An amphoteric ion peptide-based electrochemical anti-fouling sensor and its application in the detection of tetracycline
By using zwitterionic peptide modified and gold nanoparticle modified electrodes in electrochemical sensors, combined with aptamer design, the problem of non-specific adsorption of sensors in biological media is solved, and rapid and sensitive detection of tetracycline is achieved, improving the selectivity and stability of detection.
Patent Information
- Application Number
- CN202310281992.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-03-22
- Publication Date
- 2025-07-11
- Estimated Expiration
- 2043-03-22
AI Technical Summary
Existing electrochemical detection technologies are susceptible to nonspecific adsorption of fouling layers in biological media, resulting in reduced sensor sensitivity and specificity.
Electrochemical stain-resistant sensors designed based on zwitterionic peptide-modified electrodes and aptamers are used to form a hydrated layer through the electrical neutrality and hydrophilicity of zwitterionic peptides, reducing non-specific adsorption, and using gold nanoparticles to enhance electrochemical activity and peptide immobilization capabilities.
It improves the biocompatibility and protein adsorption resistance of the sensor, enhances the selectivity and sensitivity of tetracycline detection, has good stability and repeatability, and is suitable for food safety detection.
Smart Images

Figure CN116519774B_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the technical field of anti-fouling biosensors, and particularly relates to an electrochemical anti-fouling sensor based on zwitterionic peptides and its application in the detection of tetracycline. Background Art
[0002] In recent years, due to its inherent advantages of ultrasensitivity, low cost, and high stability, electrochemical detection technology has stood out among many food safety detection technologies and has been widely used in food safety analysis. However, in actual biological media, various biomolecules will non-specifically adsorb onto the surface to form a fouling layer, which will not only change the chemical properties of the sensor surface but also affect the sensitivity and specificity of the sensor itself. Therefore, it is crucial to develop a biosensing interface with anti-fouling ability to prevent non-target substances from adsorbing onto the sensor surface.
[0003] Polypeptides are considered to be promising biological anti-fouling materials at present due to their excellent biocompatibility, adjustable sequences, and easy synthesis. It is composed of amino acids with zwitterionic residues, so it is overall electrically neutral; its main chain and side chain contain groups with strong hydrophilic properties such as carboxyl and hydroxyl groups, so it can form a strong hydration effect and form a dense hydration layer on the material surface, thereby reducing the non-specific adsorption of other biomolecules. Summary of the Invention
[0004] The purpose of the present invention is to construct an electrochemical anti-fouling sensor based on zwitterionic peptides, and the constructed sensor can be used for the rapid and sensitive detection of tetracycline in food. To achieve the above purpose, the technical solution of the present invention is as follows:
[0005] The first object of the present invention is to provide a zwitterionic peptide with the sequence CPPPPKSEKSEKSEE-NH2.
[0006] In one embodiment, after the C-terminus of the zwitterionic peptide is amidated, the whole peptide chain has a balanced charge and is electrically neutral.
[0007] The second object of the present invention is to provide an anti-fouling electrode, which is an electrode modified with the above-mentioned zwitterionic peptide.
[0008] In one embodiment, the electrode is a glassy carbon electrode modified with gold nanoparticles.
[0009] The third object of the present invention is to provide an electrochemical anti-fouling sensor, which contains the above-mentioned zwitterionic peptide or the above-mentioned anti-fouling electrode.
[0010] In one embodiment, the electrochemical anti-fouling sensor contains an aptamer.
[0011] In one embodiment, the 5'-end of the aptamer is modified with a thiol group.
[0012] In one embodiment, the thiol-modifying group is -SH-(CH2)6-.
[0013] In one embodiment, the aptamer is designed according to the target analyte of the electrochemical anti-fouling sensor.
[0014] The fourth object of the present invention is to provide an electrochemical anti-fouling sensor for detecting tetracycline, which comprises a tetracycline aptamer and the above zwitterionic peptide or the above anti-fouling electrode.
[0015] In one embodiment, the sequence of the tetracycline aptamer is 5′-SH-(CH2)6-CGTACGGAATTCGCTAGCCCCCCGGCAGGCCACGGCTTGGGTTGGTCCCACTGCGCGTG GATCCGAGCTCCACGTG-3′.
