Graphene oxide for qRT-PCR detection of circulating microRNAs and preparation method and use thereof

Abstract

The present invention provides a graphene oxide for qRT-PCR detection of circulating microRNAs, and a preparation method and use thereof, which belong to the field of molecular diagnosis of diseases. The present invention provides a graphene oxide prepared by a specific method. The graphene oxide prepared by the present invention can realize high-sensitivity qRT-PCR detection of circulating microRNAs expression levels, and provide a method for early prediction of neoadjuvant chemotherapy response in breast cancer patients. Compared with traditional qRT-qPCR, the method of the present invention can reduce the detection limit of microRNAs by 10 times. The present invention uses qRT-PCR technology based on graphene oxide to achieve high-sensitivity detection of trace microRNAs in plasma related to chemotherapy response in breast cancer patients. The dynamic changes in microRNAs expression levels are conducive to early prediction of the efficacy of neoadjuvant chemotherapy in breast cancer patients. This method has the advantage of non-invasive detection and good application prospects.

Description

Technical Field

[0001] The present invention belongs to the field of molecular diagnosis of diseases, and in particular relates to graphene oxide for qRT-PCR detection of circulating microRNAs, and a preparation method and application thereof. Background Art

[0002] Breast cancer is the most commonly diagnosed cancer and the leading cause of cancer-related death in women worldwide. Neoadjuvant chemotherapy is an important clinical treatment for breast cancer patients because it helps achieve the goals of shrinking lesions, preventing cancer metastasis, and increasing the probability of breast-conserving surgery; it provides patients who cannot undergo stage I surgery with the opportunity to regain surgery. The response to neoadjuvant chemotherapy is highly correlated with the survival rate of breast cancer patients. Early prediction of the response to neoadjuvant chemotherapy can facilitate treatment adjustments on a patient-by-patient basis, which will improve patient outcomes and survival.

[0003] Currently, the clinical evaluation of the efficacy of neoadjuvant chemotherapy mainly uses imaging technology and postoperative histopathological analysis, but these methods have limitations such as low sensitivity, subjectivity and lag. In recent years, many studies have reported the relationship between microRNAs and breast cancer treatment response. For example, the literature "Serum microRNA-21 and microRNA-125b predict the efficacy and prognosis of neoadjuvant chemotherapy for breast cancer" (Liu Lihua et al., Journal of Harbin Medical University, Volume 54, Issue 3, June 2020) studied the predictive value of serum microRNAs (miRNAs) for the response and prognosis of neoadjuvant chemotherapy for breast cancer. The study showed that the expression levels of serum microRNA-21, microRNA-125b and microRNA-155 in patients were significantly higher than those in healthy women before chemotherapy, which can be used as predictive markers for the response and prognosis of neoadjuvant chemotherapy for breast cancer; the literature "Expression of miR-155 in patients with triple-negative breast cancer and its significance in neoadjuvant chemotherapy" (Xie Xiaohong et al., Zhejiang Medicine, Volume 39, Issue 19, 2017) disclosed that the expression level of microRNA-155 after neoadjuvant chemotherapy was significantly lower than that before chemotherapy. MicroRNA-155 can be used as a tumor molecular marker for judging the efficacy and prognosis of neoadjuvant chemotherapy for triple-negative breast cancer. It can be seen that the prior art discloses a variety of microRNAs that can be used as predictive markers for neoadjuvant chemotherapy response and prognosis of breast cancer. However, most microRNAs exist in low concentrations and are difficult to detect.

[0004] Currently, many important microRNAs are present in biological samples at low concentrations. Microarrays, next-generation RNA sequencing, and quantitative real-time fluorescence PCR (qRT-PCR) can be used to detect the expression levels of microRNAs. However, these methods are often expensive, cumbersome to operate, and have low sensitivity and specificity, which limits their routine use. In particular, traditional qRT-PCR has low sensitivity for detecting trace amounts of free nucleic acids and produces false-negative results. Therefore, the use of new or improved detection technologies with high sensitivity can help improve the accuracy of the microRNAs detection process.

[0005] Graphene oxide is an oxidized derivative of graphene with a hexagonal honeycomb structure. 2 region and sp connected to oxygen-containing functional groups 3 Carbon-based region. Previous studies have shown that graphene oxide can adsorb single-stranded DNA through π-π stacking and hydrogen bonding, while double-stranded DNA bases are shielded by negatively charged phosphate groups and have low affinity for graphene oxide. Based on this property, more studies have shown that graphene oxide-qPCR has good detection performance in disease diagnosis. Graphene oxide was further used for qRT-PCR, and it was found that pre-adsorption of primers on the graphene oxide surface can improve the efficiency of primer-template hybridization and reduce nonspecific amplification, thereby improving the sensitivity of qRT-PCR. For example, a patent application with publication number CN113265448A discloses a method for improving the sensitivity and specificity of real-time fluorescence PCR based on graphene oxide. The use of graphene oxide can effectively improve the sensitivity and specificity of PCR technology, but the detection limit of microRNAs using this patented method is only 10 1 copies / μL, there are still certain limitations for the detection of very low concentration microRNAs. Summary of the invention

[0006] In order to solve the problems existing in the prior art, the present invention provides a graphene oxide for qRT-PCR detection of circulating microRNAs and its preparation method and use. The present invention uses the graphene oxide to detect microRNAs related to the response of neoadjuvant chemotherapy in breast cancer patients, thereby realizing early prediction of the efficacy of neoadjuvant chemotherapy in breast cancer patients.

