A barley agmatine coumaroyltransferase gene HvACT2 and its application in improving barley disease resistance

Abstract

The present invention discloses an agmatine coumaroyl transferase gene HvACT2 and its application in improving the disease resistance of barley. The present invention clones and analyzes the barley agmatine coumaroyl transferase synthesis gene HvACT2 for the first time, confirms the function of the HvACT2 gene in the synthesis of hydroxycinnamic acid amide and malt guanidine by transgenic means for the first time, and finds that overexpression of HvACT2 can significantly improve the disease resistance of barley. The present invention also finds that HvACT2 has the function of catalyzing the synthesis of p-coumaroyl agmatine and feruloyl agmatine. The present invention also finds that the transient expression of HvACT2 synthesizes a variety of agmatine amides in tobacco, and tobacco does not originally have such substances, that is, the expression of exogenous genes causes tobacco to synthesize agmatine amides, and it is also found that the expression of HvACT2 in tobacco also increases the content of caffeoyl putrescine.

Description

Technical Field

[0001] The invention relates to the technical field of biological gene engineering, and in particular to an agmatine coumaroyl transferase gene HvACT2 and an application thereof in improving disease resistance of barley. Background Art

[0002] Barley (Hordeum vulgare L.) is the fourth largest cereal crop grown worldwide and one of the main raw materials for feed and brewing. Barley is grown in a wide range of areas with different ecological environments, and is often subject to various biological and abiotic stresses during its growth and development. Plants can respond to various stresses by regulating their metabolic activities. Many metabolites not only participate in the growth and development of plants, but also play an important role as natural defense substances in resisting adverse stress.

[0003] Phenolamide compounds are a typical class of plant defense metabolites. Hordeoyl agmatine is a class of phenolamides unique to barley. It is composed of two molecules of coumaroyl agmatine or feruloyl agmatine and has strong antifungal activity. The synthesis of hydroxycinnamic acid amides is regulated by N-hydroxycinnamoyl transferase. Barley agmatinecoumaroyl transferase is the first N-hydroxycinnamoyl transferase discovered in plants. In the 1980s, it was first discovered that barley crude extract can catalyze the synthesis of coumaroyl agmatine from coumaroyl-CoA and agmatine, and this enzyme was named agmatine-N-4-coumaryltransferase (EC2.3.1.-). Later, the ACT enzyme (EC2.3.1.64) was purified from barley seedlings. Through prokaryotic expression in Escherichia coli and substrate feeding experiments, it was found that the enzyme has substrate selection specificity for the acyl acceptor agmatine.

[0004] At present, the key genes regulating the synthesis of hordenine are still unclear. Summary of the invention

[0005] The invention provides a barley agmatine coumaroyl transferase gene HvACT2 and a new use thereof in improving the disease resistance of barley, and the gene can be applied to the breeding of disease-resistant barley varieties.

[0006] The specific technical solutions are as follows:

[0007] The invention provides a barley agmatine coumaroyl transferase gene HvACT2, the nucleotide sequence of which is shown as SEQ ID NO.1, and the full-length nucleotide sequence of its transcript cDNA is shown as SEQ ID NO.2.

[0008] The present invention identified a new ACT gene (such as the attached Figure 1The gene is located on barley chromosome 2HS and is named HvACT2. Its function and role in improving crop disease resistance have been clarified.

[0009] The present invention also provides the amino acid sequence of the barley agmatine coumaroyltransferase ACT2 protein encoded by the gene as shown in SEQ ID NO.3.

[0010] The present invention cloned the genomic DNA sequence of the gene from barley, as shown in SEQ No.1, and simultaneously cloned the full-length cDNA sequence of the HvACT2 gene, as shown in SEQ No.2. The amino acid sequence encoded by the gene is shown in SEQ No.3.

