Application of TEX2 gene and its RNAi interference system

Abstract

The present invention discloses the application of TEX2 gene and RNAi interference system thereof, and relates to the field of biomedical technology. The TEX2 gene and RNAi interference system of the present invention are used to prepare drugs for treating gastric cancer. The RNAi interference system can efficiently knock down TEX2 gene / protein in gastric cancer cells, inhibit the proliferation, invasion and migration of cancer cells, and has simple operation and high efficiency. The present invention also discloses a kit for diagnosing or judging the prognosis of diseases such as gastric cancer with high expression of TEX2 gene / protein, using TEX2 gene / protein as a target for precision treatment, and is also used to prepare targeted drugs.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine technology, and more specifically, relates to the application of TEX2 gene (gene ID: 55852, protein ID: Q8IWB9) and its RNAi interference system in the preparation of drugs for treating gastric cancer. Background Art

[0002] Data show that although immunotherapy has reduced the mortality / morbidity ratio to a certain extent, the current diagnosis and treatment of gastric cancer is still unsatisfactory. Although there are a large number of scientific research results on the mechanism of gastric cancer occurrence and development, as well as prognosis, including bioinformatics databases based on transcriptome data, there is an urgent need for secretory protein markers that are convenient for diagnosis and treatment.

[0003] Secretory proteins are a type of proteins that are released into the extracellular space through exocytosis after protein synthesis. Because of their high sensitivity, strong specificity, and good reproducibility, secretory proteins can be used as potential tumor markers and drug targets. For example, alpha-fetoprotein can be used to diagnose diseases such as liver cancer and liver disease, and cancer antigen 125 can be used to follow up on malignant tumors such as ovarian cancer and breast cancer. So, can the high levels of secretory proteins in the peripheral blood and tissues of gastric cancer patients be used as biomarkers for liquid biopsy of gastric cancer, or can they become diagnostic and therapeutic targets?

[0004] Since gastric cancer is prone to recurrence and biopsy cancer tissue is difficult to obtain, it is more practical to use patients' peripheral blood to detect gastric cancer markers. In view of this, the project team randomly retrieved 6 cases of gastric cancer patients' peripheral blood plasma before and after surgery from the clinical samples stored in the biological sample bank of our hospital, and took 6 cases of healthy people of the same age as the control. After the new generation of full-scan data independent acquisition mass spectrometry (DIA-MS) detection, 979 proteins and 5489 peptides were identified, and more than 10 differentially expressed secretory proteins were screened from the data after quality control. Combined with the results of proteomics bioinformatics analysis and ELISA, testis expressed protein 2 (TEX2) was confirmed to be significantly higher in the peripheral blood of gastric cancer patients before surgery than after surgery and in healthy people; while no significant changes were found in other digestive system tumors, such as intestinal cancer, liver cancer, etc. Correspondingly, the expression of TEX2 protein in gastric cancer tissue was significantly higher than that in benign control samples.

[0005] TEX2 contains a synapsin-like mitochondrial lipid-binding domain and is a potential lipid transporter. In mammalian cells, TEX2 is mainly localized in the endoplasmic reticulum and is a protein required for endosomal maturation and lysosomal digestion, and these functions are dependent on its lipid transfer activity. Currently, there are few studies on TEX2 and malignant tumors, and only reports have mentioned that TEX2 may be associated with lung cancer through sequencing and bioinformatics analysis. Summary of the invention

[0006] In view of the above problems existing in the prior art, the technical problem to be solved by the present invention is to provide an application of TEX2 gene and its RNAi interference system for preparing a drug for treating gastric cancer.

[0007] In order to solve the above technical problems, the technical solution adopted by the present invention is as follows:

[0008] Application of TEX2 gene in preparing medicine for treating gastric cancer.

[0009] Furthermore, the treatment of gastric cancer is to inhibit cell proliferation.

[0010] Furthermore, the treatment of gastric cancer is to inhibit cell migration.