[0007] The present invention provides a method for preparing graphene oxide, which comprises the following steps:

[0008] (1) Mixing graphite powder, potassium nitrate and concentrated sulfuric acid to obtain system 1;

[0009] (2) Mix potassium permanganate, potassium nitrate and concentrated sulfuric acid to obtain system 2;

[0010] (3) adding system 2 into system 1 to react and obtain a reaction solution containing manganese-embedded graphite;

[0011] (4) after the manganese-intercalated graphite is precipitated, the supernatant is removed, and water is added to the obtained manganese-intercalated graphite;

[0012] (5) In step (4), H2O2 is added and stirred to obtain a graphene oxide stock solution;

[0013] (6) dialyzing the prepared graphene stock solution to obtain graphene oxide.

[0014] Further,

[0015] In step (1), the weight ratio of the graphite powder and potassium nitrate is 0.1-1 part of graphite powder and 0.1-1 part of potassium nitrate; and / or the weight volume ratio of the graphite powder and concentrated sulfuric acid is 0.1-1 part of graphite powder and 10-50 parts of concentrated sulfuric acid;

[0016] And / or, in step (2), the weight parts of potassium permanganate and potassium nitrate are 1-10 parts of potassium permanganate and 1-5 parts of potassium nitrate; and / or, the weight volume parts of potassium permanganate and concentrated sulfuric acid are 1-10 parts by weight of potassium permanganate and 10-50 parts by volume of concentrated sulfuric acid;

[0017] Preferably,

[0018] In step (1), the weight ratio of the graphite powder and potassium nitrate is 0.5 parts of graphite powder and 0.5 parts of potassium nitrate; and / or the weight volume ratio of the graphite powder and concentrated sulfuric acid is 0.5 parts of graphite powder and 23 parts of concentrated sulfuric acid;

[0019] And / or, in step (2), the weight parts of potassium permanganate and potassium nitrate are 6 parts of potassium permanganate and 1 part of potassium nitrate; and / or, the weight volume parts of potassium permanganate and concentrated sulfuric acid are 6 parts by weight of potassium permanganate and 46 parts by volume of concentrated sulfuric acid.

[0020] Furthermore, in step (3), the step of adding system 2 to system 1 is to stir system 2 and system 1, and then add system 2 to system 1 in batches; and / or, the reaction is stirred at room temperature overnight;

[0021] And / or, in step (4), the volume ratio of the manganese-intercalated graphite to water is 1:3;

[0022] and / or, in step (5), the concentration of the added H2O2 is 30%; and / or, the volume ratio of the added H2O2 to the manganese-embedded graphite is 1:2; and / or, the stirring time of adding H2O2 is 1 to 5 minutes;

[0023] And / or, in step (6), the dialysis method is to place the graphene oxide stock solution in a 3500Da dialysis bag, and dialyze it in deionized water with a pH of 7.0 until the pH of the solution in the dialysis bag is 7.0.

[0024] The present invention also provides a graphene oxide, which is prepared by the above method.

[0025] The present invention also provides the use of the aforementioned graphene oxide in qRT-PCR detection of circulating microRNA;

[0026] Preferably, the microRNA is microRNA-21, microRNA-155 and / or microRNA-195;

[0027] More preferably, when the microRNA is microRNA-21, the primers are the nucleotide sequences shown in SEQ ID NO.1 and SEQ ID NO.2;

[0028] And / or, when the microRNA is microRNA-155, the primers are the nucleotide sequences shown in SEQ ID NO.3 and SEQ ID NO.4;

[0029] And / or, when the microRNA is microRNA-195, the primers are the nucleotide sequences shown in SEQ ID NO.5 and SEQ ID NO.6.

[0030] The present invention also provides a method for detecting circulating microRNA by qRT-PCR, which comprises the following method:

[0031] 1) incubating the aforementioned graphene oxide with a primer;

[0032] 2) Prepare qRT-PCR reaction system and perform real-time fluorescence quantitative PCR;

[0033] Preferably,

[0034] In step 1), the mass ratio of graphene oxide to primer is 1 to 6:1;

[0035] And / or, in step 1), the graphene oxide is diluted with water to a concentration of 4.77 to 32.52 μg / mL;

[0036] And / or, in step 1), the incubation temperature is 15-35°C and the incubation time is 30±5min;

[0037] More preferably,

[0038] In step 1), the mass ratio of graphene oxide to primer is 4:1;

[0039] And / or, in step 1), the molar ratio of the forward primer to the reaction primer in the primer is 1:1;

[0040] And / or, in step 1), the graphene oxide is diluted with water to a concentration of 7.86 μg / mL;

[0041] And / or, in step 1), the incubation temperature is 25° C. and the incubation time is 30 min.