[0016] The fifth object of the present invention is to provide a method for detecting tetracycline, which is to use the above electrochemical anti-fouling sensor for detection.
[0017] In one embodiment, the specific steps of the method are as follows:
[0018] (1) Place the above electrochemical anti-fouling sensor in tetracycline standard products with different concentrations and incubate for 60 min, measure by differential pulse voltammetry, record the current response value, and draw a standard curve;
[0019] (2) Place the above electrochemical anti-fouling sensor in a sample solution and incubate for 60 min, measure the current response value by differential pulse voltammetry, and calculate the tetracycline concentration in the sample solution according to the standard curve drawn in step (1).
[0020] In one embodiment, the buffer solution is a phosphate buffer solution containing 5 mM potassium ferricyanide and potassium ferrocyanide with 0.2 M potassium chloride.
[0021] In one embodiment, the potential range of the differential pulse voltammetry is -0.2 to 0.6 V, the amplitude is 50 mV, and the scanning rate is 0.1 V S -1 .
[0022] The sixth object of the present invention is to provide a method for preparing the above electrochemical anti-fouling sensor, and the specific steps of the method are as follows:
[0023] 1) Pretreat the glassy carbon electrode: Polish the glassy carbon electrode with alumina powder, and ultrasonically clean it with absolute ethanol and ultrapure water;
[0024] 2) Preparation of the nano - gold - modified electrode: Immerse the pretreated glassy carbon electrode in chloroauric acid solution and electro - deposit to obtain AuNPs / GCE;
[0025] 3) Preparation of the aptamer - zwitterionic peptide solution: Dissolve the aptamer and the above - mentioned zwitterionic peptide in phosphate buffer solution;
[0026] 4) Modification of AuNPs / GCE with aptamer and zwitterionic peptide: Immerse AuNPs / GCE in the aptamer - zwitterionic peptide solution and soak at 2 - 6 °C for more than 8 h to obtain the electrochemical anti - fouling sensor.
[0027] In one embodiment, the concentration of chloroauric acid is 4 - 6 mmol / L -1 。
[0028] In one embodiment, the voltage of electro - deposition is - 0.3 - - 0.5 V and the time is 60 s.
[0029] In one embodiment, the concentration of the zwitterionic peptide is 0.05 mg / mL -1 ~0.4 mg / mL -1 。
[0030] In one embodiment, the concentration of the aptamer is 1 μM - 5 μM.
[0031] In one embodiment, the aptamer is designed and screened according to the target analyte of the electrochemical sensor.
[0032] In one embodiment, the sequence of the aptamer is 5′ - SH-(CH2)6 - CGTACGGAATTCGCTAGCCCCCCGGCAGGCCACGGCTTGGGTTGGTCCCACTGCGCGTG GATCCGAGCTCCACGTG - 3′.
[0033] The present invention also provides the application of the above - mentioned zwitterionic peptide and the above - mentioned anti - fouling electrode in the preparation of an electrochemical anti - fouling sensor.
[0034] The present invention also provides the application of the above - mentioned electrochemical anti - fouling sensor or the above - mentioned electrochemical anti - fouling sensor for detecting tetracycline in the field of biological detection.
[0035] In particular, its application in the field of food safety detection.
[0036] The present invention also provides the application of the above - mentioned electrochemical anti - fouling sensor in the detection of small - molecule compounds.
[0037] Beneficial effects:
[0038] 1. The preparation method of the present invention is simple, easy to operate, and easy to miniaturize.
[0039] 2. The present invention uses zwitterionic peptides to modify the surface of the sensor, making the sensing surface have excellent biocompatibility and good anti-protein adsorption properties, and enhancing the selectivity and accuracy of the electrochemical anti-fouling sensor for tetracycline detection.
[0040] 3. The gold nanoparticles obtained by electrodeposition in the present invention have excellent electrochemical activity, and the interaction between Au-NH2 can improve the immobilization ability of polypeptides, thereby improving the sensitivity of tetracycline detection.
[0041] 4. The prepared electrochemical anti-fouling sensor has good stability and repeatability, and is suitable for the detection of tetracycline in food.
