cells were sorted from the peripheral blood of recovered patients with COVID-19, and then the mRNA of RBD-specific memory B cells was obtained. Then, an antibody variable region gene expression cassette was constructed by RT-PCR and nested PCR, and then the antibody variable region gene expression cassette was transduced into 293T cells to express antibodies and the supernatant was collected. The RBD specificity of the supernatant was detected by ELISA to screen for RBD-specific monoclonal antibodies.

[0031] The specific steps include:

[0032] S1. Collect peripheral blood from several recovered COVID-19 patients, separate PBMCs, and freeze them in a -80℃ refrigerator for later use.

[0033] S2. First, use Dead Dye to remove dead cells from the PBMC obtained in S1, and then use CD19, mIg-G, mIg-D and S-RBD to stain and mark the live RBD-specific and highly binding memory B cells in the PBMC to screen out RBD-specific memory B cells; use a flow cytometer to sort the specific memory B cells into a 96-well plate, with one specific memory B cell in each well, and freeze them in a -80°C refrigerator for later use.

[0034] Specifically, the preferred Dead Dye staining concentration range of this embodiment is 1-2μg / mL, and the preferred Dead Dye staining concentration of this embodiment is 1.5μg / mL; CD19 is a B cell marker produced by Biolegend, and the concentration range of staining is 1-2μg / mL, and the preferred CD19 staining concentration of this embodiment is 1.5μg / mL. mIg-G is a B cell surface receptor produced by Biolegend, and the concentration range of staining is 1-2μg / mL, and the preferred mIg-G staining concentration of this embodiment is 1.5μg / mL; mIg-D is a B cell surface receptor produced by Biolegend, and the concentration range of staining is 1-2μg / mL, and the preferred mIg-D staining concentration of this embodiment is 1.5μg / mL; S-RBD is a new coronavirus protein receptor domain produced by sinobiological, and the concentration range of staining is 1-2μg / mL, and the preferred S-RBD staining concentration of this embodiment is 1.5μg / mL.

[0035] RBD-specific memory B cells were sorted by flow cytometry, and PBMCs were sorted by CD19, mIg-G, mIg-D, and S-RBD to obtain S-RBD-specific memory B cells. Figure 1 and Figure 2 As shown, Figure 2 Batch ID 0428, 0505, 0522, 0528 in the example are screening batches. The principle of using CD19, mIg-G, mIg-D and S-RBD to screen out RBD-specific memory B cells is as follows: PBMCs are stained with dead cell dye (Dead Dye), B cell marker CD19, memory B cell marker mIg-G positive and mIg-D negative, and RBD-specific IgG-expressing memory B cells, and then the CD19 cell population is separated from the cell population using a flow cytometer, and then the mIg-G positive cell population is separated from the CD19 positive cell population. + mIg-D - Cell population, then from mIg-G + mIg-D - The cell population is divided into RBD-positive memory B cells, and then the RBD-positive memory B cells are sorted by flow cytometry.

[0036] S3. Sorting and obtaining the mRNA of a single RBD-specific memory B cell, and using RT-PCR amplification to obtain the antibody variable region cDNA. Specifically, when using RT-PCR to amplify the antibody variable region cDNA, the primers designed in this embodiment are designed with a universal leader at the front end (see Primer Sequence Table 1 and Primer Sequence Table 2), which effectively improves the amplification rate of the antibody gene. The experimental results are as follows: Figure 3 shown.

[0037] S4. Amplify the antibody variable region cDNA obtained from S1-S3 using nested PCR to construct an antibody variable region gene expression cassette.

[0038] S3 and S4 are carried out in total through the following six parts: (1) extraction of RBD-specific memory B cell mRNA; (2) reverse transcription (RT) of single cell mRNA; (3) addition of G tail (TDT); (4) first round of PCR (1st PCR); (5) second round of PCR (2nd PCR); (6) BCR-ORF PCR amplification to construct a gene expression cassette; (7) CMV, WPRE-γ / κ / l fragment amplification and pre-ligation of CMV, BCR-Vγ / κ / l (product of (6)), WPRE-γ / κ / l overlap PCR (Overlap PCR); (8) BCR-γORF, BCR-κORF, and BCR-l PCR amplification.