[0042] The present invention also provides the use of a reagent for detecting microRNA in preparing a kit for evaluating the effect of neoadjuvant chemotherapy for breast cancer; the microRNA is microRNA-195; or the microRNA is microRNA-21, microRNA-155 and microRNA-195;

[0043] Preferably, the reagent for detecting microRNA is a reagent for qRT-PCR test;

[0044] More preferably, the qRT-PCR test reagent includes the aforementioned graphene oxide;

[0045] And / or, when the microRNA is microRNA-195, the primers in the qRT-PCR test reagent are the nucleotide sequences shown in SEQ ID NO.5 and SEQ ID NO.6;

[0046] And / or, when the microRNA is microRNA-21, the primers in the qRT-PCR test reagent are the nucleotide sequences shown in SEQ ID NO.1 and SEQ ID NO.2;

[0047] And / or, when the microRNA is microRNA-155, the primers in the qRT-PCR test reagent are the nucleotide sequences shown in SEQ ID NO.3 and SEQ ID NO.4;

[0048] Further preferably, qRT-PCR detection is performed after the graphene oxide is incubated with primers.

[0049] Furthermore, the reagent for detecting microRNA is a reagent for detecting microRNA in human blood;

[0050] Preferably, the reagent for detecting microRNA is a reagent for detecting microRNA in human plasma.

[0051] The present invention also provides a kit for evaluating the effect of neoadjuvant chemotherapy for breast cancer, which comprises a reagent for detecting microRNA; the microRNA is microRNA-195; or the microRNA is microRNA-21, microRNA-155 and microRNA-195;

[0052] Preferably, the microRNA detection reagent is a qRT-PCR test reagent;

[0053] More preferably, the qRT-PCR test reagent includes the aforementioned graphene oxide;

[0054] And / or, when the microRNA is microRNA-195, the primers in the qRT-PCR test reagent are the nucleotide sequences shown in SEQ ID NO.5 and SEQ ID NO.6;

[0055] And / or, when the microRNA is microRNA-21, the primers in the qRT-PCR test reagent are the nucleotide sequences shown in SEQ ID NO.1 and SEQ ID NO.2;

[0056] And / or, when the microRNA is microRNA-155, the primers in the qRT-PCR test reagent are the nucleotide sequences shown in SEQ ID NO.3 and SEQ ID NO.4;

[0057] Further preferably, qRT-PCR detection is performed after the graphene oxide is incubated with primers.

[0058] Furthermore, the reagent for detecting microRNA is a reagent for detecting microRNA in human blood;

[0059] Preferably, the reagent for detecting microRNA is a reagent for detecting microRNA in human plasma.

[0060] In summary, in order to better improve the sensitivity of qRT-PCR in detecting microRNAs, the present invention provides a graphene oxide prepared by a specific method. The graphene oxide prepared by the present invention can realize high-sensitivity qRT-PCR detection of the expression level of circulating microRNAs (such as microRNA-21, microRNA-155 and microRNA-195), and provide a method for early prediction of the response of neoadjuvant chemotherapy in breast cancer patients. Before qRT-PCR, the graphene oxide is incubated with primers for adsorption. The graphene oxide can enrich the concentration of primers and improve the efficiency of the DNA amplification process, thereby significantly improving the sensitivity of qRT-PCR analysis. Compared with traditional qRT-qPCR, the method of the present invention can reduce the detection limit of microRNAs by 10 times. The present invention uses qRT-PCR technology based on graphene oxide to achieve high-sensitivity detection of trace microRNAs in plasma related to the chemotherapy response of breast cancer patients. The dynamic changes in the expression level of microRNAs are conducive to early prediction of the efficacy of neoadjuvant chemotherapy in breast cancer patients. The method has the advantages of non-invasive detection and good application prospects.

[0061] Obviously, according to the above contents of the present invention, in accordance with common technical knowledge and customary means in the art, without departing from the above basic technical ideas of the present invention, other various forms of modification, replacement or change may be made.

[0062] The above contents of the present invention are further described in detail below through specific implementation methods in the form of embodiments. However, this should not be understood as the scope of the above subject matter of the present invention being limited to the following examples. All technologies realized based on the above contents of the present invention belong to the scope of the present invention. BRIEF DESCRIPTION OF THE DRAWINGS

[0063] Figure 1 These are the characterization results of graphene oxide: a is a high-resolution transmission electron microscope image; b is an atomic force microscope image; c is an ultraviolet-visible light absorption spectrum; d is a Raman spectrum; and e is an X-ray photoelectron spectrum.

[0064] Figure 2 The effect of graphene oxide with different oxidation degrees on the sensitivity of qRT-PCR: a is the high-resolution transmission electron microscopy image of graphene oxide prepared with 10 mL H2O2; b is the atomic force microscopy image of graphene oxide prepared with 10 mL H2O2; c is the effect of graphene oxide prepared with 2.5 mL H2O2 on the sensitivity of qRT-PCR; d is the effect of graphene oxide prepared with 10 mL H2O2 on the sensitivity of qRT-PCR.

[0065] Figure 3The effect of graphene oxide concentration on the sensitivity of qRT-PCR: a is 32.52 μg / mL; b is 23.38 μg / mL, c is 20.14 μg / mL, d is 13.25 μg / mL, e is 7.86 μg / mL; f is the effect of graphene oxide at a concentration of 4.77 μg / mL on qRT-PCR.

[0066] Figure 4 Figure 3 shows the effect of graphene oxide incubation dosage on qRT-PCR sensitivity: a is the mass ratio of graphene oxide to primer when incubated at 1:1; b is 2:1; c is 4:1; d is 6:1.