[0011] Furthermore, the treatment of gastric cancer is to inhibit cell invasion.

[0012] The biomarker used to detect the expression of TEX2 protein in the patient's peripheral blood or cancer tissue is the TEX2 gene.

[0013] A kit for detecting the expression of TEX2 protein in peripheral blood or cancer tissue of a patient, comprising a TEX2 gene.

[0014] Use of the RNAi interference system of the TEX2 gene in the preparation of a drug for treating gastric cancer, wherein the sequence of the RNAi interference system of the TEX2 gene is as follows:

[0015] TEX2-shRNA1:TCGGATACAGTGTCCTATAAG,

[0016] TEX2-shRNA2: ACACCACCAAGTGCTCATAAA.

[0017] Furthermore, the RNAi interference system of the TEX2 gene is used to knock down the TEX2 gene in gastric cancer cells.

[0018] Furthermore, the RNAi interference system of the TEX2 gene is used to inhibit the expression of TEX2 protein in gastric cancer cells.

[0019] Compared with the prior art, the present invention has the following beneficial effects:

[0020] 1) The RNAi interference of the present invention can effectively knock down the TEX2 gene / protein in gastric cancer cells, inhibit the proliferation, invasion and migration of cancer cells, and the system is simple to operate and highly efficient.

[0021] 2) TEX2 gene / protein is a target for precision medicine. Kits are prepared for diagnosis or prognosis of diseases with high expression of TEX2 gene / protein, such as gastric cancer, and are also used for the preparation of targeted drugs. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 The expression diagram of TEX2 protein in peripheral blood and tissues of gastric cancer (A is the difference of protein content in plasma of 6 normal people and 6 gastric cancer patients detected by DIA-MS; B is the difference of protein content in plasma of 6 gastric cancer patients detected by DIA-MS; C is the intersection of high-content peptides in serum of gastric cancer patients and low-content peptides after gastric cancer patients and their expression heat map; D is the expression diagram of TEX2 protein in serum of 15 normal people and 15 gastric cancer, liver cancer and intestinal cancer patients before and after surgery detected by ELISA: TEX2 content in serum of normal people is 2.721±0.606 (ng / mL), TEX2 content in serum of gastric cancer patients before surgery is 4.874±1.124 (ng / mL), and TEX2 content in serum of gastric cancer patients after surgery is 3.591±0.641 (ng / mL));

[0023] Figure 2 The results of immunofluorescence detection of TEX2 protein expression in gastric cancer and benign gastric mucosal tissues (A is the fluorescence staining of TEX2 in gastric cancer tissues and benign gastric mucosal tissues; B is the statistical graph of fluorescence intensity; C is the relationship between the two groups of high and low TEX2 protein expression and the prognosis of gastric cancer patients);

[0024] Figure 3 The expression diagram of TEX2 protein in GES1 cells, HGC27 cells, AGS cells, MKN1 cells, and MKN45 cells;

[0025] Figure 4 The expression diagram of TEX2 protein after overexpression of the gene in HGC27 cells and MKN45 cells;

[0026] Figure 5 This is the plasmid map of the lentiviral knockdown vector;

[0027] Figure 6 This is the expression diagram of TEX2 protein after knocking down the gene in AGS cells and MKN1 cells;

[0028] Figure 7 Figure 2 shows the proliferation activity of AGS cells after TEX2 knockdown (A) and the proliferation activity of HGC27 cells after TEX2 overexpression (B).

[0029] Figure 8The invasion ability of AGS cells and MKN1 cells after TEX2 knockdown (A) and the invasion ability of HGC27 cells and MKN45 cells after TEX2 overexpression (B);

[0030] Fig. 9 The migration ability of AGS cells and MKN1 cells after TEX2 knockdown (A) and the migration ability of AGS cells and MKN1 cells after TEX2 overexpression (B);

[0031] Fig.10 This is a diagram showing the difference in tumor formation in mice with gastric cancer cells overexpressing the TEX2 gene. DETAILED DESCRIPTION

[0032] In order to make the purpose, technical scheme and advantages of the present invention clearer, the present invention is further described below in conjunction with specific embodiments. In the following embodiments, unless otherwise specified, the technical means used are conventional means well known to those skilled in the art.