[0042] 5. The present invention can replace the aptamer in the preparation process of the electrochemical anti-fouling sensor by different detection targets to obtain an electrochemical anti-fouling sensor for different detection targets, which has a wide range of application scenarios. Brief Description of the Drawings
[0043] Figure 1 : Website prediction result diagrams of zwitterionic peptides (a) CPPPPRSERSERSE, (b) CPPPPRSDRSDRSD, (c)
[0044] CPPPPKSEKSEKSEE-NH2, (d) CPPPPKGSSEKGSSEE-NH2, (e) CKGSSEKGSSEE-NH2, (f) CPPPPNENKNENKE-NH2;
[0045] Figure 2 : Zeta potential diagrams of zwitterionic peptides (a) CPPPPRSERSERSE, (b) CPPPPRSDRSDRSD, (c) CPPPPKSEKSEKSEE-NH2, (d) CPPPPKGSSEKGSSEE-NH2, (e) CKGSSEKGSSEE-NH2, (f) CPPPPNENKNENKE-NH2;
[0046] Figure 3 : CD diagrams of zwitterionic peptides (a) CPPPPKSEKSEKSEE-NH2, (b) CPPPPNENKNENKE-NH2 with a concentration of 0.2 mg mL -1 in phosphate buffered saline (PBS) with a pH of 7.4;
[0047] Figure 4 : Schematic diagrams of the contact angles of the modified interfaces of GCE (upper), AuNPs / GCE (middle), and Pep / AuNPs / GCE (lower);
[0048] Figure 5 : Signal responses of GCE, AuNPs / GCE, and Pep / AuNPs / GCE in different protein solutions. Error bars represent the standard deviation of three repeated measurements;
[0049] Figure 6 In, a, b, c, and d are the electrochemical responses of GCE, AuNPs / GCE, Pep / AuNPs / GCE, and Apt-Pep / AuNPs / GCE incubated in 100 ng mL -1 tetracycline before and after incubation, respectively;
[0050] Figure 7 : Schematic diagram showing the influence of zwitterionic peptide concentration on the anti-fouling performance of the biosensor;
[0051] Figure 8 : Schematic diagram showing the influence of aptamer concentration on the anti-fouling performance of the biosensor;
[0052] Figure 9 : Schematic diagram showing the influence of tetracycline incubation time on the anti-fouling performance of the biosensor;
[0053] Figure 10 In, A: Electrochemical responses of the biosensor incubated with different tetracycline concentrations. B: Curve showing the relationship between tetracycline concentration and current change;
[0054] Figure 11 : Specificity investigation of the biosensor for 100 ng mL -1 tetracycline (a), 100 ng mL -1 chlortetracycline (b), 100 ng mL -1 doxycycline (c), 100 ng mL -1 oxytetracycline (d). Detailed implementation manners
[0055] Next, the technical solutions in the embodiments of the present invention will be clearly and completely described in conjunction with the accompanying drawings in the embodiments of the present invention.
[0056] As described in the background art, zwitterionic peptides can reduce the non-specific adsorption of interfering substances and further improve the specificity and accuracy of tetracycline detection. Based on this, the present invention provides a construction method for an electrochemical anti-fouling sensor based on zwitterionic peptides for rapid and sensitive detection of tetracycline in food.
[0057] Detection conditions for differential pulse voltammetry (DPV): DPV detection was carried out in a phosphate buffer solution (PBS, pH 7.4, 0.01 M) containing 5 mM potassium ferricyanide and potassium ferrocyanide with 0.2 M potassium chloride. The detection potential range was -0.2 to 0.6 V, the amplitude was 50 mV, and the scan rate was 0.1 V s -1 。
[0058] Detection conditions for cyclic voltammetry (CV): CV detection was carried out in a phosphate buffer solution (PBS, pH 7.4, 0.01 M) containing 5 mM potassium ferricyanide and potassium ferrocyanide with 0.2 M potassium chloride. The detection potential range was -0.2 to 0.6 V, the amplitude was 10 mV, and the scan rate was 0.1 V s -1 。
[0059] Example 1 Design and screening of zwitterionic peptides
[0060] (1) Design and synthesis of zwitterionic peptides
[0061] A series of antifouling zwitterionic peptides with different lengths were designed and synthesized, and the sequences are as follows: CPPPPRSERSERSE, CPPPPRSDRSDRSD, CPPPPKSEKSEKSEE, CPPPPKGSSEKGSSEE, CKGSSEKGSSEE, CPPPPNENKNENKE. Among them, the C-terminals of the polypeptides CPPPPKSEKSEKSEE, CPPPPKGSSEKGSSEE, CKGSSEKGSSEE, and CPPPPNENKNENKE were amidated to achieve charge balance, and the modified antifouling zwitterionic peptides CPPPPKSEKSEKSEE-NH2, CPPPPKGSSEKGSSEE-NH2, CKGSSEKGSSEE-NH2, and CPPPPNENKNENKE-NH2 were obtained.