[0039] The preparation of each reaction solution and the reaction conditions are as follows:

[0040] (1) Using Dynabeads TM mRNA DIRECT TM Purification Kit (Thermo Fisher Scientific) was used to extract single-cell mRNA, which specifically included the following steps:

[0041] ① Centrifugation: After taking out the 96-well plate with single RBD-specific memory B cells from the -80°C refrigerator, centrifuge at 600×g for 30 seconds to centrifuge the cells to the bottom of the well;

[0042] ② Washing: Take out the Dynabeads oligo(dT)25 microsphere bottle and vortex to mix, aspirate enough microspheres at 2μl / well, place on the magnet block, let stand for 30s, discard the supernatant, and resuspend with 500μl Lysis Buffer;

[0043] ③ Preparation: Add 9 μl / well Lysis Buffer into a 50 mL centrifuge tube, add the above 500 μl microsphere suspension, and blow evenly with a gun;

[0044] ④ Packaging: Use eight tubes to pack the microspheres, and then use a spray gun to add them into the cell plate at 9μl / well;

[0045] ⑤ Rinse: Apply the film to the 96-well plate, then rinse the tube wall for 2 cycles;

[0046] ⑥ Incubation: Let stand at room temperature for 5 minutes to allow the mRNA of RBD-specific memory B cells to be fully released and bound to the microspheres. After the incubation, centrifuge at 600×g to centrifuge the microspheres to the bottom of the wells. Place the 96-well plate on the DynaMag TM - On the 96sideMagnet magnetic plate, discard the supernatant with a pipette;

[0047] ⑦Wash A: Add 8 μl / well of Washing Buffer A, move the plate back and forth 7-8 times to fully wash the microspheres, and discard the supernatant;

[0048] ⑧ Wash B: Add 8 μl / well of Washing Buffer B, and wash the microspheres back and forth 7-8 times. Discard the supernatant, and then add 10 μl / well of the pre-prepared reverse transcription (RT) reaction solution. The reagent preparation and reaction conditions are described in (2) below.

[0049] (2) Reverse transcription (RT) (10 μl system)

[0050] The reagents required for preparation are shown in Table 1 below:

[0051] Reagent name volume <![CDATA[DEPC-H2O]]> 4.5μl 5×primerscript Buffer 2.0μl 2.5mM dNTP 2.0μl RNase Inhibitor 1μl Sample beads PrimerScriptⅡRTase 0.5μl Total volume 10μl

[0052] Reaction conditions: 42°C for 60 min (mixing every 20 min);

[0053] After the reaction, the 96-well plate was centrifuged at 600 × g and then placed on the DynaMag TM -96 sideMagnet magnetic plate, discard the supernatant with a pipette, and then add the pre-prepared TDT reaction solution at 10 μl / well. The reagent preparation and reaction conditions are as described below (3).

[0054] (3) Add G-tail (TDT) (10 μl system)

[0055] The reagents required for preparation are shown in Table 2 below:

[0056] Reagent name volume <![CDATA[H2O]]> 6.4μl 5×TdT buffer 2.0μl 10mM dGTP 0.5μl 0.1% BSA 1.0μl Sample beads TdT 0.1μl Total volume 10μl

[0057] Reaction conditions: 37°C for 40 min (mixing every 20 min).

[0058] After the reaction, the 96-well plate was centrifuged at 600 × g and then placed on the DynaMag TM -96 side Magnet plate, discard the supernatant with a pipette, and then add the pre-prepared first round PCR (1st PCR) reaction solution at 10 μl / well. The reagent preparation and reaction conditions are as described below (4).

[0059] (4) 1st PCR (10 μl system) (For primer sequences, see the primer sequence table)

[0060] The reagents required for preparation are shown in Table 3 below:

[0061] Reagent name volume <![CDATA[H2O]]> 1.9μl 2×GC Buffer 5μl 2.5mM dNTP 1μl FP:AP3-dC (10 μM) 0.5μl RP1:Cg-1st (10μM) 0.5μl RP2:Ck-1st (10 μM) 0.5μl RP3:CI-RT (10 μM) 0.5μl PrimesTAR 0.1μl sample beads Total volume 10μl

[0062] Based on the PCR principle, the experimental reaction conditions of the 1st PCR are: ① pre-denaturation at 95°C for 3 min; ② denaturation at 95°C for 15 sec, annealing at 60°C for 5 sec, extension at 72°C for 1 min, 30-35 cycles, 30 cycles are preferred in this embodiment; ③ cyclic extension at 72°C for 5 min, and storage at 4°C.

[0063] (5) Second round of PCR (2nd PCR) (10 μl system) (For primer sequences, see Primer Sequence Table 1 and Primer Sequence Table 2)

[0064] The reagents required for preparation are shown in Table 4 below:

[0065] Reagent name volume <![CDATA[H2O]]> 1.5μl 2×GC Buffer 5μl 2.5mM dNTP 1μl FP:MAC-AP3 / AP3 (10 μM) 0.5μl RP:Cg-nest / K20 / CI-nest (10 μM) 0.5μl PrimesTAR 0.5μl sample 1μl Total volume 10μl

[0066] Based on the PCR principle, the experimental reaction conditions of 2nd PCR are: ① pre-denaturation at 95°C for 3 min; ② denaturation at 95°C for 15 sec, annealing at 60°C for 5 s, extension at 72°C for 1 min, 30-35 cycles, 35 cycles are preferred in this embodiment; 72°C external extension for 5 min, and storage at 4°C.

[0067] After PCR, 4 μl of each well was taken for 1.5% agarose gel electrophoresis. The wells with the Gamma chain paired with the Kappa chain or Lamada chain were sent for sequencing.

