A biological agent for inhibiting the transformation of adipose-derived mesenchymal stem cells into adipocytes

Abstract

The present invention provides a biological preparation for inhibiting the transformation of adipose mesenchymal stem cells into adipocytes, belonging to the field of cell biology technology. The biological preparation provided by the present invention includes a gene inhibitor for inhibiting the expression of the LINC02516 gene, and also includes a pharmaceutically acceptable carrier. The use of the biological preparation provided by the present invention can effectively inhibit the differentiation of adipose mesenchymal stem cells into adipocytes.

Description

[0001] This case is a divisional application. The title of the invention of the original application is: Application of a gene expression inhibitor in the treatment of obesity. The application date of the original application is: 2022-05-18, and the application number of the original application is: CN202210548230.6. Technical Field

[0002] The invention belongs to the technical field of cell biology, and in particular relates to a biological preparation that inhibits adipose mesenchymal stem cells from transforming into adipocytes. Background Art

[0003] As people's living standards improve, the overweight and obesity rates of Chinese residents are rising rapidly, and have created a heavy disease burden and economic burden on the country and society. Studies have shown that overweight and obese people are at high risk of hypertension, coronary heart disease, dyslipidemia, abnormal insulin function, type 2 diabetes and fatty liver.

[0004] Obesity is caused by the generation and enlargement of fat cells, and the generation of fat cells mainly depends on the proliferation and differentiation of adipose stem cells. Therefore, from the perspective of cell proliferation and differentiation, if the proliferation and differentiation of adipose stem cells are effectively inhibited, the generation of fat cells can be effectively reduced, thereby effectively inhibiting obesity. Summary of the invention

[0005] The purpose of the present invention is to provide an application of a gene expression inhibitor in treating obesity.

[0006] In order to achieve the above object, the present invention provides the following technical solutions:

[0007] First, the present invention provides an application of a gene expression inhibitor in the preparation of a drug for treating obesity, wherein the gene expression inhibitor is a LINC02516 gene expression inhibitor, and the transcript sequence of LINC02516 is shown in SEQ ID NO.1.

[0008] Preferably, the LINC02516 gene expression inhibitor is siRNA that inhibits LINC02516 gene expression.

[0009] Preferably, the siRNA comprises a sense strand and an antisense strand, the sense strand of the siRNA is shown as SEQ ID NO.4, and the antisense strand of the siRNA is shown as SEQ ID NO.5.

[0010] Secondly, the present invention provides a therapeutic drug for treating obesity, the drug comprising a LINC02516 gene expression inhibitor, the transcript sequence of the LINC02516 gene is shown in SEQ ID NO.1, and the LINC02516 gene expression inhibitor is a siRNA that inhibits the expression of the LINC02516 gene.

[0011] Preferably, the siRNA comprises a sense strand and an antisense strand, the sense strand of the siRNA is shown as SEQ ID NO.4, and the antisense strand of the siRNA is shown as SEQ ID NO.5.

[0012] Preferably, the drug further comprises a pharmaceutically acceptable carrier, and the pharmaceutically acceptable carrier is one of a solvent, a liposome, or a viral vector.

[0013] Secondly, the present invention provides an application of a LINC02516 gene expression inhibitor in the preparation of a drug for inhibiting the proliferation of adipose-derived mesenchymal stem cells, characterized in that the transcript sequence of the LINC02516 gene is as shown in SEQ ID NO.1, and the LINC02516 gene expression inhibitor is an siRNA that inhibits the expression of the LINC02516 gene.

[0014] Preferably, the siRNA comprises a sense strand and an antisense strand, the sense strand of the siRNA is shown as SEQ ID NO.4, and the antisense strand of the siRNA is shown as SEQ ID NO.5.