[0067] Figure 5 is the evaluation result of the sensitivity of qRT-PCR based on graphene oxide; a is the standard curve of qRT-PCR based on graphene oxide, the initial template copy number is 10 0 -10 9 copies / μL; b is the standard curve of traditional qRT-PCR, with the initial template copy number in the range of 10 1 -10 9 copies / μL range; c is the standard curve of qRT-PCR based on graphene oxide, the initial template copy number is 10 6 -10 9 copies / μL; d is the standard curve of traditional qRT-PCR, with the initial template copy number in the range of 10 6 -10 9 copies / μL; e is the standard curve of qRT-PCR based on graphene oxide, and the initial template copy number is 10 0 -10 5 copies / μL; f is the standard curve of traditional qRT-PCR, with the initial template copy number in the range of 10 1 -10 5 copies / μL range.

[0068] Figure 6Figure 3 Expression levels and dynamic changes of plasma microRNAs in responders and non-responders to chemotherapy during neoadjuvant chemotherapy: a is the expression level of microRNA-21 in plasma samples collected continuously from responders and non-responders to chemotherapy determined by graphene oxide-based qRT-PCR, b is the expression level of microRNA-155, and c is the expression level of microRNA-195; d is the ROC curve of microRNA-21 expression level at baseline; e is the ROC curve of microRNA-155 expression level at baseline; f is the ROC curve of microRNA-195 expression level at baseline; g is the combined ROC curve of the three microRNAs at baseline; h is the ROC curve of microRNA-21 expression level at the end of the first NAC cycle; i is the ROC curve of microRNA-155 expression level at the end of the first NAC cycle; j is the ROC curve of microRNA-195 expression level at the end of the first NAC cycle; k is the combined ROC curve of the three microRNAs at the end of the first NAC cycle; *P<0.05, **P<0.01, ***P<0.001. DETAILED DESCRIPTION

[0069] The raw materials and equipment used in the specific embodiments of the present invention are all known products and are obtained by purchasing commercially available products.

[0070] Synthesis and verification of primers and probes

[0071] The microRNAs detected in the embodiments of the present invention are microRNA-21, microRNA-155 and microRNA-195.

[0072] According to the NCBI gene information, the microRNAs gene sequence was searched, and the primers and probes were designed using the primer design software Oligo7.0. Different microRNAs probes were labeled with different fluorescent groups, and the specificity of the primers and probes was verified using the dye method and the traditional TaqMan probe method.

[0073] The primers for detecting each microRNA are shown in Table 1.

[0074] Name Sequence (5′→3′) SEQ ID NO. miRNA-21Forward GCGCAACACCAGTCGATG 1 miRNA-21Reverse AGTGCAGGGTCCGAGGTATT 2 miRNA-155Forward CGCGTTAATGCTAATCGTGATA 3 miRNA-155Reverse AGTGCAGGGTCCGAGGTATT 4 miRNA-195Forward GCGCGTAGCAGCACAGAAAT 5 miRNA-195Reverse AGTGCAGGGTCCGAGGTATT 6

[0075] In this embodiment, the traditional qRT-PCR refers to qRT-PCR without incubating graphene oxide with primers.

[0076] Example 1. Preparation and characterization of graphene oxide

[0077] 1. Preparation of graphene oxide

[0078] Graphene oxide was synthesized by a modified Hummers method, and the sp of graphene oxide was adjusted by adjusting the amount of H2O2 used to 30%. 2 and sp 3 The specific method is as follows:

[0079] (1) At room temperature, add 0.5 g graphite powder, 0.5 g KNO3 and 23 mL concentrated H2SO4 into beaker 1; add 6 g KMnO4, 1 g KNO3 and 46 mL concentrated H2SO4 into beaker 2.

[0080] (2) Place beaker 1 and beaker 2 on a magnetic stirrer and stir them at the same speed for 1.5 hours. Then, every 20 minutes, transfer 4 mL of the mixed solution in beaker 2 to beaker 1 until all the mixed solution in beaker 2 is added to beaker 1. After stirring the mixed solution in beaker 1 overnight at room temperature, put it into a blue-mouth bottle and store it in a sealed state at room temperature in a dark environment to wait for the natural sedimentation of manganese-embedded graphite.

[0081] (3) Take the settled manganese-intercalated graphite, pour out the upper liquid, take two 5 mL portions of manganese-intercalated graphite and add them to two beakers respectively, then add 15 mL of deionized water and stir for 20 minutes. Add 2.5 mL and 10 mL of 30% H2O2 to the two beakers respectively and stir for two minutes to obtain the graphene oxide stock solution.

[0082] (4) The two graphene oxide stock solutions prepared in (3) are placed in 3500Da dialysis bags respectively, and the dialysis bags are then placed in deionized water with a pH of 7.0 for dialysis; when the pH of the solution in the dialysis bag reaches 7.0, the product in the dialysis bag is collected to obtain graphene oxide.

[0083] 2. Characterization of graphene oxide

[0084] Graphene oxide was characterized and analyzed by transmission electron microscopy, atomic force microscopy, UV spectroscopy, Raman spectroscopy and X-ray photoelectron spectroscopy.