[0033] The main reagents, consumables, and animal models used in the following examples are:

[0034] Opal 7-color immunohistochemistry kit (Perkin Elmer, USA).

[0035] Anti-human TEX2 antibody (042752-HRP, Usbiological Company, USA).

[0036] Anti-human TEX2 antibody (NBP1-8315, NOVUS Company, Taiwan, China).

[0037] Anti-CK antibodies.

[0038] Gastric cancer cell lines (MKN45, MKN1, AGS, HGC27) and gastric mucosal epithelial cell line (GES1) were purchased from Nanjing Kebai Biotechnology Co., Ltd.

[0039] RPMI-1640 culture medium and fetal bovine serum (Gibco, USA).

[0040] Five-week-old nude mice were purchased from the Experimental Animal Center of Nantong University.

[0041] The main instruments used in the following examples are as follows:

[0042] Multispectral pathology scanning system: Perkin Elmer, USA.

[0043] Inverted fluorescence microscope: Zeiss, Germany.

[0044] Gel imaging system: China Tianneng Company.

[0045] Multifunctional microplate reader: Thermo Corporation, USA.

[0046] Example 1

[0047] Sandwich ELISA:

[0048] ELISA was used to detect 96-well plates; 1:500 anti-TEX2 antibody (NBP1-8315) was used to coat the 96-well ELISA plate, 100uL per well, and the plate was washed with an automatic plate washer after overnight at 4°C; 5% calf serum was blocked at 37°C for 40min and washed with an automatic plate washer; serum was diluted 1:1 as antigen using coating solution, 100μL was added, at least two wells were added for each sample, and the plate was kept at 4°C overnight; the liquid in the wells was discarded and the plates were washed as before; 1:100 HRP-labeled anti-TEX2 antibody (042752-HRP) was added, and the plates were washed as before after 1h at 37°C; TMB-urea peroxide solution was added, 100μL per well, and the plates were kept at 37°C and protected from light for 20min; 50μL of stop solution was added to each well to stop the reaction, and the experimental results were determined within 20min, and the OD450nm reading was performed using a multifunctional microplate reader.

[0049] The results are as follows Figure 1 As shown in the figure, the TEX2 protein content in the peripheral blood of gastric cancer patients before surgery was significantly higher than its expression in the peripheral blood after surgery and in healthy people, and was consistent with the change trend of TEX2 protein in gastric cancer plasma detected by mass spectrometry.

[0050] Example 2

[0051] 1. Gastric cancer paraffin tissue array from the biological sample bank of the Affiliated Hospital of Nantong University (operations were performed between 2004 and 2009, the patients had not received immunotherapy, chemotherapy or radiotherapy before the operation, and the clinical case data were complete), including 145 cases of gastric cancer tissues and 45 cases of benign tissues.

[0052] 2. Multicolor immunofluorescence histochemistry

[0053] After the tissue chip was placed on a slice dryer, it was immersed in xylene for dewaxing and then dehydrated with gradient alcohol; after rinsing with distilled water, it was placed on a high-temperature slice rack in AR6 repair solution with a pH of 6.0 for high-temperature antigen repair; after cooling naturally to room temperature, it was rinsed with PBS and blocked with a primary antibody blocking solution for 10 minutes; 200 μL of anti-human TEX2 antibody working solution (NBP1-8315) with a dilution ratio of 1:100 was added to the tissue chip and kept at 4°C overnight; the tissue chip was taken out and rewarmed for 0.5 hours and then rinsed with PBS; 200 μL of secondary antibody working solution was added to the tissue chip and rinsed with PBS after 10 minutes at room temperature; the prepared fluorescent dye was added to the tissue chip, incubated at room temperature for 10 minutes in the dark, and then rinsed with PBS; if a second antibody was to be incubated, high-temperature antigen repair was performed, as described above; if no antibody was to be incubated again, after drying and transparency, the slide was sealed with DAPI.