[0011] The present invention also provides an overexpression recombinant vector comprising the barley agmatine coumaroyltransferase gene HvACT2 described above; specifically, the recombinant vector is constructed by connecting a 1650 bp gene fragment of the coding region in the full-length cDNA sequence encoding the gene HvACT2 shown in SEQ ID No: 2 into the attR1 and attR2 sites of the pBract214 vector.

[0012] The present invention also provides a CAS9 gene editing vector, which connects the gene target site into the pUB-cas9-U6 vector.

[0013] The present invention also provides a prokaryotic expression vector of barley agmatine coumaroyl transferase gene HvACT2, which is a 1650 bp gene fragment of the coding region in the full-length cDNA sequence of the coding gene HvACT2 shown in SEQ ID No. 2 connected to a pET28a vector.

[0014] The invention provides the use of the barley agmatine coumaroyltransferase gene HvACT2 in improving the disease resistance of barley, wherein the disease resistance is resistance to powdery mildew and / or fusarium head blight.

[0015] The present invention overexpresses the HvACT2 gene in the barley variety Golden Promise, and finds that overexpressing the gene can significantly increase the abundance of various hydroxycinnamic acid amides in barley, and can significantly increase the plant's resistance to powdery mildew and fusarium head blight. The content changes of various hydroxycinnamic acid amides in the cas9 gene-edited material are not significant, and only the content of hordenine C is significantly reduced in the gene-edited strain.

[0016] Furthermore, the barley agmatine coumaroyltransferase gene HvACT2 improves the disease resistance of barley by promoting the synthesis of hydroxycinnamic acid amide and hordeoguanidine.

[0017] Compared with the prior art, the present invention has the following beneficial effects:

[0018] (1) The present invention cloned and analyzed the barley agmatine coumaroyltransferase synthesis gene HvACT2 for the first time, and published the nucleotide sequence and amino acid sequence of the gene, providing a basis for clarifying the synthesis mechanism of hydroxycinnamic acid amide and barley malt guanidine and its resistance to powdery mildew and fusarium head blight.

[0019] (2) The present invention is the first to confirm the function of the HvACT2 gene in the synthesis of hydroxycinnamic acid amide and hordein by transgenic means, and found that overexpression of HvACT2 can significantly improve the disease resistance of barley.

[0020] (3) The present invention utilizes Escherichia coli prokaryotic expression technology to exogenously express HvACT2, and substrate feeding experiments show that HvACT2 has the function of catalyzing the synthesis of p-coumaroyl agmatine and feruloyl agmatine.

[0021] (4) The present invention utilizes tobacco transient expression technology to heterologously express HvACT2. The results of metabolic detection after transient expression in tobacco indicate that transient expression of HvACT2 synthesizes a variety of agmatine amides in tobacco, which are not originally present in tobacco. That is, the expression of the exogenous gene causes tobacco to synthesize agmatine amides. It is also found that expression of HvACT2 in tobacco also increases the content of caffeoylputrescine. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 Manhattan plot of genome-wide association analysis of guanidine C abundance in 100 barley core accessions.

[0023] Figure 2 This is a diagram of the structure of the HvACT2 gene.

[0024] Figure 3 is a schematic diagram of the construction of HvACT2 gene overexpression;

[0025] Among them: A represents pBRACT214: HvACT2 overexpression vector map, the vector includes: 35S promoter, hygromycin resistance gene (Hygromycin), corn Ubi promoter (ZmUbi), attR1 and attR2 and HvACT2 insert fragment, terminator NOS; B represents the 1% agarose gel electrophoresis gel map of the overexpressed HvACT2-2 insert fragment; C represents the overexpression HvACT2 LR verification map; D represents the overexpression transgenic strain verification map.

[0026] Figure 4 This is the verification result of HvACT2 gene-edited transgenic plants;

[0027] Among them, A represents the insertion verification of the gene-edited barley vector; B represents the typical target editing situation of the T1 generation of the Cas9-HvACT2 gene-edited barley line.