[0062] (2) Performance testing of zwitterionic peptides
[0063] (a) Hydrophilicity
[0064] The relationship between the net charge and pH value of a series of zwitterionic peptides designed in step (1) was preliminarily predicted through a website, and the results are as Figure 1 shown. When the pH = 7.0, the net charge carried by the zwitterionic peptides is close to 0, and hydrophilic amino acids account for the majority, indicating that the zwitterionic peptides designed in step (1) all have good hydrophilicity.
[0065] (b) Electrical neutrality
[0066] A PBS solution (pH = 7.4) with a concentration of 0.02 mM was used to prepare a concentration of 0.2 mg mL -1For the zwitterionic peptide solution, the charge amount in the zwitterionic peptide solution was determined by Zeta potential, and the results are as Figure 2 shown. The Zeta potentials of Figures c and f are close to 0 at pH = 7, and two zwitterionic peptides CPPPPKSEKSEKSEE-NH2 and CPPPPNENKNENKE-NH2 with relatively good electrical neutrality were preliminarily screened out.
[0067] (c) Spatial structure
[0068] To determine the structural information of the designed polypeptides, the zwitterionic peptides CPPPPKSEKSEKSEE-NH2 and CPPPPNENKNENKE-NH2 were dissolved in 0.02 mM PBS solution (pH = 7.4), and the secondary structure of the zwitterionic peptides with a concentration of 0.2 mg mL -1 was detected by circular dichroism (CD). The wavelength range of the circular dichroism was 190 - 300 nm, and the results are as Figure 3 shown. CPPPPKSEKSEKSEE-NH2 has a negative absorption band near 200 nm and a relatively weak positive absorption band near 225 nm. This result indicates that this zwitterionic peptide has a secondary structure, and this secondary structure is beneficial to achieving a higher packing density; while the peptide CPPPPNENKNENKE-NH2 only has a negative absorption band near 200 nm and no positive absorption band near 220 nm, which may be due to the lack of a good α-helix structure and is not conducive to forming a rigid structure with support.
[0069] In summary, the peptide CPPPPKSEKSEKSEE-NH2 was screened out for the preparation of an electrochemical anti-fouling interface and an electrochemical anti-fouling sensor.
[0070] Example 2 Modifying the electrode with zwitterionic peptides
[0071] (1) Preparing the electrode
[0072] (a) Pretreating the glassy carbon electrode (GCE): The glassy carbon electrode was polished, that is, the bare GCE was polished on alumina powder with a particle size of 0.02 - 0.05 μm to remove surface impurities and obtain a smooth mirror-like surface, and then ultrasonically cleaned in absolute ethanol and ultrapure water for 2 min respectively. The standard for a well-polished glassy carbon electrode is that the peak-to-peak voltage difference measured by CV in a solution of 5 mM potassium ferricyanide and potassium ferrocyanide containing 0.2 M potassium chloride is less than 80 mV.
[0073] (b) Preparing AuNPs / GCE: The glassy carbon electrode pretreated in step (1) was immersed in a previously prepared 5 mmol L -1In the chloroauric acid solution, at a voltage of -0.5 V, electro-deposit for 60 s on the surface of the glassy carbon electrode to obtain an electrode modified with gold nanoparticles (AuNPs / GCE).