[0068] (6) Amplification and construction of antibody expression cassette (BCR-ORF)

[0069] PCR amplification of the promoter region (CMV promoter), WPRE-γ (antibody gamma chain) and WPRE-κ (antibody kappa chain), the PCR amplification system is shown in Table 5 below:

[0070]

[0071] PCR amplification conditions were as follows: ① pre-denaturation at 95°C for 3 min; ② denaturation at 95°C for 15 sec, annealing at 56°C for 15 sec, extension at 72°C for 1 min, 30 cycles; ③ cyclic extension at 72°C for 5 min, storage at 12°C.

[0072] (7) Amplification of CMV and WPRE-γ / κ / l fragments and pre-ligation of CMV, BCR-Vγ / κ / l, and WPRE-γ / κ / l by Overlap PCR

[0073] The experimental system is shown in Table 6 below:

[0074]

[0075] PCR amplification conditions were as follows: pre-denaturation at 95°C for 3 min; denaturation at 95°C for 15 sec, annealing at 50°C for 15 sec, extension at 72°C for 1.5 min, 10 cycles; extra-cyclic extension at 72°C for 5 min, and storage at 12°C.

[0076] (8) PCR amplification of BCR-γORF, BCR-κORF, and BCR-1

[0077] The experimental system is shown in Table 7 below:

[0078]

[0079] PCR amplification program: pre-denaturation at 95°C for 3 min; denaturation at 95°C for 15 sec, annealing at 58°C for 15 sec, extension at 72°C for 1.5 min, 30 cycles; extra-cyclic extension at 72°C for 5 min, storage at 12°C.

[0080] After amplification, agarose gel electrophoresis and gel imaging were used to analyze whether the obtained antibody variable region gene size was correct. The experimental results were as follows: Figure 4 As shown, the marker is in the middle and the band is at 5000 bp.

[0081] BCR-γORF and BCR-κ / ORF ethanol precipitation: Take 30μl of the PCR products of BCR-γORF and BCR-κORF respectively and place them in 8-tube series, then add 120μl of anhydrous ethanol and 6μl of sodium acetate solution, mix thoroughly, and let stand at -80℃ for 30min; centrifuge at 10000rpm for 20min, discard the supernatant, rinse once with 200μl of 70% ethanol and anhydrous ethanol respectively, evaporate the ethanol completely at 56℃, add 40μl of sterile water, oscillate to fully dissolve the precipitate, and detect the concentration of the antibody variable region gene.

[0082] The leader primers used in S3 and S4 are shown in the following primer sequence table 1:

[0083]

[0084]

[0085]

[0086] The J-region primers used in S3 and S4 are shown in the following Primer Sequence Table 2:

[0087] primer ID sequence IGHJ_01 GATGGGCCCTTGGTGGAGGGTGAGGAGACGGTGACCAGGGTGCCCTGGCCCCAGT IGHJ_02 GATGGGCCCTTGGTGGAGGGTGAGGAGACAGTGACCAGGGTGCCACGGCCCCAGA IGHJ_03 GATGGGCCCTTGGTGGAGGGTGAAGAGACGGTGACCATTGTCCCTTGGCCCCAGA IGHJ_04 GATGGGCCCTTGGTGGAGGGTGAGGAGACGGTGACCGTGGTCCCTTGCCCCCAGA IGKJ_01 GATGGTGCAGCCACAGTTCGTTTGATTTCCACCTTGGTCCCTTGGCCGAACGTCC IGKJ_02 GATGGTGCAGCCACAGTTCGTTTGATTTCCACCTTGGTCCCTTGGCCGAACGTCC IGKJ_03 GATGGTGCAGCCACAGTTCGTTTTGATATCCACTTTGGTCCCAGGGCCGAAAGTGA IGKJ_04 GATGGTGCAGCCACAGTTCGTTTGATCTCCACCTTGGTCCCTCCGCCGAAAGTGA IGKJ_05 GATGGTGCAGCCACAGTTCGTTTAATCTCCAGTCGTGTCCCTTGGCCGAAGGTGA IGLJ_01 GGGGCAGCCTTGGGCTGACCTAGGACGGTGACCTTGGTCCCAGTTCCGAAGACAT IGLJ_02 GGGGCAGCCTTGGGCTGACCTAGGACGGTCAGCTTGGTCCCTCCGCCGAATACCA IGLJ_03 GGGGCAGCCTTGGGCTGACCTAAAATGATCAGCTGGGTTCCTCCACCAAATACAA IGLJ_04 GGGGCAGCCTTGGGCTGACCTAGGACGGTCAGCTCGGTCCCCTCACCAAACACCC IGLJ_05 GGGGCAGCCTTGGGCTGACCTAGGACGGTCAGCTCCGTCCCCTCACCAAACACCC IGLJ_06 GGGGCAGCCTTGGGCTGACCGAGGACGGTCACCTTGGTGCCACTGCCGAACACAT IGLJ_07 GGGGCAGCCTTGGGCTGACCGAGGACGGTCAGCTGGGTGCCTCCTCCGAACACAG IGLJ_08 GGGGCAGCCTTGGGCTGACCGAGGGCGGTCAGCTGGGTGCCTCCTCCGAACACAG

[0088] S5. The antibody variable region gene expression cassette obtained in S4 was transduced into 293T cells to express the antibody within 48 hours and the supernatant was collected. The RBD specificity of the supernatant was detected by ELISA to screen for RBD-specific fully human monoclonal antibodies.