[0028] Figure 5 It is the relative abundance of phenolamides (CPS) in the leaves of HvACT2 overexpression and gene-edited strains at the seedling stage, including the relative abundance of Np-Coumaroylagmatine, Feruloyl agmatine, Sinapoylagmatine, Np-Coumaroylputrescine, Feruloyl putrescine, Hordatine A, Hordatine B and Hordatine C in the leaves of HvACT1 and HvACT2 overexpression and gene-edited strains at the seedling stage (WT: wild type, OX-HvACT2: HvACT2 overexpression strain; cas9-HvACT2: HvACT2 knockout strain).

[0029] Figure 6 is the powdery mildew phenotype of the wild type and HvACT2 overexpressing strains inoculated at the seedling stage;

[0030] Among them, A represents the growth of powdery mildew spots at 6d and 12d after inoculation; B represents the growth of powdery spore hyphae at 3d, 6d and 12d after inoculation.

[0031] Figure 7 is the phenotype of wild type and HvACT2 overexpressing strains inoculated with Fusarium graminearum PH-1;

[0032] Among them, A represents the phenotype of the panicle inoculated with PH-1; B represents the diseased spikelet rate; C and D represent the relative abundance of deoxynivalenol and aureusin in the panicle of the wild type and overexpression lines after inoculation with PH-1, respectively. * represents P < 0.05, ** represents P < 0.01, and the differences between the overexpression lines and the wild type were analyzed by T test.

[0033] Figure 8 It is the construction of pET28a-HvACT2 prokaryotic expression vector, purification of exogenous protein and live detection;

[0034] Among them, A represents the pET28a-HvACT2 insert; B represents the pET28a plasmid linearization electrophoresis, in which the last lane is the original plasmid and 1-4 are the enzyme-digested plasmids; C represents the pET28a-HvACT2 verification; D represents the pET28a-HvACT2 vector map; E represents the purified pET28a-HvACT2 fusion protein Western blot analysis; F and G represent the enzyme activity analysis results of the pET28a-HvACT2 prokaryotic expression protein.

[0035] Fig. 9 The results of the construction and metabolic verification of the SK-HvACT2 tobacco transient expression vector. A represents the SK-HvACT2 insert; B represents the electrophoresis of the SK plasmid restriction linearization, where the first lane is the original plasmid and the other lanes are restriction-digested plasmids; C represents the SK-HvACT2 verification; D represents the schematic diagram of the SK-HvACT2 vector; E and F represent the relative abundance of coumaroyl agmatine amide-related metabolites detected in tobacco transient expression leaves (m / z is the mass number of the metabolite; RT is the retention time of the metabolite); G, H, and I represent the relative abundance of feruloyl agmatine-related metabolites detected in tobacco transient expression leaves; J represents the relative abundance of caffeoyl putrescine detected in tobacco transient expression leaves. DETAILED DESCRIPTION

[0036] The technical solution of the present invention is further described in detail below through specific embodiments. It should be understood that the implementation of the present invention is not limited to the following embodiments, and any form of modification and / or change made to the present invention will fall within the protection scope of the present invention.

[0037] In the present invention, unless otherwise specified, all parts and percentages are by weight, and the equipment and raw materials used can be purchased from the market or are commonly used in the art. The methods in the following embodiments are all conventional methods in the art unless otherwise specified.

[0038] Example 1

[0039] 1. Cloning of the HvACT2 gene and its coding region

[0040] 1. Cloning of HvACT2 gene

[0041] One week after germination, the leaves of barley Golden Hope (GP) were cut to about 2 cm for DNA extraction. DNA was extracted using the CTAB method to obtain GP genomic DNA for later use; GP genomic DNA was used as a template and 2× Max Master Mix (Dye Plus) high-fidelity DNA polymerase (P525, Vazyme, China) was used for gene amplification.

