A non-restriction endonuclease mutant and preparation method thereof
By mutation of specific amino acid sites on the non-restricted endonuclease analyte sequence, the endonuclease mutants that are highly secreted and expressed are solved, and the problems of low yield and complex process in the prior art are achieved, and efficient secretion is achieved and increase activity, reducing the cost of use.
Patent Information
- Application Number
- CN202211550436.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-12-05
- Publication Date
- 2024-12-10
- Estimated Expiration
- 2042-12-05
AI Technical Summary
The existing non-specific endonucleases have low secretion yields in E. coli, cumbersome processes and expensive prices, making it difficult to meet market demand.
Mutations of six amino acid sites, including R65V, N66A, W67F, E135G, D136T, Q137I, were constructed with efficient secretion expression of non-restricted endonuclease mutations on the wild-type non-restricted endonuclease amino acid sequence, including R65V, N66A, W67F, E135G, D136T, Q137I. and prepared by recombinant expression vectors and genetic engineering methods.
The secretion expression level and activity of non-restrictive endonucleases are significantly improved, production costs are reduced, and process flow is simplified.
Smart Images
Figure CN116064476B_ABST
Abstract
Description
Technical Field
[0001] The invention relates to the technical field of bioenzymes, and relates to a non-restrictive endonuclease mutant and a preparation method thereof, and in particular to the construction and application of a high-activity endonuclease mutant with secretory expression. Background Art
[0002] Non-specific endonucleases are a class of hydrolases that can degrade various forms of DNA and RNA. They have high activity against the phosphodiester bonds of single-stranded, double-stranded, linear, circular, and supercoiled forms of DNA and RNA, producing 5'-phosphate nucleotides or 5'-phosphate oligonucleotides, and have no sequence requirements for nucleic acids. They can be used to remove nucleic acids from biological materials or eliminate interference caused by nucleic acids.
[0003] A typical representative of this type of enzyme is the nonspecific endonuclease derived from Serratia marcescens, which has been commercialized under the trade name The gene of the enzyme has been cloned and expressed in Escherichia coli. Since the enzyme has a signal peptide, the generated nuclease is secreted into different parts such as the periplasm and culture medium. So far, the enzyme has been mainly isolated and purified from the culture medium. However, only a small amount of the enzyme is secreted outside the cell, and many are present in the periplasm and in the form of inactive precursor inclusion bodies inside the cell. Some people have solubilized and renatured the inclusion bodies, and although they have obtained active enzymes, because they are precursor proteins with a signal peptide, the specific activity is not high. Therefore, the yield of the enzyme is low, the process is cumbersome, and the price is expensive, which is not conducive to use in my country. Therefore, how to construct and prepare a new type of non-specific endonuclease so that the non-specific endonuclease can be efficiently secreted and expressed and the activity is improved is a hot spot and difficulty in the research of this industry.
[0004] The present invention successfully obtains a non-specific nuclease mutant with efficient secretory expression and high activity through point mutation and codon optimization, which significantly increases the yield of the enzyme and simplifies the process. Summary of the invention
[0005] In order to solve the problems in the prior art, the present invention provides a non-restriction endonuclease mutant with high secretion level and a preparation method thereof.
[0006] To achieve the above object, the technical scheme of the present invention is as follows: a non-restrictive endonuclease mutant of the present invention is obtained by mutating six amino acid sites on the amino acid sequence of a wild-type non-restrictive endonuclease, the six amino acid mutation sites are: R65V, N66A, W67F, E135G, D136T, Q137I, and the amino acid sequence of the non-restrictive endonuclease mutant is shown in SEQ ID NO.1.
[0007] The nucleotide sequence of the gene encoding the non-restrictive endonuclease mutant of the present invention is shown in SEQ ID NO.2.
[0008] The present invention comprises a recombinant expression vector of the gene.
[0009] The present invention discloses an Escherichia coli expression bacterium, which contains the recombinant expression vector.
[0010] The method for preparing the non-restrictive endonuclease mutant of the present invention comprises the following steps:
[0011] (1) obtaining a gene encoding a non-restriction endonuclease mutant;
[0012] (2) Construction of the recombinant expression vector pCold-Nse-mut
[0013] First, the expression vector pCold-I was double-digested with restriction endonucleases Kpn I and EcoR I to obtain a linearized pCold-I vector; then, the sequence obtained in step (1) was ligated into the linearized pCold-I vector using non-ligase-dependent single fragment rapid cloning to obtain a recombinant expression vector pCold-Nse-mut;
[0014] (3) Construction of recombinant bacteria Nse-mut / BL21
[0015] The recombinant expression vector pCold-Nse-mut was transformed into BL21 competent cells, spread on LB agar plates containing ampicillin resistance for culture, and positive recombinant bacteria were selected and named Nse-mut / BL21;
[0016] (4) Induce expression overnight and activate the recombinant bacteria Nse-mut / BL21 by plating. Take the induced recombinant bacterial solution, centrifuge, discard the supernatant, add PBS to resuspend the bacteria and perform ultrasonic treatment, then add 5×SDS sample lysis buffer, boil in water bath for 10 minutes, centrifuge, take the supernatant, and affinity purify the recombinant fusion protein through the His-tag tag to obtain a non-restriction endonuclease mutant.