[0085] Figure 1 a shows a transmission electron microscope image of graphene oxide. The more regular morphology of the region comes from the incomplete oxidation of the graphene oxide basal surface, which is the sp 2 region, while the disordered region on the basal surface of graphene oxide is composed of high-density oxygen-containing functional groups, representing the sp 3 Area. Figure 1As shown in (b), in the atomic force microscope image, the thickness of the graphene oxide nanosheet is about 1.5nm and the size is 0.2-0.5μm. Analysis of the UV-visible absorption spectrum of graphene oxide nanoparticles (suspended in ultrapure water) shows that there are two characteristic absorption peaks at 229nm and 297nm ( Figure 1 c), the absorption peak at 229 nm is caused by sp 2 The shoulder peak at 297 nm is caused by the π-π* transition of C=C bonds, while the shoulder peak at 297 nm is caused by the n-π* transition of C=O bonds or other functional groups. There are two visible peaks in the Raman spectrum of graphene oxide, corresponding to 1598 cm w1 The G band of 1341cm -1 The D band comes from defects (disordered bands) ( Figure 1 d). The intensity ratio of the D band to the G band (ID / IG) is 1.18. -1 There is a broad peak at the point where the peak is caused by the small flakes in graphene oxide. Figure 1 e describes the X-ray photoelectron spectrum, where the C1s peak consists of five characteristic peaks located at 284.5 eV, 285.3 eV, 286.9 eV, 287.9 ​​eV and 288.9 eV, which correspond to the C=C, CC, CO, C=O and -COOH characteristic peaks of the carbon skeleton, respectively. This indicates that there are a large number of hydroxyl and epoxy groups and sp 3 and sp 2 Hybridized carbon atoms coexist. All characterizations are consistent with the characteristics of graphene oxide, indicating that the graphene oxide of the present invention is successfully prepared.

[0086] Example 2: Establishment and optimization of qRT-PCR method based on graphene oxide

[0087] Before qRT-PCR, the diluted graphene oxide was incubated with primers. Subsequently, the graphene oxide and primer complex was added to the PCR reaction mixture for PCR.

[0088] Adjusting the sp of graphene oxide sheets 2 The size of the area, using different sizes of sp 2The graphene oxide in the region was diluted with ultrapure water, and the UV-visible absorption spectra of graphene oxide of different concentrations were detected using a UV-6300 ultraviolet spectrophotometer. A concentration-absorbance standard curve was drawn, and the concentration of the diluted graphene oxide aqueous solution was found according to the concentration-absorbance standard curve. Graphene oxide of different concentrations was added to the system for qRT-PCR. The incubation ratio of graphene oxide to primers was adjusted to determine the amount of graphene oxide that can produce the best effect in the reaction system. A 10-fold concentration gradient dilution of the DNA standard (10 9 -100 copies / reaction) were used for graphene oxide-based qRT-PCR to evaluate its sensitivity.

[0089] (1) Optimization of the oxidation degree of graphene oxide

[0090] Two graphene oxide solutions prepared with 2.5 mL and 10 mL of 30% H2O2 were applied to the qRT-PCR system respectively, and the degree of reduction of the threshold cycle value was observed to screen out the appropriate graphene oxide solution. Figure 2 ,like Figure 2 As shown in a and 2b, when 10 mL H2O2 (30%) was added, the TEM images of graphene oxide showed a smaller sp 2 Area and more sp 3 The AFM images showed smaller slice layers in the region. Compared with the conventional qRT-PCR (Control), the graphene oxide prepared with 2.5 mL H2O2 (30%) can significantly reduce the Ct value of qRT-PCR ( Figure 2 c), the Ct value of graphene oxide qRT-PCR prepared with 10 mL H2O2 (30%) did not decrease significantly ( Figure 2 d). Therefore, graphene oxide prepared with 2.5 mL H2O2 (30%) shows sp 2 Region and sp 3 This indicates that graphene oxide prepared in this way shows the best performance in qRT-PCR detection.

[0091] The present invention optimizes the surface sp of graphene oxide by adjusting the volume of H2O2 used in the synthesis process of graphene oxide 2 and sp 3 The ratio of the area found that sp 2 and sp 3 The change of the area ratio will affect the adsorption of graphene oxide to single-stranded DNA, thereby affecting the efficiency of the qRT-PCR amplification process. The present invention notes that when the number of C=C bonds on graphene oxide is large, sp 2The abundance of the region increased, and the Ct value of qRT-PCR based on graphene oxide decreased significantly. These results indicate that graphene oxide 2 The region adsorbs single-stranded DNA. Due to the presence of hydroxyl-rich functional groups in graphene oxide, graphene oxide can not only adsorb single-stranded DNA through π-π stacking, but also form hydrogen bonds between the hydroxyl groups of graphene oxide and nucleotide bases. Therefore, compared with what is observed in conventional qRT-PCR, the primer concentration is relatively high in the region where graphene oxide exists. When the template is added, the probability of the primer contacting the template on the graphene oxide surface increases. When the primer and target sequence are completely matched, the binding force between the primer and the target sequence is greater than the adsorption effect of graphene oxide on the primer. At this time, the primer can be separated from the graphene oxide surface, and the PCR reaction can then occur.