[0042] The amplification primers are:

[0043] HvACT2-F: 5'-AATGGAGGTAGCTAGCCCACTACT-3';

[0044] HvACT2-R: 5'-CGGTTCATGCATGGAGATCATCGATG-3';

[0045] PCR reaction system (50 μL): 25 μL 2×Phanta Max Master Mix (Dye Plus), 2 μL upstream and downstream primers (10 μM), 2 μL cDNA (100 ng / μL), and 19 μL sterile double distilled water.

[0046] PCR program: pre-denaturation at 95°C for 3 min, (denaturation at 95°C for 15 s, annealing at Tm-3°C for 15 s, extension at 72°C for 60 s / Kb) for 35 cycles, and complete extension at 72°C for 5 min.

[0047] The amplified product was purified and sent for sequencing, and a portion was kept for later use.

[0048] 2. Cloning of the coding region of HvACT2 gene

[0049] One week after the germination of barley GP, the whole seedling was frozen in liquid nitrogen for later use. The total RNA of barley was extracted using the MiniBest Plant RNA Extraction Kit (9769, Takara, Japan). The extraction steps were described in the reference manual. RNase contamination was prevented during the operation. The purity and concentration of the extracted RNA were determined using NanoDrop 2000 (Thermo Fisher Scientific Inc., USA) and the RNA was used for later use. The RNA reverse transcription kit PrimeScripTM II 1st Strand cDNA Synthesis Kit (RR037A, Takara, Japan) was used to perform first-strand reverse transcription DNA synthesis using total RNA as a template.

[0050] Using GP cDNA as template, high-fidelity DNA polymerase was used to amplify the gene coding region P525, Vazyme, China). The amplification primers are:

[0051] HvACT2-F: 5'-AATGGAGGTAGCTAGCCCACTACT-3';

[0052] HvACT2-R: 5'-CGGTTCATGCATGGAGATCATCGATG-3';

[0053] The PCR reaction system and PCR procedure were the same as above.

[0054] This gene has no introns. The gene structure diagram is shown in Figure 2 .

[0055] 2. Verification of HvCACT2 gene function by overexpression and gene editing transgenic methods

[0056] 1. Construction of pBract214:HvACT2 overexpression vector

[0057] (1) Based on the cloning of the complete coding region of HvACT2, primers with attB1 and attB2 linkers and HvACT2 gene sequence specificity were designed, and the target gene was used as a template to amplify a fragment with attB1 / attB2 genes at both ends. The amplification primers were:

[0058] HO-HvACT2-2F: 5'-aaaaagcaggctAATGGAGGTAGCTAGCCCACTACT-3';

[0059] HO-HvACT2-2R: 5'-agaaagctgggtCGGTTCATGCATGGAGATCATCGATG-3';

[0060] (2) BP recombination reaction was performed using BP recombinase mixture (11789-020, Invitrogen, USA). The two-round amplification products were inserted into the entry vector pDONR-zeo. The recombinant products were transformed into Escherichia coli. The monoclonal PCR was verified and sent for testing using primers attB1-F and M13R-R. The positive plasmids were saved. The sequencing primers were:

[0061] attB1-F: 5'-GGGGACAAGTTTGTACAAAAAAGCAGGCT-3';

[0062] M13R-R: 5'-CAGGAAACAGCTATGACC-3';

[0063] (3) Using LR recombinase mixture (11791-020, Invitrogen, USA) to perform LR recombination reaction, the target gene HvACT2 was transferred from pDONR-zeo to the overexpression vector pBRACT214 to obtain the pBRACT214-HvACT2 fusion product;

[0064] (4) The recombinant product was transformed into competent Escherichia coli DH5a (C502, Vazyme, China) by heat stimulation, and a single clone was selected for positive verification and sent for sequencing. The positive plasmid was saved. The verification primers were:

[0065] PBR214-F: 5'-GCATATGCAGCAGCTATATGTG-3';

[0066] PBR214-R: 5'-GATATCAGCTTGCATGCCGGTC-3';

[0067] After sequencing was confirmed, the plasmid was extracted to obtain pBRACT214:HvACT2 overexpression vector (see Figure 3 ).