[0017] Furthermore, in step (2), the primers used to amplify the gene of the non-restrictive endonuclease mutant are: primer Nse-mut-F having the nucleotide sequence of SEQ ID NO.3; and primer Nse-mut-R having the nucleotide sequence of SEQ ID NO.4.
[0018] Further, in step (4), a single colony was picked and inoculated into LB liquid culture medium containing 100 μg / ml ampicillin, and cultured at 37°C with shaking overnight; the newly cultured bacterial liquid was transferred to LB liquid culture medium containing ampicillin resistance at a volume ratio of 1:10, and cultured at 37°C until OD600 was 0.4-0.6, and IPTG with a final concentration of 0.2 mmol / L was added, and induced at 16°C for 24 hours to obtain the induced recombinant bacterial liquid.
[0019] The non-restrictive endonuclease mutant or the gene or the recombinant expression vector of the present invention is used in a nuclease cleavage reaction.
[0020] Beneficial effects: The present invention changes the charge or hydrophobicity of amino acids at key mutation sites, thereby changing the spatial structure of the nuclease and improving the expression efficiency and activity of the non-restrictive nuclease.
[0021] Compared with the prior art, the present invention has the following advantages:
[0022] (1) The novel non-restriction endonuclease mutant and its encoding gene sequence of the present invention, and the non-restriction endonuclease mutant prepared by genetic engineering method, meet the market demand for non-restriction endonucleases.
[0023] (2) The experiment shows that the secretion expression level of a non-restrictive endonuclease mutant disclosed in the present invention is significantly superior to that of the wild type. The experiment shows that the enzyme specific activity of a non-restrictive endonuclease mutant disclosed in the present invention is significantly superior to that of the wild type. The present invention provides a solution for reducing the cost of using endonucleases. BRIEF DESCRIPTION OF THE DRAWINGS
[0024] Other features, objects and advantages of the present invention will become more apparent from the detailed description of non-limiting embodiments made with reference to the following drawings:
[0025] Figure 1 is a sequence design diagram of a non-restrictive endonuclease mutant of the present invention;
[0026] Figure 2 This is a diagram showing the PCR amplification results of the endonuclease mutant of the present invention;
[0027] M: DNA Marker DL1000; 1-4: PCR products; 5: negative control;
[0028] Figure 3 This is a diagram showing the identification results of the recombinant bacteria Nse-mut / BL21 PCR of the present invention;
[0029] M: DNA Marker DL1000; 1-5: PCR amplification results of recombinant bacteria Nse-mut / BL21; 6: negative control;
[0030] Figure 4 The figure is a PAGE gel image of the purification of the endonuclease mutant protein of the present invention;
[0031] M: protein marker; 1-2: Nse-mut / BL21-1; 3-4: Nse-mut / BL21-1. DETAILED DESCRIPTION
[0032] The present invention is described in detail below in conjunction with specific embodiments. The following embodiments will help those skilled in the art to further understand the present invention, but are not intended to limit the present invention in any form. It should be noted that, for those of ordinary skill in the art, several variations and improvements may be made without departing from the concept of the present invention. These all belong to the protection scope of the present invention.
[0033] A non-restrictive endonuclease mutant of the present invention is obtained by mutating six amino acid sites on the amino acid sequence of a wild-type non-restrictive endonuclease, wherein the six amino acid mutation sites are: R65V, N66A, W67F, E135G, D136T, and Q137I. The amino acid sequence of the non-restrictive endonuclease mutant is shown in SEQ ID NO.1.
[0034] The nucleotide sequence of the gene encoding the non-restrictive endonuclease mutant of the present invention is shown in SEQ ID NO.2.
[0035] The present invention comprises a recombinant expression vector of the gene.
[0036] The present invention discloses an Escherichia coli expression bacterium, which contains the recombinant expression vector.
[0037] The non-restrictive endonuclease mutant or the gene or the recombinant expression vector of the present invention is used in a nuclease cleavage reaction.