[0015] Finally, the present invention provides the use of siRNA of LINC02516 gene in the preparation of an inhibitor of Cyclin-D1 and CDK1 gene protein expression in adipose mesenchymal stem cells, the transcript sequence of the LINC02516 gene is shown in SEQ ID NO.1, the siRNA includes a sense chain and an antisense chain, the sense chain of the siRNA is shown in SEQ ID NO.4, and the antisense chain of the siRNA is shown in SEQ ID NO.5.

[0016] The beneficial effects of the present invention are:

[0017] The present invention found that the expression level of LINC02516 was significantly increased during the adipogenic differentiation of adipose-derived mesenchymal stem cells. Inhibiting LINC02516 can effectively inhibit the adipogenic differentiation of adipose-derived mesenchymal stem cells and the proliferation of adipose-derived mesenchymal stem cells, thereby effectively inhibiting the generation of fat cells. Therefore, it can be used to treat obesity. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1Changes in the expression level of LINC02516 during adipogenic transformation of adipose-derived mesenchymal stem cells;

[0019] Figure 2 The inhibitory effect of the siRNA provided by the present invention;

[0020] Figure 3 Oil Red O staining test results;

[0021] Figure 4 Protein expression of adipogenic genes PPARγ and aP2 after siRNA transfection;

[0022] Figure 5 Protein expression of cell cycle genes Cyclin-D1 and CDK1 after siRNA transfection. DETAILED DESCRIPTION

[0023] In order to clearly illustrate the technical features of this solution, this solution is described below through a specific implementation method.

[0024] Example 1

[0025] Detection of the difference in LINC02516 expression during adipogenic differentiation of adipose-derived mesenchymal stem cells

[0026] (1) Adipose-derived mesenchymal stem cells were seeded into a 6-well cell culture plate and cultured with complete medium;

[0027] (2) When the cell density of adipose-derived mesenchymal stem cells reached about 90%, the complete medium was removed and adipogenic induction medium was added to induce adipogenesis. RNA was extracted on day 0, day 3, day 7, day 10, and day 14, respectively;

[0028] (3) After RNA extraction, reverse transcription kit was used to reverse transcribe RNA into cDNA;

[0029] (4) Primers for gene LINC02516 were designed based on the transcript sequence of LINC02516 (SEQ ID NO. 1). The primer sequences are as follows:

[0030] Upstream primer: GTGTACTCCTGGGAGCTCCT (SEQ ID NO. 2);

[0031] Downstream primer: GGCAGGAAAGGACATTCTCCA (SEQ ID NO. 3);

[0032] (5) The relative expression level of LINC02516 was detected using a fluorescence quantitative PCR kit, with GAPDH as the internal reference and 2 -△△CT The experimental results are as follows: Figure 1 shown.

[0033] Among them, at 3 days of culture, the relative expression level of LINC02516 was 2.02±0.18, P less than 0.05, and the difference was statistically significant;

[0034] At 7 days of culture, the relative expression level of LINC02516 was 3.26±0.14, P less than 0.05, and the difference was statistically significant;

[0035] At 10 days of culture, the relative expression level of LINC02516 was 4.14 ± 0.10, P less than 0.05, and the difference was statistically significant;

[0036] At 14 days of culture, the relative expression level of LINC02516 was 4.62±0.21, P less than 0.05, and the difference was statistically significant;

[0037] From the above results, it can be seen that the expression level of LINC02516 increases during the adipogenic differentiation process, indicating that the increased expression level of LINC02516 may be related to the promotion of adipogenic differentiation of adipose-derived mesenchymal stem cells. Therefore, we believe that the adipogenic differentiation of adipose-derived mesenchymal stem cells can be inhibited by inhibiting the expression level of LINC02516 during the adipogenic differentiation process.