[0092] (2) Optimization of graphene oxide solution concentration

[0093] The graphene oxide solution prepared with 2.5 mL of 30% H2O2 was diluted to 32.52 μg / mL, 23.38 μg / mL, 20.14 μg / mL, 13.25 μg / mL, 7.86 μg / mL, and 4.77 μg / mL. After applying these six concentrations of graphene oxide solutions to the qRT-PCR system, the degree of reduction in the threshold cycle value was observed, and the appropriate graphene oxide concentration was screened out. The results are shown in Figure 3 , when the concentration of graphene oxide (GO) is too high (>32.52μg / mL), graphene oxide exhibits an inhibitory effect on qRT-PCR, and there is no typical amplification curve. As the concentration of graphene oxide decreases, the Ct value of qRT-PCR based on graphene oxide also decreases. Compared with traditional qRT-PCR detection, the graphene oxide concentration with the largest reduction in Ct value is 7.86μg / mL. Subsequently, as the concentration of graphene oxide further decreases, the Ct value stops decreasing and gradually approaches the Ct value of traditional qRT-PCR. Therefore, the present invention selects 7.86μg / mL as the appropriate graphene oxide concentration of the present invention.

[0094] (3) Optimization of the amount of graphene oxide and primer incubation

[0095] After determining the optimal graphene oxide concentration, the amount ratio of graphene oxide to primer was adjusted during the incubation of graphene oxide and primer, with the mass ratios being 1:1, 2:1, 4:1 and 6:1, respectively, to determine the amount of graphene oxide that can produce the best effect in the reaction system. Figure 4 When the ratio of graphene oxide to primer is 4:1, the threshold cycle value decreases significantly, and the effect is optimal.

[0096] (4) Construction of a qRT-PCR system based on graphene oxide

[0097] The dialyzed graphene oxide stock solution was sonicated for 5 minutes before dilution with ultrapure water. Before qRT-PCR, the diluted graphene oxide (7.86 μg / mL) was incubated with 10 μM forward primer and 10 μM reverse primer at 25 °C for 30 minutes. Subsequently, 3 μL of the mixture containing graphene oxide and primers was added to a 25 μL PCR reaction mixture, which included 1 μL cDNA, 0.5 μL 10 μM probe, 12.5 μL 2× PerfectStartTM II Probe qPCRSuperMix, and 8 μL enzyme-free water.

[0098] (5) Sensitivity evaluation of graphene oxide-based qRT-PCR method

[0099] Synthetic DNA standards were used to determine the sensitivity of the graphene oxide-based qRT-PCR method. 9 to 10 0 The detection limits of qRT-PCR based on graphene oxide and traditional qRT-PCR (without incubation of graphene oxide with primers) were compared. Figure 5 The standard curve showed that the threshold cycle value of qRT-PCR based on graphene oxide was linear. 0 -10 9 The correlation coefficient was 0.9961 within the range of copies / μL. However, the linear dynamic range of traditional qRT-PCR is narrow, and the standard curve is within 10 1 -10 9 In the range of copies / μL, the correlation coefficient is 0.9967. Compared with traditional qRT-PCR, qRT-PCR based on graphene oxide can reduce the detection limit of traditional qRT-PCR for microRNAs by 10 times, and the threshold cycle value of qRT-PCR based on graphene oxide is also significantly reduced.

[0100] In addition, analysis of PCR amplification efficiency showed that for high initial template copy numbers (>10 6 In the experimental group with a relatively low initial template copy number (10 copies / μL), the relative amplification efficiency of conventional qRT-PCR was comparable to that of graphene oxide-based qRT-PCR (89% vs. 89%). 5In the experimental group with 100 copies / μL), the amplification efficiency of qRT-PCR based on graphene oxide was much higher than that of traditional qRT-PCR (97% vs. 90%). It can be seen that compared with traditional qRT-PCR, the application of graphene oxide prepared by the improved method of the present invention in the qRT-PCR system can increase the detection sensitivity of miRNAs by one order of magnitude and reduce the detection limit to 10 0 copies / μL.

[0101] However, the graphene oxide prepared by the method of the patent application with publication number CN113265448A can only reduce the detection limit of miRNAs to 10 in the qRT-PCR system. 1 It can be seen from the comparison that: compared with the patent application with publication number CN113265448A, the graphene oxide prepared by the present invention has a better effect in the qRT-PCR system.

[0102] In addition, if Figure 5 e and 5f, when detecting low concentration circulating miRNAs (<10 5 In terms of % copies / μL), the graphene oxide prepared by the present invention has a better effect and is more suitable for detecting markers with very low content in clinical samples.

[0103] Example 3: Detection of microRNAs by qRT-PCR based on graphene oxide to predict response to neoadjuvant chemotherapy

[0104] The 65 breast cancer patients included in the study all received 6 to 8 cycles of neoadjuvant chemotherapy, with an interval of 21 days between each cycle. Blood was drawn from the antecubital vein of all patients before the start, at the end of each cycle, and at the end of neoadjuvant chemotherapy. All patients in the study received standard treatment, and the response to neoadjuvant chemotherapy was evaluated by imaging every two cycles.

[0105] Peripheral blood samples were collected in EDTA anticoagulated tubes. Plasma was separated by two-step centrifugation (1600g for 5 min and 16000g for 5 min) and then stored at -80°C for further use. Total microRNA was isolated from 300 μL of plasma, and the extracted microRNA was reverse transcribed into cDNA. Then, graphene oxide-based qRT-PCR was performed under optimal conditions to detect the expression levels of microRNA-21, microRNA-155, and microRNA-195 in the plasma of breast cancer patients.

[0106] The MillerPayne (MP) grading system is used to evaluate the pathological response of the breast. MP grades I, II, and III indicate no response to neoadjuvant chemotherapy, while MP grades IV and V indicate response to neoadjuvant chemotherapy.