[0038] Example 1
[0039] Sequence design of non-restriction endonuclease mutants
[0040] This example simulates the three-dimensional structure of a wild-type recombinant non-restrictive endonuclease (Nse), constructs a gene sequence containing the Serratia marcescens endonuclease, connects it to a vector and introduces it into Escherichia coli for expression, and determines that six mutation points are R65V, N66A, W67F, E135G, D136T, and Q137I. A non-restrictive endonuclease mutant gene is obtained, and its amino acid sequence is shown in SEQ ID No. 1. The specific steps are as follows:
[0041] The amino acid sequence of the wild-type recombinant non-restriction endonuclease was modeled using Swiss-Model software to obtain its three-dimensional structure, and six mutation target sites, R65V, N66A, W67F, E135G, D136T, and Q137I, were determined. Figure 1 shown.
[0042] (2) The codons of the recombinant non-restriction endonuclease mutant were optimized according to the codon preference of Escherichia coli to obtain the optimized nucleotide sequence shown in SEQ ID No. 2.
[0043] (3) The recombinant non-restrictive nuclease mutant gene was obtained by chemical synthesis method of Suzhou Jinweizhi Biotechnology Co., Ltd.
[0044] Example 2
[0045] Construction of Escherichia coli expression strain for recombinant non-restriction endonuclease mutant (Nse-mut)
[0046] 1. Construction of recombinant expression vector pCold-Nse-mut
[0047] First, the expression vector pCold-I was double-digested with restriction endonucleases Kpn I and EcoR I, and the target gene fragment was recovered using a DNA gel recovery kit to obtain a linearized pCold-I vector.
[0048] Secondly, homologous recombination primers (Nse-mut-F:TATGGAGCTCGGTACCATGCATCACCACCACCACCAT (SEQ ID NO.3); Nse-mut-R:GACAAGCTTGAATTCTTAGTTTTTACAGCCCATCAGTTC (SEQ ID NO.4)) were designed and amplified using the optimized Nse-mut gene obtained in Example 1 as a template.
[0049] The PCR reaction system was: 25 μL of 2×Phanta Max Master Mix, 2 μL of each primer (Nse-mut-F and Nse-mut-R, 10 uM), 3 μL of cDNA template, and 18 μL of ddH2O.
[0050] PCR reaction conditions: 95°C for 3 min; 95°C for 15 s, 56°C for 15 s, 72°C for 30 s, for a total of 34 cycles; final extension at 72°C for 5 min.
[0051] The PCR product was detected by 1% agarose gel electrophoresis and recovered by DNA gel recovery kit to obtain the Nse-mut gene fragment (see the results). Figure 2 shown).
[0052] Finally, the Nse-mut gene was ligated into the linearized pCold-I vector using a ligase-independent single-fragment rapid cloning kit to construct the recombinant expression vector pCold-Nse-mut.
[0053] 2. Construction of recombinant bacteria Nse-mut / BL21
[0054] The recombinant expression vector pCold-Nse-mut was transformed into BL21 competent cells and plated on LB agar plates containing ampicillin resistance for culture. Positive recombinant bacteria were selected and PCR was used (results in Figure 3 The recombinant bacteria were identified and named Nse-mut / BL21.
[0055] Example 3
[0056] Expression and purification of recombinant non-restriction endonuclease mutant (Nse-mut)
[0057] For the positive recombinant bacteria Nse-mut / BL21 in the overnight plating implementation case 2, a single colony was picked and inoculated into 5mL of LB liquid culture medium containing 100μg / ml ampicillin, and cultured at 37℃ overnight with shaking. The new culture solution was transferred to 20mL of LB liquid culture medium containing ampicillin resistance at a ratio of 1:10, and cultured at 37℃ until OD600 was about 0.5, and IPTG with a final concentration of 0.2mmol / L was added, and induced at 16℃ for 24h. Take 2mL of the induced recombinant bacterial solution, centrifuge at 12000rpm for 5min, discard the supernatant, add 400μL PBS to resuspend the bacteria and perform ultrasonic treatment, then add 100μL 5×SDS sample lysis buffer, boil in water bath for 10min, centrifuge at 12000rpm for 10min, take the supernatant for 12% SDS-PAGE analysis, and the results show that the recombinant protein has obtained prokaryotic soluble expression. The recombinant fusion protein was purified by His-tag affinity to obtain the non-restrictive endonuclease mutant of the present invention (see Figure 4 ).
[0058] Example 4
[0059] Determination of the enzymatic activity of recombinant non-restriction endonuclease mutants
[0060] Non-restriction endonucleases can digest DNA into 3-8b oligonucleotide chains.