[0068] 2. Construction of Cas 9:HvACT2 gene editing vector

[0069] (1) The U6 vector was linearized using BsaIHF-V2 restriction endonuclease (R3733L, NEB, USA), and the digestion product was subjected to rapid CIP dephosphorylation treatment (M0525V, NEB, USA) to prevent the vector from self-ligation;

[0070] (2) Design the target using the target design database and perform off-target detection. The target primers are:

[0071] cas9 HvACT2-F: 5'-cttgGGCGCAAAGACGTAGATAA-3',

[0072] cas9 HvACT2-R: 5'-aaacTTATCTACGTCTTTGCGCC-3';

[0073] (3) The target primers were dissolved in TE buffer to a final concentration of 100 μM / L and annealed at 90°C for 1-2 min using a PCR instrument;

[0074] (4) The target primer annealing product was phosphorylated by adding T4PNK (M0201S, NEB, USA);

[0075] (5) The U6 linearized vector and the annealed phosphorylated product were ligated using T4 ligase (M0202L, NEB, USA) to obtain Cas9-U6-HvACT1 and Cas9-U6-HvACT2 knockout vectors.

[0076] The product in (6) was transformed into competent Escherichia coli DH5a, and the primers P2 5'-GCGATTAAGTTGGGTAACGC-3' and cas9-Gene-R were used for single clone verification and sequencing.

[0077] After sequencing was confirmed to be correct, the plasmid was extracted to obtain the cas9:HvACT2 gene editing vector.

[0078] 3. Obtaining transgenic barley plants

[0079] The constructed overexpression positive plasmid and knockout vector positive plasmid were transformed into Agrobacterium by heat shock method, and commercial Agrobacterium competent cells AGL1 (AC1020S, Weidi Biotechnology, China) were used as the recipient strain. Agrobacterium was used to infect in vitro GP embryos for genetic transformation, and transgenic plants were obtained after hygromycin selection and culture. DNA of transgenic plants and wild-type leaves was extracted for positive identification;

[0080] Among them, the primers for overexpression plant verification are PBR214-F / PBR214-R, the length of the amplified fragment is 2185bp, and the primers are as follows;

[0081] PBR214-F: 5'-GCATATGCAGCAGCTATATGTG-3',

[0082] PBR214-R: 5'-GATATCAGCTTGCATGCCGGTC-3';

[0083] The gene-edited plants used primers Cas9-F1 / Cas9-R1 to verify whether the vector was inserted. The length of the amplified fragment was 462bp. The primers are as follows:

[0084] Cas9-F1: 5'-AATGGTCTTGCCTTGGCGTA-3';

[0085] Cas9-R1: 5'-GGTTAAGCAGCGCATTGAGG-3';

[0086] Take the transgenic plants with vector insertion, use T-C9-ACT2 F / T-C9-ACT2 R to sequence the knockout plants, detect the gene mutation type, and the amplification length is 1171bp. The verification primers are as follows:

[0087] T-C9-ACT2 F: 5'-CGTGTCCGTTTGAATCGACG-3';

[0088] T-C9-ACT2 R: 5'-AAGCGACGAGGAAGTTGCTG3';

[0089] After seed propagation, sufficient transgenic seeds are harvested and T1 generation seeds can be used for subsequent steps after positive identification (see Figure 4 ).

[0090] Example 2

[0091] 1. Comparison of the synthetic functions of hydroxycinnamic acid amide in barley HvACT2 overexpression and gene editing materials

[0092] The positive seedlings of each transgenic line and the wild type were planted, and the second expanded leaf of each line was taken at the seedling stage to extract metabolites and identify them. Metabolites were extracted using a chromatographic methanol-water solution (Vmethanol:Vwater=80:20); metabolites were detected and separated using UPLC-Q-TOF / MS (UPLC, Waters, USA; Q-TOF / MS, Triple TOF 5600plus System, AB SCIEX, USA), and non-targeted metabolic data were collected using MS-DIAL software for raw mass spectrometry data (wiff files) (http: / / prime.psc.riken.jp / compms / msdial / main.html). After exporting data (peak area) from MS-DIAL, the metabolite abundance was weighted by sample weight for data analysis (see Figure 5 ).