[0089] (A) Dilute the antigen with PBS (final concentration 2 μg / mL), 10 μl / well, and coat the 384-well ELISA plate at 4°C overnight or 37°C for 2 hours (preferably at 4°C overnight in this example). NOTE: Centrifuge immediately after addition to ensure that the liquid is at the bottom.

[0090] The experimental system is shown in Table 8 below:

[0091] Reagent Name Catalog Number Original Concentration Final Concentration Dilution Ratio SARS-COV-2RBD Cat:40592-V08H 200μg / mL 2μg / mL 1:100 Goat pab to Hu IgG-ALP Cat:ab97221 1mg / mL 2μg / mL 1:500

[0092] (B) Preparation of PBST (0.05% Tween 20, Cat#TB220): add 0.5 mL of Tween 20 to 1 L of PBS;

[0093] Wash the plate with PBST machine (Thermoscientific wellwash versa) or by hand (the plate after machine washing still needs to be manually tapped / centrifuged for 1 minute using a microplate centrifuge (MPC-P25) to make sure no water or bubbles are visible on the plate).

[0094] Blocking: Add 80 μl of 5% BSA (BioFroxx, Cat. NO: 4240GR100) (prepared in PBST) to the washed plate and place in an incubator at 37°C for 1 hour. Wash the plate with a PBST machine or by hand.

[0095] (C) Sample addition and standard. Standard: 10 μl / well original concentration 1 μg / mL, gradient dilution 250 ng / mL, 125 ng / mL, 62.5 ng / mL, 31.25 ng / mL, 15.63 ng / mL, 7.81 ng / mL, 3.9 ng / mL and 1.95 ng / mL. (Blocking solution dilution); Sample: cell supernatant transfected with antibody gene. Negative control / blank well: blocking solution 10 μl / well.

[0096] Incubate at 37°C for 30 min. Wash the plate in PBST machine or by hand.

[0097] (D) Secondary antibody was added at a concentration of 10 μl / well and then incubated at 37°C for 30 min.

[0098] The experimental system is shown in Table 9 below:

[0099] Secondary Antibody Name Catalog Number Original Concentration Final Concentration Dilution Ratio goat-anti-human IgG-ALP A18808 1.5mg / ml 0.3μg / ml 1:5000 Goat pab to Hu IgG-ALP Ab98532 0.5mg / ml 0.25μg / ml 1:2000

[0100] Wash the plate with PBST machine or by hand. 10μl / well PNPP (disodium p-nitrophenyl phosphate) was used to detect the OD (450mm) values ​​at 5min, 10min, 15min, 20min, 25min, 30min, 35min, 40min, 45min, 50min, 55min and 60min using (Thermoscientific Muttiskan GO). 50mg PNPP powder (Thermo, Prod#34045) + 40mL ddH2O + 10mL Diethanol aminesubstrate Buffer (5X), PNPP was stored at 4℃ in the dark.

[0101] The experimental results are as follows Figure 5As shown, an OD value greater than 0.1 was considered positive.