[0107] In order to explore the relationship between miRNA expression levels and chemotherapy response, the present invention analyzed the miRNA expression levels of chemotherapy responders and chemotherapy non-responders. The results showed that the plasma levels of microRNA-21, microRNA-155 and microRNA-195 were different between chemotherapy responders and non-responders at the baseline and end of each cycle of neoadjuvant chemotherapy. The expression levels of microRNA-21, microRNA-155 and microRNA-195 in chemotherapy non-responders were significantly higher than those in chemotherapy responders, and there was a significant difference ( Figure 6 ac). The expression levels of microRNA-21, microRNA-155, and microRNA-195 in the subjects changed more significantly from baseline to the end of the first neoadjuvant chemotherapy cycle, and there were significant differences ( Figure 6 ac). These results indicate that the expression levels of microRNA-21, microRNA-155, and microRNA-195 during neoadjuvant chemotherapy can distinguish whether breast cancer neoadjuvant chemotherapy is effective or ineffective, and thus can be used to predict the treatment response of breast cancer neoadjuvant chemotherapy.

[0108] Receiver operating curves were constructed, and the areas under the receiver operating curves and 95% confidence intervals of three plasma microRNAs, namely microRNA-21, microRNA-155, and microRNA-195, for predicting response to neoadjuvant chemotherapy were calculated to evaluate the predictive ability of the selected microRNAs. Figure 6The area under the receiver operating curve values ​​for the expression levels of microRNA-21, microRNA-155, and microRNA-195 at baseline were 0.6686 (95% confidence interval, 0.5738-0.7994), 0.7377 (95% confidence interval, 0.6165-0.8589), and 0.7093 (95% confidence interval, 0.5826-0.8360), respectively. In addition, the combination of the three microRNAs can be used to predict the response to chemotherapy with a high accuracy (area under the receiver operating curve value, 0.7689; 95% confidence interval, 0.6540-0.8839). After the first cycle of neoadjuvant chemotherapy, a significant decrease in the expression levels of these three markers was observed in the subjects. In addition, significant differences in the expression levels of microRNAs were observed between chemotherapy responders and non-responders, and breast cancer patients with lower plasma microRNA expression levels were more likely to achieve pathological complete remission.

[0109] The present invention also calculated the area under the receiver operating curve and 95% confidence interval of the expression levels of the three microRNAs at the end of the first chemotherapy cycle (T2 stage). The results showed that the area under the receiver operating curve values ​​of microRNA-21, microRNA-155 and microRNA-195 in the T2 stage were 0.7964 (95% confidence interval, 0.6508-0.8880), 0.7339 (95% confidence interval, 0.6070-0.8608) and 0.7500 (95% confidence interval, 0.6283-0.8717), respectively. In addition, the combination of the three microRNAs can be used to predict the response to chemotherapy with a high accuracy (area under the receiver operating curve value, 0.8295; 95% confidence interval, 0.7332-0.9258). The above results show that the qRT-PCR detection of microRNAs based on graphene oxide in the present invention has a high sensitivity in predicting the response to neoadjuvant chemotherapy.

[0110] In summary, in order to better improve the sensitivity of qRT-PCR in detecting microRNAs, the present invention provides a graphene oxide prepared by a specific method. The graphene oxide prepared by the present invention can realize high-sensitivity qRT-PCR detection of the expression level of circulating microRNAs (such as microRNA-21, microRNA-155 and microRNA-195), and provide a method for early prediction of the response of neoadjuvant chemotherapy in breast cancer patients. Before qRT-PCR, the graphene oxide is incubated with primers for adsorption. The graphene oxide can enrich the concentration of primers and improve the efficiency of the DNA amplification process, thereby significantly improving the sensitivity of qRT-PCR analysis. Compared with traditional qRT-qPCR, the method of the present invention can reduce the detection limit of microRNAs by 10 times. The present invention uses qRT-PCR technology based on graphene oxide to achieve high-sensitivity detection of trace microRNAs in plasma related to the chemotherapy response of breast cancer patients. The dynamic changes in the expression level of microRNAs are conducive to early prediction of the efficacy of neoadjuvant chemotherapy in breast cancer patients. The method has the advantages of non-invasive detection and good application prospects.

Claims

1. Use of graphene oxide in the preparation of reagents for qRT-PCR detection of circulating microRNA; The preparation method of graphene oxide comprises the following steps: (1) Mix graphite powder, potassium nitrate and concentrated sulfuric acid to obtain system 1; (2) Mix potassium permanganate, potassium nitrate and concentrated sulfuric acid to obtain system 2; (3) adding system 2 into system 1 to obtain a reaction solution containing manganese-embedded graphite; (4) After the manganese-intercalated graphite is precipitated, the supernatant is removed and water is added to the obtained manganese-intercalated graphite; (5) In step (4), H2O2 is added and stirred to obtain a graphene oxide stock solution; (6) dialyzing the prepared graphene oxide stock solution to obtain graphene oxide; In step (1), the weight ratio of the graphite powder and potassium nitrate is 0.5 parts of graphite powder and 0.5 parts of potassium nitrate; the weight volume ratio of the graphite powder and concentrated sulfuric acid is 0.5 parts of graphite powder and 23 parts of concentrated sulfuric acid; In step (2), the weight proportions of potassium permanganate and potassium nitrate are 6 parts of potassium permanganate and 1 part of potassium nitrate; the weight and volume proportions of potassium permanganate and concentrated sulfuric acid are 6 parts of potassium permanganate and 46 parts of concentrated sulfuric acid; In step (4), the volume ratio of the manganese-embedded graphite to water is 1:3; In step (5), the concentration of the added H2O2 is 30%; the volume ratio of the added H2O2 to the manganese-embedded graphite is 1:2; The method for detecting circulating microRNA by qRT-PCR described in the application is: Graphene oxide diluted with water to a concentration of 7.86 μg / mL was incubated with primers, with the mass ratio of graphene oxide to primers being 4:1, to prepare a qRT-PCR reaction system, and perform real-time fluorescence quantitative PCR.