[0054] The staining results were observed under a fluorescence microscope, and staining in the corresponding part of the cell was considered positive. Each sample was captured at 20 times magnification using Vectra3 automatic imaging software. Images were analyzed and scored using inForm4.1.0 (Perkin Elmer), and a threshold of positive or negative cells was set for each cell. The percentage of cells in each area was calculated and scored (0-100), and the cutoff point of TEX2 protein expression score was obtained by X-tile software based on survival time and survival status. The scores were as follows: 0-74.66 for low expression or no expression, and 74.67-100 for high expression. All data were processed using statistical software SPSS V.22.0, and the chi-square test was used for inter-group comparisons. Cox proportional hazard regression was used to analyze the prognostic factors of patients. The Kaplan-Meier method and log-rank test were used for univariate analysis of patient prognosis. All test results were considered statistically significant when P < 0.05.

[0055] The results are as follows Figure 2 As shown in Figure 2, TEX2 protein expression in gastric cancer tissues was higher than that in benign gastric mucosal epithelial cells; increased TEX2 protein was associated with lymph node metastasis in gastric cancer patients (χ 2 =7.198, P=0.027), advanced TNM stage (χ 2 =8.759, P=0.013); and the patient group with high expression had a short survival time (HR=2.445, P=0.016) and a poor prognosis.

[0056] Example 3

[0057] 1. Gastric cancer cell lines, including: HGC27 cells, AGS cells, MKN45 cells, and MKN1 cells, were cultured with RPMI-1640 complete medium. The temperature in the incubator was maintained at 37°C and 5% CO2 saturated humidity. The cells were routinely subcultured in the incubator, and cells in the logarithmic growth phase were selected for the experiment.

[0058] 2. Total cell protein extraction

[0059] (1) All gastric cancer cells were cultured in RPMI-1640 medium containing fetal bovine serum at 37°C and 5% CO2; (2) Gastric cancer cells were collected, the culture medium was discarded, and the cells were washed twice with pre-cooled PBS; (3) Different 1×SDS cell lysis buffers were added according to the size of the cell culture flask and the growth density of the cells, and then the cells were scraped clean with a cell scraper and transferred to a clean EP tube; (4) The scraped cell protein was fully lysed on ice for 30 minutes; (5) The supernatant was retained after centrifugation at 4°C, and the concentration of cell protein was measured using the BCA method and a multifunctional microplate reader, and stored in a -20°C refrigerator for future use.

[0060] 3. Western blot

[0061] (1) Prepare polyacrylamide gel (5% concentrated gel, 10% separation gel); (2) After the protein marker and the extracted protein sample are loaded, the operating voltage is adjusted to 100 V. After the end, the gel is removed and transferred to the membrane (PVDF membrane); (3) Constant current 300 mA is used for electrotransfer for 1.5 hours. The transfer must be carried out in an ice box; (4) After the transfer is completed, the PVDF membrane is placed in the blocking solution and blocked at room temperature for 2 hours; (6) The primary antibody dilution solution is prepared with the blocking solution, and the diluted primary antibody is evenly added to the PVDF membrane and incubated at 4°C overnight; (7) After washing the membrane, the secondary antibody dilution solution is prepared with TBST, and the diluted secondary antibody is evenly added to the PVDF membrane at room temperature for 1.5 hours; (8) After washing the membrane, the PVDF membrane is spread flat on the corresponding position of the developer, the ECL luminescent solution is diluted with TBST and evenly added to the PVDF membrane, and the gel imaging system is used to take pictures and save them.

[0062] The results are as follows Figure 3 As shown, TEX2 was expressed relatively high in AGS and MKN1 gastric cancer cells, and relatively low in HGC27 and MKN45 gastric cancer cells.