[0102] The above description is only a preferred embodiment of the present invention, which is only illustrative and not restrictive of the present invention. A person skilled in the art will understand that many changes, modifications and even equivalent changes may be made to the present invention within the spirit and scope defined by the claims of the present invention, but all of them will fall within the scope of protection of the present invention. Sequence Listing: <110> Chongqing Medical University, Feng Yulin <120> Novel coronavirus RBD-specific monoclonal antibodies and their applications <160> 20 <210> twenty one <211> 125 <212> PRT <213> Artificial Sequence <400> twenty one Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly 1 5 10 15 Gly Ser Leu Arg Leu Ser Cys Ala Ala Ser Lys Phe Thr Phe Ser 20 25 30 Asn Tyr Ala Met Asn Trp Val Arg Gln Ala Pro Gly Lys Gly 35 40 Leu Glu Trp Val Ser Ala Ile Ser Gly Ser Gly Gly Asn Thr Tyr 45 50 55 Tyr Ala Asp Ser Val Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn 60 65 70 Ser Lys Asn Thr Leu Tyr Leu Gln Met Asn Ser Leu Arg Ala 75 80 85 Glu Asp Thr Ala Val Tyr Tyr Cys Ala Lys Gly Glu Leu Leu Trp 90 95 100 Phe Gly Glu Leu Leu Glu Asn Trp Phe Asp Pro Trp Gly Gln 105 110 115 Gly Thr Arg Val Thr Val Ser Ser 120 125 <210>22 <211>107 <212>PRT <213>Artificial Sequence <400>22 Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Val Ser Ala Ser Val 1 5 10 15 Gly Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Gly Ile Ser 20 25 30 Ser Trp Leu Ala Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys 35 40 45 Leu Leu Ile Tyr Ala Ala Ser Ser Leu Gln Ser Gly Val Pro Ser 50 55 60 Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile 65 70 75 Ser Ser Leu Gln Pro Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln 80 85 90 Ala Asp Ser Phe Pro Trp Thr Phe Gly Gln Gly Thr Arg Val Glu 95 100 105 Ile Lys <210>23 <211>119 <212>PRT <213>Artificial Sequence <400>23 Gln Val Thr Leu Arg Glu Ser Gly Pro Ala Leu Val Lys Pro Thr 1 5 10 15 Gln Thr Leu Thr Leu Thr Cys Thr Phe Ser Gly Phe Ser Leu Ser 20 25 30 Thr Ser Gly Met Cys Val Ser Trp Ile Arg Gln Pro Pro Gly Lys 35 40 45 Ala Leu Glu Trp Leu Ala Arg Ile Asp Trp Asp Asp Asp Lys Tyr 50 55 60 Tyr Ser Thr Ser Leu Met Thr Arg Leu Thr Ile Ser Lys Asp Thr 65 70 75 Ser Lys Asn Gln Val Val Leu Thr Met Thr Asn Met Asp Pro Val 80 85 90 Asp Thr Ala Thr Tyr Tyr Cys Ala Arg Ile Gln Arg Gly Ile Ala 95 100 105 Ala Asp Tyr Trp Gly Gln Gly Ile Leu Val Thr Val Ser Ser 110 115 <210>24 <211>107 <212>PRT <213>Artificial Sequence <400>24 Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val 1 5 10 15 Gly Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Thr Ile Ser 20 25 30 Ser Tyr Leu Asn Trp Phe Gln Gln Lys Pro Gly Lys Ala Pro Lys 35 40 45 Leu Leu Ile Tyr Val Ala Ser Asn Leu Gln Ser Gly Val Pro Ser 50 55 60 Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile 65 70 75 Ser Ser Leu Gln Pro Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln 80 85 90 Ser Tyr Ser Thr Pro Arg Thr Phe Gly Gln Gly Thr Lys Leu Glu 95 100 105 Ile Lys <210>25 <211>126 <212>PRT <213>Artificial Sequence <400>25 Glu Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly 1 5 10 15 Glu Ser Leu Lys Ile Ser Cys Lys Ala Ser Gly Tyr Ser Phe Thr 20 25 30 Thr Tyr Trp Ile Gly Trp Val Arg Gln Met Pro Gly Lys Gly Leu 35 40 45 Glu Trp