[0061] The enzyme activity of the non-restrictive endonuclease mutant was determined by spectrophotometry. The following activity determination reagents and analytical solution were prepared: 50mM Tris-HCl, 5mM MgCl2, pH 8.0. The salmon sperm DNA was diluted to different concentrations with the analytical solution, and the purified non-restrictive endonuclease mutant was added, and then placed in a 37°C water bath. After incubation for 30 minutes, samples were taken for agarose gel electrophoresis.
[0062] The activity unit is defined as the amount of enzyme required to change the absorbance value A260 of salmon sperm DNA by 1.0 at 37°C for 30 minutes (equivalent to the amount of enzyme that completely digests 37 μg of salmon sperm DNA).
[0063] The results of the non-restrictive endonuclease activity assay are shown in Table 1.
[0064] Table 1
[0065]
[0066] As shown in Table 1, the wild-type enzyme activity of the non-restrictive endonuclease is 149.3 U / μL, and the specific activity is 0.47*10 6 , while the enzyme activity of the mutant Nse-mut of the present invention is 380.6U / μL, and the specific activity is 1.31*10 6 Significantly higher than the wild type.
[0067] The above embodiments are only for illustrating the technical concept and features of the present invention, and their purpose is to enable ordinary technicians in the field to understand the content of the present invention and implement it accordingly, and they cannot be used to limit the protection scope of the present invention. Any equivalent changes or modifications made based on the essence of the content of the present invention should be included in the protection scope of the present invention.
Claims
1. A non-restriction endonuclease mutant, characterized in that: Six amino acid mutation sites were mutated on the wild-type non-restrictive endonuclease amino acid sequence to obtain the mutant, wherein the six amino acid mutation sites are: R65V, N66A, W67F, E135G, D136T, and Q137I. The amino acid sequence of the non-restrictive endonuclease mutant is shown in SEQ ID NO.
1.
2. A gene encoding the non-restrictive endonuclease mutant according to claim 1, wherein the nucleotide sequence thereof is shown in SEQ ID NO.
2.
3. A recombinant expression vector comprising the gene according to claim 2.
4. An Escherichia coli expression strain characterized by: Contains the recombinant expression vector according to claim 3.
5. The method for preparing a non-restrictive endonuclease mutant according to claim 1, characterized in that The steps include: (1) obtaining a gene encoding the non-restriction endonuclease mutant according to claim 1, wherein the nucleotide sequence of the gene encoding the non-restriction endonuclease mutant is shown in SEQ ID NO. 2; (2) Construction of the recombinant expression vector pCold-Nse-mut First, the expression vector pCold-I was double-digested with restriction endonucleases Kpn I and EcoR I to obtain a linearized pCold-I vector; then, the sequence obtained in step (1) was ligated into the linearized pCold-I vector using non-ligase-dependent single fragment rapid cloning to obtain a recombinant expression vector pCold-Nse-mut; (3) Construction of recombinant bacteria Nse-mut / BL21 The recombinant expression vector pCold-Nse-mut was transformed into BL21 competent cells, spread on LB agar plates containing ampicillin resistance for culture, and positive recombinant bacteria were selected and named Nse-mut / BL21; (4) Induce expression overnight and activate the recombinant bacteria Nse-mut / BL21 by plating. Take the induced recombinant bacterial solution, centrifuge, discard the supernatant, add PBS to resuspend the bacteria and perform ultrasonic treatment, then add 5×SDS sample lysis buffer, boil in water bath for 10 minutes, centrifuge, take the supernatant, and affinity purify the recombinant fusion protein through the His-tag tag to obtain a non-restriction endonuclease mutant.
6. The method for preparing a non-restrictive endonuclease mutant according to claim 5, characterized in that: In step (2), the primers used to amplify the gene of the non-restrictive endonuclease mutant are: primer Nse-mut-F having the nucleotide sequence of SEQ ID NO.3; primer Nse-mut-R having the nucleotide sequence of SEQ ID NO.
4.
7. The method for preparing a non-restrictive endonuclease mutant according to claim 6, characterized in that: In step (4), a single colony is picked and inoculated into LB liquid culture medium containing 100 μg / ml ampicillin, and cultured at 37°C with shaking overnight; the newly cultured bacterial liquid is transferred to LB liquid culture medium containing ampicillin resistance at a volume ratio of 1:10, and cultured at 37°C until OD6000.4-0.6, IPTG with a final concentration of 0.2 mmol / L is added, and induced at 16°C for 24 hours to obtain the induced recombinant bacterial liquid.
8. Use of the non-restrictive endonuclease mutant according to claim 1, the gene according to claim 2, or the recombinant expression vector according to claim 3 in a nuclease cleavage reaction.