[0038] Example 2

[0039] Inhibit the expression of LINC02516 and detect the changes in adipogenic differentiation of adipose-derived mesenchymal stem cells

[0040] 1. Detection of the inhibitory effect of siRNA against LINC02516

[0041] (1) Designing siRNA based on the transcript sequence of gene LINC02516. The sequence of the siRNA is as follows:

[0042] siRNA positive strand: GAGAGAGAGUGCAAAGCAA (SEQ ID NO. 4);

[0043] siRNA antisense strand: UUGCUUUGCACUCUCUCUC (SEQ ID NO. 5);

[0044] siNC was provided by a siRNA synthesis company;

[0045] (2) Adipose-derived mesenchymal stem cells were seeded in a 6-well cell culture plate, and siNC and siRNA were transfected into the adipose-derived mesenchymal stem cells, respectively;

[0046] (3) 48 h after transfection, RNA was extracted, reverse transcription and fluorescence quantitative PCR were performed to detect the relative expression level of LINC02516. The results were as follows: Figure 2 As shown;

[0047] Among them, after transfection of siRNA, the relative expression level of the cells was 0.16±0.06, and the inhibition rate was about 84%, indicating that the siRNA designed by the present invention can effectively inhibit the expression of LINC02516.

[0048] 2. Oil Red O assay to detect changes in adipogenic differentiation of adipose-derived mesenchymal stem cells after siRNA transfection

[0049] (1) Adipose-derived mesenchymal stem cells were seeded into 6-well cell culture plates and transfected with siNC and siRNA, respectively;

[0050] (2) 48 h after transfection, the medium was changed to adipogenic induction medium for culture;

[0051] (3) After 7 days of culture, the culture medium was removed and the culture wells were washed with PBS. After washing three times, the PBS was removed and 10% paraformaldehyde was added to fix the cells for 30 min.

[0052] (4) After fixation, remove the paraformaldehyde, add the prepared Oil Red O staining solution, cover the cells, and stain the cells at room temperature;

[0053] (5) Stain for 30 minutes, aspirate the staining solution, gently rinse the cells 2-3 times with PBS, and observe and photograph them under an inverted microscope. The results are as follows: Figure 3 shown.

[0054] It can be seen that the number of cells stained with Oil Red O was significantly less in cells transfected with LINC02516 siRNA, indicating that inhibiting the expression of LINC02516 can effectively inhibit the adipogenic differentiation of adipose-derived mesenchymal stem cells.

[0055] Example 3

[0056] Protein expression of adipogenic genes PPARγ and aP2 in adipose-derived mesenchymal stem cells after inhibition of LINC02516

[0057] (1) Adipose-derived mesenchymal stem cells were seeded into 6-well cell culture plates and transfected with siNC and siRNA, respectively;

[0058] (2) 48 h after transfection, the medium was changed to adipogenic induction medium for culture;

[0059] (3) After 7 days of culture, the culture medium was removed, protein lysis buffer was added, and after sufficient lysis, the cells were scraped off and transferred to a 1.5 ml centrifuge tube;

[0060] (4) After lysis on ice for 30 minutes, place the centrifuge tube in a centrifuge and centrifuge for 15 minutes. Transfer the resulting supernatant to a new 1.5 ml centrifuge tube and measure the concentration of the protein sample.

[0061] (5) Add loading buffer to adjust the protein sample to a uniform protein concentration, and heat the centrifuge tube in boiling water for 5 min;

[0062] (6) preparing a protein electrophoresis gel, loading the sample and performing electrophoresis, the initial condition is a constant voltage of 90 V, and when bromophenol blue reaches the separation gel, the constant voltage is adjusted to 120 V until the bromophenol blue runs out of the bottom of the electrophoresis gel;

[0063] (7) After the electrophoresis is completed, install the electrotransfer clip, set the electrotransfer conditions, and perform electrotransfer;

[0064] (8) After electroporation, the membrane was removed and placed in blocking solution for blocking. After blocking for 1 h, the membrane was incubated with primary antibodies against PPARγ, aP2, and GAPDH.