Met Gly Ile Ile Tyr Pro Gly Asp Ser Asp Thr Arg Tyr 50 55 60 Ser Pro Ser Phe Gln Gly Gln Val Thr Ile Ser Ala Asp Lys Ser 65 70 75 Ile Thr Thr Ala Tyr Leu Gln Trp Ser Ser Leu Lys Ala Ser Asp 80 85 90 Thr Ala Ile Tyr Tyr Cys Ala Arg Leu Pro Pro His Phe Gly Ser 95 100 105 Gly Ser Tyr Tyr Gly Asn Ala Phe Asp Ile Trp Gly Leu Gly Thr 110 115 120 Met Val Thr Val Ser Ser 125 <210>26 <211>110 <212>PRT <213>Artificial Sequence <400>26 Gln Ser Val Leu Thr Gln Pro Pro Ser Ala Ser Gly Thr Pro Gly 1 5 10 15 Gln Arg Val Thr Ile Ser Cys Ser Gly Ser Ser Ser Asn Ile Gly 20 25 30 Ser Asn Tyr Val Tyr Trp Tyr Gln Gln Leu Pro Gly Thr Ala Pro 35 40 45 Lys Leu Leu Ile Tyr Arg Ser Asn Gln Arg Pro Ser Gly Val Pro 50 55 60 Asp Arg Phe Ser Gly Ser Lys Ser Gly Thr Ser Ala Ser Leu Ala 65 70 75 Ile Ser Gly Leu Arg Ser Glu Asp Glu Ala Asp Tyr Tyr Cys Ala 80 85 90 Thr Trp Asp Asp Ser Leu Thr Gly Pro Val Phe Gly Gly Gly Thr 95 100 105 Lys Leu Thr Val Leu 110 <210>27 <211>130 <212>PRT <213>Artificial Sequence <400>27 Glu Val Gln Leu Val Gln Ser Gly Ser Glu Leu Lys Lys Pro Gly 1 5 10 15 Ala Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Ser Phe Thr 20 25 30 Asp Tyr Ala Met Asn Trp Val Arg Gln Ala Pro Gly Gln Gly 35 40 Leu Glu Trp Met Gly Trp Ile Asn Thr Asn Thr Gly Asn Pro Thr 45 50 55 Tyr Ala Gln Gly Phe Thr Gly Arg Phe Val Phe Ser Leu Asp Thr 60 65 70 Ser Val Ser Thr Ala Tyr Leu Gln Ile Ser Thr Leu Lys Ala Glu 75 80 85 Asp Thr Ala Val Tyr Tyr Cys Ala Ser Thr Val Gly Arg Gly Ser 90 95 100 Gly Thr Tyr Tyr Tyr Gly Asn Tyr Tyr Ser Tyr Ser Met Asp Val 105 110 115 Trp Gly Gln Gly Thr Thr Val Thr Val Ser Ser 120 125 130 <210> 28 <211> 111 <212> PRT <213> Artificial Sequence <400> 28 Gln Ser Ala Leu Thr Gln Pro Ala Ser Val Ser Gly Ser Pro Gly 1 5 10 15 Gln Ser Ile Thr Ile Ser Cys Thr Gly Thr Ser Ser Asp Val Gly 20 25 30 Thr Tyr Asn Tyr Val Ser Trp Tyr Gln Gln His Pro Gly Lys Ala 35 40 45 Pro Lys Leu Met Ile Tyr Asp Val Ser Lys Arg Pro Ser Gly Val 50 55 60 Ser Asn Arg Phe Ser Gly Ser Lys Ser Gly Asn Thr Ala Ser Leu 65 70 75 Thr Ile Ser Gly Leu Gln Ala Glu Asp Glu Ala Asp Phe Tyr Cys 80 85 90 Thr Ser Tyr Thr Gly Ser Ser Thr Ser Val Val Phe Gly Gly Gly 95 100 105 Thr Lys Leu Thr Val Leu 110 <210>29 <211>123 <212>PRT <213>Artificial Sequence <400>29 Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Arg Lys Pro Gly 1 5 10 15 Ala Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr 20 25 30 Ser Tyr Tyr Met His Trp Val Arg Gln Ala Pro Gly Gln Gly Leu 35 40 45 Glu Trp Met Gly Ile Ile Asn Pro Glu Ala Asn Ser Thr Thr Tyr 50 55 60 Ala Gln Lys Phe Gln Gly Arg Val Thr Met Thr Ser Asp Thr Ser 65 70 75 Thr Ser Thr Val Tyr Leu Asp Leu Ser Ser Leu Arg Ser Glu Asp 80 85 90 Thr Ala Val Tyr Tyr Cys Ala Arg Thr Gly Phe Leu Ile Pro Ser 95 100 105 Lys Gly Gly Gly Met Asp Val Trp Gly Gln Gly Thr Thr Val Thr 110 115 120 Val Ser Ser <210>30 <211>111 <212>PRT <213>Artificial Sequence <400>30 Gln Ser Ala Leu Thr Gln Pro Ala Ser Val Ser Gly Ser Pro Glu 1 5 10 15 Gln Ser Ile Thr Ile Ser Cys Thr Gly Thr Ser Ser Asp Val Gly 20 25 30 Val Tyr Asn Tyr Val Ser Trp Tyr Gln Gln His Pro Gly Lys Ala 35 40 45 Pro Lys Leu Met Ile Tyr Asp Val Ser Lys Arg Pro Ser Gly Val 50 55 60 Ser Asn Arg Phe Ser Gly Ser Lys Ser Gly Asn Thr Ala Ser Leu 65 70 75 Thr Ile Ser Gly Leu Gln Ala Glu Asp Glu Ala Asp Tyr Tyr Cys 80 85 90 Ser Ser Tyr Thr Ser Ser Ser Ser Leu