[0063] 3. Screening of gene knockout positive clones

[0064] 1) With respect to the TEX2 gene sequence, the sequence of the RNAi interference system specifically targeting the TEX2 gene is shown below, and a lentivirus-mediated RNAi interference system is constructed.

[0065] TEX2-shRNA1:TCGGATACAGTGTCCTATAAG,

[0066] TEX2-shRNA2: ACACCACCAAGTGCTCATAAA.

[0067] 2) Select an appropriate virus infection concentration, infect the target cells with lentivirus, and add a dyeing agent; 12-16 hours after infection, change the medium and continue culturing, while observing whether the cell state is abnormal; 72-96 hours after infection, observe the fluorescence under an inverted fluorescence microscope, and perform drug screening on the infected cells to collect more successfully infected cells.

[0068] 3) Preparation and growth of monoclonal clones: Dilute cells into 10 96-well plates by limiting dilution method; observe the growth of monoclonal clones after one week, and transfer the grown monoclonal clones to 48-well plates for expansion and culture after about two weeks; transfer the grown monoclonal clones to 24-well plates and 12-well plates for expansion and culture; when each monoclonal clone is expanded to 2 12-well plates, take out cells from one well, lyse and extract protein, and use Western blot to detect the knockdown monoclonal clones.

[0069] The results are as follows Figure 4 As shown, compared with the control group, the relative protein expression of TEX2 in cells treated with the RNAi interference system was significantly reduced, indicating that the expression of TEX2 protein in AGS cells and MKN1 cells was effectively inhibited.

[0070] 4. Construction of overexpression system and screening of stable strains

[0071] 1) Use the first and last primers to amplify the open reading frame region of TEX2 mRNA, and use gene recombination technology to recombinant the TEX2 expression fragment into the pCDH-CMV-MCS-EF1-puro vector ( Figure 5 ).

[0072] 2) After packaging into virus, select the appropriate virus infection concentration, infect the target cells with lentivirus, and add the dyeing agent; after 12-16 hours of infection, change the medium and continue culturing; after 72-96 hours of infection, observe the fluorescence under an inverted fluorescence microscope, and perform drug screening on the infected cells to collect more successfully infected cells.

[0073] 3) Preparation and growth of monoclonal clones: cells were diluted into 10 96-well plates by limiting dilution method; the growth of monoclonal clones was observed after one week, and the grown monoclonal clones were transferred to 48-well plates for expansion culture after about two weeks; the grown monoclonal clones were transferred to 24-well plates and 12-well plates for expansion culture in turn. When each monoclonal clone was expanded to 2 12-well plates, cells from one well were taken out, lysed and protein was extracted, and monoclonal clones overexpressing TEX2 were detected by Western blot.

[0074] The results are as follows Figure 6 As shown, compared with the control group, the relative protein expression of TEX2 in cells after expression treatment was significantly increased, indicating that the expression of TEX2 protein in HGC27 cells and MKN45 cells was effectively upregulated.

[0075] 5. Cell proliferation (CCK-8)

[0076] Digest and collect cells from each group 48 hours after transfection, centrifuge and set aside; resuspend the cells with complete culture medium and adjust the cell density to 30,000 cells / mL; add 100 μL of cell suspension to each well, set up 5 replicate wells for each group, and gently tap the 96-well plate to make the cells evenly distributed; after the cells adhere to the wall (about 6-8 hours), add CCK-8 reagent (10 μL per well) at 0, 24, 48, 72, and 96 hours, respectively, and gently tap the 96-well plate, put it in the incubator for 2 hours, take it out, and detect the absorbance value at 450 nm on the microplate reader, paying attention to the linear range of the microplate reader; use Graphpad prism to statistically process the measured data and draw a line graph.

[0077] The results are as follows Figure 7 As shown, after knocking down TEX2 by RNAi interference system, the proliferation activity of AGS cells decreased (A), while the proliferation activity of HGC27 cells after overexpressing TEX2 was significantly increased (B).