[0065] (9) After the incubation, wash the membrane and then incubate with the secondary antibody;

[0066] (10) After the secondary antibody incubation is completed, the development and exposure are performed, and the experimental results obtained are as follows Figure 4 shown.

[0067] As can be seen from the figure, inhibiting the expression of LINC02516 can effectively inhibit the protein expression of adipogenic genes PPARγ and aP2 in adipose-derived mesenchymal stem cells.

[0068] Example 4

[0069] Proliferation of adipose-derived mesenchymal stem cells after inhibition of LINC02516

[0070] (1) Adipose-derived mesenchymal stem cells transfected with siNC and siRNA were seeded into a 96-well cell culture plate, with 100 ul added to each well, and each 100 ul contained 2000 cells;

[0071] (2) After the 96-well plate was placed in a cell culture incubator for 72 h, the cells were tested according to the instructions of CCK-8.

[0072] The test results showed that the OD value of cells transfected with siNC was 0.59±0.04, and the OD value of cells transfected with siRNA was 0.48±0.05, with a P value less than 0.05, and the difference was statistically significant. The above results indicate that inhibiting the expression of LINC02516 in adipose-derived mesenchymal stem cells can effectively inhibit the proliferation of adipose-derived mesenchymal stem cells.

[0073] Example 5

[0074] Protein expression of cell cycle genes Cyclin-D1 and CDK1 in adipose-derived mesenchymal stem cells after inhibition of LINC02516

[0075] (1) Adipose-derived mesenchymal stem cells were seeded into 6-well cell culture plates and transfected with siNC and siRNA, respectively;

[0076] (2) 48 h after transfection, the medium was changed to adipogenic induction medium for culture;

[0077] (3) After 7 days of culture, the culture medium was removed, protein lysis buffer was added, and after sufficient lysis, the cells were scraped off and transferred to a 1.5 ml centrifuge tube;

[0078] (4) After lysis on ice for 30 minutes, place the centrifuge tube in a centrifuge and centrifuge for 15 minutes. Transfer the resulting supernatant to a new 1.5 ml centrifuge tube and measure the concentration of the protein sample.

[0079] (5) Add loading buffer to adjust the protein sample to a uniform protein concentration, and heat the centrifuge tube in boiling water for 5 min;

[0080] (6) preparing a protein electrophoresis gel, loading the sample and performing electrophoresis, the initial condition is a constant voltage of 90 V, and when bromophenol blue reaches the separation gel, the constant voltage is adjusted to 120 V until the bromophenol blue runs out of the bottom of the electrophoresis gel;

[0081] (7) After the electrophoresis is completed, install the electrotransfer clip, set the electrotransfer conditions, and perform electrotransfer;

[0082] (8) After electroporation, the membrane was removed and placed in blocking solution for blocking. After blocking for 1 h, the membrane was incubated with primary antibodies against Cyclin-D1, CDK1, and GAPDH.

[0083] (9) After the incubation, wash the membrane and then incubate with the secondary antibody;

[0084] (10) After the secondary antibody incubation is completed, the development and exposure are performed, and the experimental results obtained are as follows Figure 5 shown.

[0085] Technical features not described in the present invention can be achieved through or by adopting existing technologies and will not be described in detail here. Of course, the above description is not a limitation of the present invention, and the present invention is not limited to the above examples. Changes, modifications, additions or substitutions made by ordinary technicians in this technical field within the essential scope of the present invention should also fall within the scope of protection of the present invention.

Claims

1. Use of a gene inhibitor for inhibiting LINC02516 gene expression in the preparation of a biological agent for inhibiting adipose mesenchymal stem cells from generating adipocytes, characterized in that: The transcript sequence of the LINC02516 gene is shown in SEQ ID NO.1; The gene inhibitor is siRNA of the LINC02516 gene, the sense strand sequence of the siRNA is shown in SEQ ID NO.4, and the antisense strand sequence of the siRNA is shown in SEQ ID NO.5.

Images