[0074] (c) Prepare zwitterionic peptide solution: Dissolve the zwitterionic peptide CPPPPKSEKSEKSEE-NH2 prepared in Example 1 in a 0.02 mM PBS solution (pH = 7.4) to obtain a zwitterionic peptide solution with a concentration of 0.2 mg mL -1 .
[0075] (d) Modify AuNPs / GCE with zwitterionic peptide: Immerse AuNPs / GCE in the zwitterionic peptide solution prepared in step (c) and incubate at 4 °C for more than 8 h. At this time, the zwitterionic peptide self-assembles onto AuNPs / GCE through gold-sulfur bonds to obtain the modified electrode Pep / AuNPs / GCE.
[0076] (2) Performance test of the electrode
[0077] Use the sessile drop method to measure the interfacial contact angle of the zwitterionic peptide and investigate the hydrophilicity of the electrode surface modified with the polypeptide. The results are as Figure 4 shown. The contact angle of the GCE surface is 60.6°; after being modified with AuNPs, the contact angle increases to 69.2°, indicating that the electro-deposited AuNPs enhance the interfacial hydrophobicity; after being modified with the polypeptide, the contact angle significantly decreases to 32.0°, indicating that the zwitterionic peptide has good hydrophilicity.
[0078] (3) Anti-fouling effect test of the electrode
[0079] Incubate the prepared electrodes Pep / AuNPs / GCE, AuNPs / GCE and bare GCE in positively charged bovine serum albumin (BSA), negatively charged lysine solution (LYS), and uncharged hemoglobin (HB) at different concentrations (1 mg L -1 , 2 mg L -1 , 5 mg L -1 ) for 30 min. Use DPV to record the corresponding current changes generated by different electrodes before and after incubation. The electrical signal before incubation is I0, and the electrical signal after incubation is I. Calculate the signal suppression rate. The results are as Figure 5 shown. After incubation in different concentrations and different single protein solutions, the signal suppression rate of the electrode modified with the polypeptide is significantly lower than that of the bare electrode and the electrode modified only with AuNPs, indicating that Pep / AuNPs / GCE has excellent anti-fouling performance.
[0080] Signal Suppression (%) = (electrical signal I0 - electrical signal I) / electrical signal I0 * 100%;
[0081] Example 3 Preparation of Electrochemical Anti-Fouling Sensor
[0082] (a) Pretreatment of GCE: Polish the GCE, that is, grind the bare GCE on alumina powder with a particle size of 0.02 - 0.05 μm to remove surface impurities and obtain a mirror-like smooth surface. Then ultrasonically clean it in absolute ethanol and ultrapure water for 2 min respectively. The standard for a well-polished glassy carbon electrode is that the peak-to-peak voltage difference measured by CV in a solution of 5 mM potassium ferricyanide and potassium ferrocyanide containing 0.2 M potassium chloride is less than 80 mV.
[0083] (b) Preparation of AuNPs / GCE: Immerse the glassy carbon electrode pretreated in step (1) into the pre-prepared chloroauric acid solution of 5 mmol L -1 and electro-deposit for 60 s on the electrode surface at a voltage of -0.5 V to obtain an electrode modified with gold nanoparticles (AuNPs / GCE).
[0084] (c) Preparation of aptamer - zwitterionic peptide solution: Dissolve the aptamer and the zwitterionic peptide CPPPPKSEKSEKSEE-NH2 prepared in Example 1 in a 0.02 mM PBS solution (pH = 7.4) to obtain a solution containing 0.2 mg mL -1 polypeptide and 3 μM aptamer.
[0085] (d) Modification of AuNPs / GCE with aptamer and zwitterionic peptide: Immerse AuNPs / GCE in the solution prepared in step (c) and incubate at 4 °C for more than 8 h. At this time, the polypeptide and the aptamer can self-assemble onto the modified electrode through gold-sulfur bonds (Apt-Pep / AuNPs / GCE). After rinsing the surface, a stable biosensor (Apt-Pep / AuNPs / GCE) can be obtained.
[0086] Aptamer sequence:
[0087] Apt76: 5′-SH-(CH2)6-CGTACGGAATTCGCTAGCCCCCCGGCAGGCCACGGCTTGGGTTGGTCCCACTGCGCGTG GATCCGAGCTCCACGTG-3′.