[0093] The results showed that compared with the wild type, the synthesis of p-coumaroylagmatine, feruloylagmatine, sinapinoylagmatine, coumaroylputrescine, feruloylputrescine and hordenine was significantly increased in the HvACT2 overexpression strain, among which the contents of coumaroylagmatine and feruloylagmatine were 11 times and 13 times that of the wild type, respectively; in the gene-edited materials, the abundance of hordenine B and C was reduced in the cas9-HvACT2 strain, among which the content of hordenine C was significantly reduced, and there was no significant difference in the content of other hydroxycinnamic acid amides between the gene-edited materials and the wild type.

[0094] 2. Disease resistance identification of barley HvACT2 overexpressing materials

[0095] Powdery mildew inoculation: Wild-type GP and HvACT2 overexpression lines were used as test materials, and the susceptible variety Franklin was used as the susceptible seedling to breed powdery mildew fungi. Each material was sown in a 5×10 plug tray and placed in an artificial climate box (22℃ day / 18℃ night, 14h day / 10h night, humidity 80%). When the seedlings grow to one leaf and one heart, inoculation was carried out. Before inoculation, water the inoculated leaves with a watering can, dip the powdery mildew grown on the susceptible seedlings with a brush, and gently shake off the inoculation. After 3d, 6d, and 12d of inoculation, trypan blue staining was used to observe the growth of powdery mildew spores (see Figure 6 ).

[0096] Inoculation of Fusarium graminearum: Each material was grown to the heading stage and inoculated with Fusarium graminearum PH-1. The specific steps are as follows: (1) Prepare potato dextrose agar (PDA) medium, inoculate PH-1 bacterial blocks, and culture at 25°C for 5 days (PAD formula: add 200g peeled potato blocks, 20g glucose and 20g agar to 1000mL water, boil and mix well, and then sterilize at 121°C for 20min); (2) Use a toothpick to pick a certain amount of hyphae, inoculate the middle florets of wild-type and overexpressing different strains of barley ears, and bag them; (3) After 15 days of inoculation, count the total number of spikelets, the number of diseased spikelets, and calculate the diseased spikelet rate; (4) Use UPLC-Q-TOF / MS to detect the content of vomitoxin in the inoculated ears (see Figure 7 ).

[0097] The results of powdery mildew inoculation showed that the powdery mildew spots of wild-type plants were obvious at 6 days of inoculation. Although fungal spots could also be observed on the leaves of overexpression strains, the number of spots was significantly less than that of wild-type strains. At 12 days of inoculation, the leaf spots of wild-type plants had been connected into blocks, the density of powdery mildew spores was very high, and obvious necrotic spots could be observed; the powdery mildew spots on the leaves of overexpression strains were significantly smaller. Optical observation showed that although no obvious fungal spots were observed on the leaves at 3 days of inoculation, the hyphae of powdery mildew spores had penetrated into the surface of the leaves. Powdery mildew hyphae began to spread and grow on the leaves of wild-type plants, but the hyphae on the leaves of overexpression strains grew significantly slower; at 6 days of inoculation, the colony area of ​​wild-type leaves further expanded and formed a large number of conidia, while the colony area of ​​overexpression strains was smaller at this time, and the number of conidia was significantly less than that of wild-type; at d12 of inoculation, the number of hyphae, conidia and colony area of ​​wild-type leaves further expanded, but the hyphae of OX2-2 strain grew significantly slower, accompanied by the formation of many papillae. The above results show that the overexpression line has strong powdery mildew resistance. The results of inoculation with PH-1 showed that the diseased spikelet rate of the overexpression line was significantly lower than that of the wild type, and the vomitoxin and fusarium toxin of the overexpression line were significantly lower than those of the wild type, indicating that overexpression of HvACT2 improves the plant's resistance to fusarium scurf.