Gln Ile Phe Gly Gly Gly 95 100 105 Thr Lys Leu Thr Val Leu 110 <210>31 <211>129 <212>PRT <213>Artificial Sequence <400>31 Gln Val Leu Leu Gln Glu Ser Gly Pro Gly Leu Val Lys Pro Ser 1 5 10 15 Gln Thr Leu Ser Leu Thr Cys Thr Val Ser Gly Gly Ser Ile Ser 20 25 30 Asn Gly Ser Tyr Tyr Trp Ser Trp Ile Arg Gln His Pro Gly Lys 35 40 45 Gly Leu Glu Trp Ile Gly Tyr Ile Tyr Tyr Ser Gly Ser Thr Tyr 50 55 60 Tyr Asn Pro Ser Leu Arg Ser Arg Val Thr Ile Ser Leu Asp Thr 65 70 75 Ser Met Asn Gln Phe Ser Leu Lys Leu Ser Ser Val Thr Ala Ala 80 85 90 Asp Thr Ala Val Tyr Tyr Cys Ala Arg Ile Tyr Arg Gly Thr Met 95 100 105 Val Val Val Phe Ser Asp Leu His Trp Tyr Phe Asp Leu Trp Gly 110 115 120 Arg Gly Thr Leu Val Thr Val Ser Ser 125 <210>32 <211>108 <212>PRT <213>Artificial Sequence <400>32 Ser Tyr Val Val Thr Gln Pro Pro Ser Val Ser Val Ala Pro Gly 1 5 10 15 Lys Thr Ala Arg Ile Thr Cys Gly Gly Asn Asn Ile Gly Ser Lys 20 25 30 Ser Val His Trp Tyr Gln Gln Lys Pro Gly Gln Ala Pro Val Leu 35 40 45 Val Met Tyr Tyr Asp Ser Asp Arg Pro Ser Gly Ile Pro Glu Arg 50 55 60 Phe Ser Gly Ser Asn Ser Gly Asn Thr Ala Thr Leu Thr Ile Ser 65 70 75 Arg Val Glu Ala Gly Asp Glu Ala Asp Tyr Tyr Cys Gln Val Trp 80 85 90 Asp Ser Ser Ala Asp His Tyr Val Phe Gly Thr Gly Thr Lys Val 95 100 105 Thr Val Leu <210>33 <211>122 <212>PRT <213>Artificial Sequence <400>33 Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly 1 5 10 15 Ala Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Ile Phe Thr 20 25 30 Gly Tyr Tyr Met His Trp Val Arg Gln Ala Pro Gly Gln Gly Leu 35 40 45 Glu Trp Met Gly Trp Ile Asn Pro Asn Ser Gly Gly Thr Asn Tyr 50 55 60 Ala Gln Lys Phe Gln Gly Arg Val Thr Met Thr Arg Asp Thr 65 70 Ser Ile Asn Thr Ala Tyr Met Glu Leu Ser Arg Leu Thr Ser Asp 75 80 85 Asp Thr Ala Val Tyr Tyr Cys Ala Arg Asp Ser Leu Phe Ser Arg 90 95 100 Val Asp Trp Tyr Phe Asp Leu Trp Gly Arg Gly Thr Leu Val Thr 105 110 115 Val Ser Ser 120 <210>34 <211>111 <212>PRT <213>Artificial Sequence <400>34 Gln Ser Val Leu Thr Gln Pro Pro Ser Val Ser Gly Ala Pro Gly 1 5 10 15 Gln Arg Val Thr Ile Ser Cys Thr Gly Ser Ser Ser Asn Ile Gly 20 25 30 Ala Gly Tyr Asp Val His Trp Tyr Gln Gln Leu Pro Gly Thr Ala 35 40 45 Pro Lys Leu Leu Ile Tyr Asp Asn Thr Asn Arg Pro Ser Gly Ile 50 55 60 Pro Asp Arg Phe Ser Gly Ser Ser Ser Gly Asn Thr Ala Ser Leu 65 70 75 Thr Ile Thr Gly Ala Gln Ala Glu Asp Glu Ala Asp Tyr Tyr Cys 80 85 90 Asn Ser Arg Asp Ser Ser Gly Asn Thr Val Val Phe Gly Gly Gly 95 100 105 Thr Lys Leu Thr Val Leu 110 <210>35 <211>123 <212>PRT <213>Artificial Sequence <400>35 Gln Val Gln Leu Ile Gln Ser Gly Ala Glu Val Lys Lys Pro Gly 1 5 10 15 Ala Ser Val Lys Val Ser Cys Thr Thr Ser Gly Tyr Thr Phe Thr 20 25 30 Ser Tyr Phe Leu His Trp Val Arg Gln Ala Pro Gly Gln Gly Leu 35 40 45 Glu Trp Met Gly Ile Ile Asn Pro Ser Asp Gly Thr Thr Thr Tyr 50 55 60 Ala Gln Lys Phe Gln Gly Arg Val Thr Met Thr Arg Asp Thr 65 70 Ser Thr Gly Thr Val Ser Met Glu Leu Ser Ser Leu Arg Tyr Glu 75 80 85 Asp Thr Ala Val Tyr Tyr Cys Ala Arg Asp Gly Ala Leu Tyr Ser 90 95 100 Asn Ser Pro Thr Glu Phe Asp Tyr Trp Gly Gln Gly Thr Leu Val 105 110 115 Thr Val Ser Ser 120 <210>36 <211>110 <212>PRT <213>Artificial Sequence <400>36 Gln Ser Val Leu Thr Gln Pro Pro Ser Ala Ser Gly Thr Pro Gly 1 5 10 15 Gln Arg Val Thr Ile Ser Cys Ser Gly Ser Asn Ser Asn Ile Gly 20 25 30 Ser Asn Tyr Val Tyr Trp Tyr Gln