2. The use according to claim 1, characterized in that: The incubation temperature is 15-35°C, and the incubation time is 30±5min.

3. The use according to claim 1, characterized in that: In step (3), the step of adding system 2 to system 1 is to stir system 2 and system 1 and then add system 2 to system 1 in batches; and / or, the reaction is stirred at room temperature overnight; And / or, in step (5), the time of adding H2O2 and stirring is 1 to 5 minutes; And / or, in step (6), the dialysis method is to place the graphene oxide stock solution in a 3500Da dialysis bag, and dialyze it in deionized water with a pH of 7.0 until the pH of the solution in the dialysis bag is 7.

0.

4. The use according to claim 1, characterized in that: The molar ratio of the forward primer to the reverse primer in the primers is 1:1; And / or, the incubation temperature is 25° C. and the incubation time is 30 min.

5. The use according to claim 1, characterized in that: The circulating microRNA is microRNA-21, microRNA-155 and / or microRNA-195.

6. The use according to claim 5, characterized in that: When the circulating microRNA is microRNA-21, the primers are the nucleotide sequences shown in SEQ ID NO.1 and SEQ ID NO.2; And / or, when the circulating microRNA is microRNA-155, the primers are the nucleotide sequences shown in SEQ ID NO.3 and SEQ ID NO.4; And / or, when the circulating microRNA is microRNA-195, the primers are the nucleotide sequences shown in SEQ ID NO.5 and SEQ ID NO.

6.

7. Use of a reagent for detecting circulating microRNA in preparing a kit for evaluating the effect of neoadjuvant chemotherapy for breast cancer; the circulating microRNA is microRNA-195; or the circulating microRNA is microRNA-21, microRNA-155 and microRNA-195; The reagent for detecting circulating microRNA is a reagent for qRT-PCR test; The qRT-PCR test reagent comprises the graphene oxide described in any one of claims 1 to 6; The qRT-PCR method for detecting circulating microRNAs is: Graphene oxide diluted with water to a concentration of 7.86 μg / mL was incubated with primers, with the mass ratio of graphene oxide to primers being 4:1, to prepare a qRT-PCR reaction system, and perform real-time fluorescence quantitative PCR.

8. The use according to claim 7, characterized in that: When the circulating microRNA is microRNA-195, the primers in the qRT-PCR test reagent are the nucleotide sequences shown in SEQ ID NO.5 and SEQ ID NO.6; And / or, when the circulating microRNA is microRNA-21, the primers in the qRT-PCR test reagent are the nucleotide sequences shown in SEQ ID NO.1 and SEQ ID NO.2; And / or, when the circulating microRNA is microRNA-155, the primers in the qRT-PCR test reagent are the nucleotide sequences shown in SEQ ID NO.3 and SEQ ID NO.

4.

9. The use according to claim 7 or 8, characterized in that: The reagent for detecting circulating microRNA is a reagent for detecting circulating microRNA in human blood.

10. The use according to claim 9, characterized in that: The reagent for detecting circulating microRNA is a reagent for detecting circulating microRNA in human plasma.

11. A kit for evaluating the effect of neoadjuvant chemotherapy for breast cancer, characterized in that: The method comprises a reagent for detecting circulating microRNA; the circulating microRNA is microRNA-195; or the circulating microRNA is microRNA-21, microRNA-155 and microRNA-195; The reagent for detecting circulating microRNA is a reagent for qRT-PCR test; The qRT-PCR test reagent comprises the graphene oxide described in any one of claims 1 to 6; The qRT-PCR method for detecting circulating microRNAs is: Graphene oxide diluted with water to a concentration of 7.86 μg / mL was incubated with primers, with the mass ratio of graphene oxide to primers being 4:1, to prepare a qRT-PCR reaction system, and perform real-time fluorescence quantitative PCR.

12. The kit according to claim 11, characterized in that: When the circulating microRNA is microRNA-195, the primers in the qRT-PCR test reagent are the nucleotide sequences shown in SEQ ID NO.5 and SEQ ID NO.6; And / or, when the circulating microRNA is microRNA-21, the primers in the qRT-PCR test reagent are the nucleotide sequences shown in SEQ ID NO.1 and SEQ ID NO.2; And / or, when the circulating microRNA is microRNA-155, the primers in the qRT-PCR test reagent are the nucleotide sequences shown in SEQ ID NO.3 and SEQ ID NO.

4.

13. The kit according to claim 11 or 12, characterized in that: The reagent for detecting circulating microRNA is a reagent for detecting circulating microRNA in human blood.

14. The kit according to claim 13, characterized in that: The reagent for detecting circulating microRNA is a reagent for detecting circulating microRNA in human plasma.

Images