[0098] Example 3 Heterologous expression of barley HvACT2 in Escherichia coli and detection of enzyme activity

[0099] Prokaryotic expression pET28a was used as the prokaryotic expression vector, and the pET28a_HvACT2 expression vector was constructed by homologous recombination. SalI and BamHI were used to linearize pET28a, and the target gene was cloned with the homologous arms of the vector sequence through two steps (the enzymes used for cloning and the PCR procedure were the same as the first step); ClonExpress II One Step Cloning Kit homologous recombination enzyme (C112-01, Vazyme, China) was used to catalyze the linearized vector and the inserted gene to complete the recombination reaction. The recombinant product was transformed into Escherichia coli competent DH5a, and a single clone was picked for verification, sent for sequencing, and the positive plasmid and bacterial solution were saved.

[0100] The primers used in the first round of amplification were:

[0101] HvACT2-F: 5'-ATGGAGGTAGCTAGCCCACTACTC-3',

[0102] HvACT2-R: 5'-TCATGCATGGAGATCATCGATG-3';

[0103] The primers used in the second round of amplification were:

[0104] pET28-ACT2-F: 5'-CAGCAAATGGGTCGCGGATCCATGGAGGTAGCTAGCCCACTACTC-3',

[0105] pET28-ACT2-R: 5'-TGCGGCCGCAAGCTTGTCGACTCATGCATGGAGATCATCGATG-3';

[0106] The primers used for verification were:

[0107] pET28a-F: 5'-CGATCCCGCGAAATTAATACGAC-3';

[0108] pET28a-R: 5'-GCTAGTTATTGCTCAGCGGTGG-3'.

[0109] The above-mentioned correctly sequenced positive plasmids and original plasmids were transformed into commercial competent BL21 (DE3) cells (EC1002S, Shanghai Weidi Biotechnology, China), cultured overnight on plates containing kanamycin, and single clones were picked. Single colonies that were positive for PCR verification were stored in a -70°C refrigerator with glycerol for later use.

[0110] Induce exogenous protein expression and purification: take 200 μL of expression bacterial solution and inoculate it into 10 mL of LB liquid medium, culture for 6 hours, and then inoculate 10 mL of bacterial solution into 200 mL of LB liquid medium to culture until OD600 is about 0.6; use a final concentration of 0.1 mM IPTG for induction, 100 rpm, 16 ° C for 20 hours, collect bacteria, resuspend the bacteria with 10 times the volume of bacteria in ultrasonic buffer, add 200 μL of 1 M PMSF and 2 mL of 100 mg / mL lysozyme, ultrasonically lyse the bacteria, centrifuge at 12,000g for 5 minutes at 4 ° C, collect the supernatant for soluble protein purification. The protein was purified using a His tag protein purification kit (CW0894S, Kangwei Century, China). First, the binding buffer and bacterial lysate were mixed in equal proportions and applied to a nickel gel column for chromatography at a flow rate of 10 column volumes / h. The loading speed could be controlled using an infusion drip tube. After all the samples were loaded onto the column, the column was rinsed with 15 column volumes of binding buffer to remove the impurities. The protein was eluted with 5 mL of elution buffer, and each 1 mL was collected in one tube. The collected eluate was the expressed target protein. The purification step was completed in a 4°C refrigerator. Western blot analysis of the exogenous protein was performed, and in vitro enzyme activity was determined (see Appendix Figure 8 ).

[0111] The catalytic activity of HvACT2 was verified in vitro. The pET28a_HvACT2 fusion protein was analyzed with coumaroyl-CoA and feruloyl-CoA as acyl donors and agmatine as acceptor. Metabolic analysis showed that HvACT2 could acylate agmatine in vitro to synthesize p-coumaroylagmatine and feruloylagmatine.