Gln Leu Pro Gly Thr Ala Pro 35 40 45 Lys Leu Leu Ile Tyr Arg Asn Asn Gln Arg Pro Ser Gly Val Pro 50 55 60 Asp Arg Phe Ser Gly Ser Lys Ser Gly Thr Ser Ala Ser Leu Ala 65 70 75 Ile Ser Gly Leu Arg Ser Glu Asp Glu Ala Asp Tyr Tyr Cys Thr 80 85 90 Thr Trp Asp Ala Ser Arg Gly Gly Trp Val Phe Gly Gly Gly Thr 95 100 105 Lys Leu Thr Val Leu 110 <210>37 <211>122 <212>PRT <213>Artificial Sequence <400>37 Gln Val Gln Leu Val Gln Ser Gly Pro Glu Val Lys Lys Pro Gly 1 5 10 15 Ala Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr 20 25 30 Ser Tyr Tyr Val His Trp Val Arg Gln Ala Pro Gly His Gly Leu 35 40 45 Glu Trp Met Ala Ile Ile Asn Pro Asp Ala Gly Ser Thr Ser Phe 50 55 60 Ala Gln Arg Phe Gln Gly Arg Leu Thr Met Thr Thr Asp Thr 65 70 Ser Thr Ser Thr Val Tyr Met Gly Leu Asn Ser Leu Arg Ser Glu 75 80 85 Asp Thr Ala Val Tyr Tyr Cys Ala Arg Gly Gly Leu Val Pro Ala 90 95 100 Val Met Pro Ala Leu Asp Tyr Trp Gly Gln Gly Ala Leu Val Thr 105 110 115 Val Ser Ser 120 <210>38 <211>110 <212>PRT <213>Artificial Sequence <400>38 Gln Ser Val Leu Thr Gln Pro Pro Ser Ala Ser Gly Thr Pro Gly 1 5 10 15 Gln Arg Val Thr Ile Ser Cys Ser Gly Ser Ser Ser Asn Ile Gly 20 25 30 Ser Asn Tyr Val Tyr Trp Tyr Gln Gln Leu Pro Gly Thr Ala Pro 35 40 45 Lys Leu Leu Ile Tyr Arg Asn Asn Gln Arg Pro Ser Gly Val Ser 50 55 60 Asp Arg Phe Ser Gly Ser Lys Ser Gly Thr Ser Ala Ser Leu Ala 65 70 75 Ile Ser Gly Leu Arg Ser Glu Asp Glu Ala Asp Tyr Tyr Cys Ala 80 85 90 Ala Trp Asp Asp Ser Leu Ser Gly Pro Val Phe Gly Gly Gly Thr 95 100 105 Lys Leu Thr Val Leu 110 <210> 39 <211> 131 <212> PRT <213> Artificial Sequence <400> 39 Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly 1 5 10 15 Gly Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser 20 25 30 Ser Tyr Ala Met Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu 35 40 45 Glu Trp Val Ser Ala Ile Ser Gly Ser Gly Ser Ser Thr Tyr Tyr 50 55 60 Ala Asp Ser Val Lys Gly Arg Phe Thr Ile Ser Arg Asp Thr Ser 65 70 75 Lys Asn Thr Leu Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu 80 85 Asp Thr Ala Val Tyr Tyr Cys Ala Arg Gly Leu Gln Tyr Tyr Tyr 90 95 100 Asp Thr Ser Gly Tyr Tyr Lys Asp Ser Tyr Tyr Tyr Gly Val Asp 105 110 115 Val Trp Gly Gln Gly Thr Thr Val Thr Val Ser Ser 120 125 130 <210>40 <211>107 <212>PRT <213>Artificial Sequence <400>40 Gln Ser Val Leu Thr Gln Pro Pro Ser Ala Ser Gly Thr Pro Gly 1 5 10 15 Gln Arg Val Thr Ile Ser Cys Ser Gly Ser Ser Ser Asn Ile Gly 20 25 30 Ser Asn Tyr Val Tyr Trp Tyr Gln Gln Leu Pro Gly Thr Ala Pro 35 40 45 Lys Leu Leu Ile Tyr Arg Asn Asn Gln Arg Pro Ser Gly Val Ser 50 55 60 Asp Arg Phe Ser Gly Ser Lys Ser Gly Thr Ser Ala Ser Leu Ala 65 70 75 Ile Ser Gly Leu Arg Ser Glu Asp Glu Ala Asp Tyr Tyr Cys Ala 80 85 90 Ala Trp Asp Asp Ser Leu Ser Gly Pro Val Phe Gly Gly Gly Thr 95 100 105 Lys Leu Thr Val Leu 110

Claims

1. A novel coronavirus SARS-COV-2 RBD-specific monoclonal antibody, characterized in that: The amino acid sequence of the heavy chain variable region is shown in SEQ ID NO:21; the amino acid sequence of the light chain variable region is shown in SEQ ID NO:

22.

2. A novel coronavirus SARS-COV-2 RBD-specific monoclonal antibody, characterized in that: The amino acid sequence of the heavy chain variable region is shown in SEQ ID NO:25; the amino acid sequence of the light chain variable region is shown in SEQ ID NO:26.

Images