[0078] 6. Cell invasion (Transwell chamber method)

[0079] First, prepare the hydrogel (50 μL of hydrogel mixed in 350 μL of diluent, then add 50 μL of base medium to mix), add to the upper chamber of the transwell chamber, 100 μL each, to avoid bubbles; digest and collect the cells of each group 48 hours after transfection, centrifuge for use; resuspend the cells with RPMI-1640 base medium, and adjust the cell density to 5×10 4 / mL; add 800μL of complete culture medium to a 24-well plate, place in a small chamber, fully infiltrate, take 100μL of cell suspension and add to the upper chamber of the transwell chamber; take out after conventional culture for 24-48h, wash twice with 1×PBS, fix with 4% paraformaldehyde for 20min, and wash twice with 1×PBS; add 500μL of crystal violet staining solution to a 24-well plate, place in a small chamber, take out after 10min, wash twice with 1×PBS, invert the small chamber, and gently wipe off the cells in the upper chamber that have not passed through with a cotton swab;

[0080] The results are as follows Figure 8 As shown, the results were observed under an inverted microscope, and the results showed that the invasion ability of AGS cells and MKN1 cells decreased after TEX2 was knocked down by RNAi interference system (A), while the invasion ability of HGC27 cells and MKN45 cells was improved after TEX2 was overexpressed (B).

[0081] 7. Cell migration (scratch method)

[0082] Use a marker pen to draw horizontal lines evenly on the back of the 6-well plate, using a ruler to measure, approximately every 0.5 to 1 cm, across the holes, with at least 3 lines across each hole; add about 5×10 5 cells (the specific number varies with different cells, and it is determined that the cells can be fully confluent overnight); the next day, use the tip of the gun to measure the ruler and scratch as perpendicularly as possible to the horizontal line on the back; after the scratch, remove the culture medium in the well, wash twice with PBS, remove the scratched cells, add 1% complete culture medium; culture in a cell culture incubator; take pictures at 0 and 24 hours.

[0083] The results are as follows Fig. 9 As shown, the migration ability of AGS cells and MKN1 cells decreased after TEX2 was knocked down by RNAi interference system (A), while the migration ability of HGC27 cells and AGS cells was improved after TEX2 was overexpressed (B).

[0084] 8. Nude mouse subcutaneous tumor formation experiment

[0085] The above-mentioned TEX2 overexpression monoclonal strain (TEX2-OE-MKN45) and the control group MKN45 were routinely subcultured and expanded in a cell culture incubator; the skin of the nude mouse injection site was disinfected with 75% alcohol in a clean bench, and 50 μL (2×10 6 Each group had 5 mice, and 2 groups had 10 mice in total. The tumor volume of nude mice was measured every 3 days. The longest and shortest diameters of the tumor were measured with a vernier caliper to calculate the tumor volume V (mm 3 )=πab 2 / 6; After 9 weeks, the mice were killed, the tumors were removed, and the tumor tissues were photographed, measured and weighed.

[0086] The results are as follows Fig.10 As shown, the tumor grew expansively under the skin of nude mice. After one week, the tumor volume gradually increased and became hard. The tumor volume of the TEX2-OE-MKN45 group was significantly larger than that of the control group, and the weight was also significantly different.

Claims

1. Application of the RNAi interference system of TEX2 gene in the preparation of a drug for treating gastric cancer. The sequence of the RNAi interference system of TEX2 gene is as follows: TEX2-shRNA1:TCGGATACAGTGTCCTATAAG, TEX2-shRNA2: ACACCACCAAGTGCTCATAAA.

2. The use according to claim 1, characterized in that: The RNAi interference system of the TEX2 gene is used to knock down the TEX2 gene in gastric cancer cells.

3. The use according to claim 1, characterized in that: The RNAi interference system of the TEX2 gene is used to inhibit the expression of TEX2 protein in gastric cancer cells.

Images