[0112] Example 4 Transient expression and metabolic analysis of barley HvACT2 in tobacco

[0113] Tobacco transient expression used pGreen Ⅱ 0029 62 SK expression vector, and homologous recombination method was used to construct SK-HvACT2 transient expression vector. BamHⅠ and EcoRⅠ were used to linearize the SK vector; the HvACT2 gene fragment containing the homologous sequence at the end of the linearized vector was obtained by two-step cloning, and the target gene was amplified with a linker sequence homologous to the vector using a high-fidelity DNA polymerase (P525, Vazyme, China). The linearized vector and the gene fragment were recombined using a homologous recombinase (C112-01, Vazyme, China); the homologous recombination product was transformed into competent cells DH5a, coated with LB plates containing kanamycin, and cultured at 37℃ overnight. After picking single clones for positive verification, the single clones that were verified as positive were sent to the company for sequencing. The primers used in the first round of amplification were the same as the primers used to construct the first round of amplification of the prokaryotic expression vector, and the second round of amplification primers were:

[0114] SK-HvACT2-F: cgctctagaactagtggatccATGGAGGTAGCTAGCCCACTACTC;

[0115] SK-HvACT2-R: gataagcttgatatcgaattcTCATGCATGGAGATCATCGATG

[0116] The primers for verification are:

[0117] SK-F:GTGGGTAGCATCCACTATCCTTCG;

[0118] SK-R:CCAGACTATTTCCTTATCGGGAAC;

[0119] The correctly sequenced SK-HvACT2 original plasmid was transformed into the Agrobacterium GV3101 strain, grown on a double-antibody plate for about two days, and a single Agrobacterium colony was selected for PCR identification. The positive bacterial solution and the empty bacterial solution were transferred to 50ml LB culture medium for expansion and culture to an OD600 of about 0.7-0.9. The above Agrobacterium was centrifuged at 3500rpm for 10min and the bacteria were collected. The Agrobacterium bacteria were resuspended with the injection buffer for tobacco transient expression. After repeated resuspension twice, the OD600 of the Agrobacterium bacterial solution was adjusted to about 0.5. Select tobacco with good growth for transient expression experiments, use a 2mL disposable syringe, inject SK-HvACT2 and the original empty Agrobacterium bacterial solution into the tobacco leaf flesh (avoiding the veins), mark the injected leaves, and culture for 3d for metabolic sampling.

[0120] Metabolite detection results showed that phenolamide-related metabolites were only detected in leaves transformed with plasmids containing gene fragments. Based on the anion mass, retention time and parent ion fragments of the five phenolamide metabolites, the five metabolites were identified as p-coumaroyl agmatine, p-coumaroyl hydroxyagmatine, feruloyl agmatine and two derivatives of feruloyl agmatine. In addition, caffeoyl putrescine more than doubled in the transformed tobacco leaves containing gene fragments.

[0121] The above-described embodiment is only a preferred embodiment of the present invention and does not limit the present invention in any form. There are other variants and modifications without exceeding the technical solution described in the claims. All nucleotide sequences of the transcript, genome and promoter of the HvACT2 gene, the amino acid sequence of the encoded protein, and biological materials containing any of the above genes belong to the protection scope of the present invention.

Claims

1. Application of barley agmatine coumaroyltransferase gene HvACT2 in improving disease resistance of barley, characterized in that: The disease resistance is resistance to powdery mildew and / or fusarium head blight; The full-length nucleotide sequence of the transcript cDNA of the barley agmatine coumaroyltransferase gene HvACT2 is shown in SEQ ID NO.

2.

2. The use according to claim 1, characterized in that The barley agmatine coumaroyl transferase gene HvACT2 improves the disease resistance of barley by promoting the synthesis of hydroxycinnamic acid amide and hordeoguanidine.

Images