[0088] Example 4: Detection of Tetracycline by Electrochemical Anti-Fouling Sensor Apt-Pep / AuNPs / GCE
[0089] (1) Feasibility test for tetracycline detection
[0090] GCE, AuNPs / GCE, Pep / AuNPs / GCE, and Apt-Pep / AuNPs / GCE were incubated in 100 ng mL -1 tetracycline for 60 min, thoroughly rinsed with 0.2 mM PBS solution (pH = 7.4), and the current changes of each electrode before and after incubation were recorded using DPV. The results are as Figure 6 shown. Figures a, b, and c are the DPV response diagrams of GCE, AuNPs / GCE, and Pep / AuNPs / GCE before and after incubation with 100 ng mL -1 tetracycline. It can be seen that there is almost no change in the DPV response of GCE, AuNPs / GCE, and Pep / AuNPs / GCE before and after incubation with tetracycline, and no current change is caused, indicating that the tetracycline target has not been captured. Figure d is Apt-Pep / AuNPs / GCE. It can be clearly seen that there is a significant change in the DPV response before and after incubation with tetracycline, and an obvious current response is generated, indicating that the tetracycline target binds to the aptamer, hindering electron transfer. Therefore, the DPV current decreases. Through this change in current, quantitative detection of the tetracycline target can be achieved.
[0091] (2) Optimization of zwitterionic peptide concentration
[0092] An electrochemical anti-fouling sensor was prepared using the same method as in Example 3, except that the concentration of the zwitterionic peptide CPPPPKSEKSEKSEE-NH2 was adjusted to 0.05 mg mL -1 , 0.1 mg mL -1 , 0.2 mg mL -1 , 0.3 mg mL -1 , 0.4 mg mL -1 to prepare a series of electrochemical anti-fouling sensors. After incubating this series of electrochemical anti-fouling sensors in 1 mg mL - 1 BSA solution for 30 min, the changes in the DPV current of zwitterionic peptides with different concentrations were compared. The electrical signal before BSA incubation was recorded as I0, and the electrical signal after BSA incubation was recorded as I. The signal inhibition rate was calculated. The results are as Figure 7 shown. The range of DPV current change is the smallest when the concentration of the zwitterionic peptide is 0.2 mg mL -1 , indicating that the zwitterionic peptide reaches the maximum anti-fouling performance at this concentration.
[0093] (3) Optimization of aptamer concentration
[0094] The electrochemical anti-fouling sensor was prepared by the same method as in Example 3, except that the concentration of the aptamer was adjusted to 1 μM, 2 μM, 3 μM, 4 μM, and 5 μM, and a series of electrochemical anti-fouling sensors were prepared. This series of electrochemical anti-fouling sensors were respectively immersed in 100 ng mL -1 of the tetracycline standard solution, and then the change in the DPV current after incubating with different concentrations of tetracycline aptamers was compared. The electrical signal before tetracycline incubation was recorded as I0, and the electrical signal after tetracycline incubation was I. The signal inhibition rate was calculated. The results are as Figure 8 shown. When the 3 μM aptamer was modified on the electrode, it could be clearly seen that the change in the DPV response current before and after incubation was the largest, indicating that the binding amount of tetracycline to the aptamer at this concentration reached the maximum saturation.
[0095] (4) Optimization of the incubation time
[0096] The electrochemical anti-fouling sensor prepared in Example 3 was immersed in 100 ng mL -1 of tetracycline and incubated for 20 min, 40 min, 60 min, 80 min, and 100 min respectively. The change in the DPV current before and after incubation was compared. The electrical signal before tetracycline incubation was recorded as I0, and the electrical signal after tetracycline incubation was I. The signal inhibition rate was calculated. The results are as Figure 9 shown. When the incubation time was less than 60 min, the value of the current change gradually increased with the increase of the incubation time. When the incubation time exceeded 60 min, the current response value did not change significantly with the increase of the incubation time, indicating that the binding amount of tetracycline reached the maximum at 60 min.
[0097] (5) Establishment of the detection method for the tetracycline electrochemical anti-fouling sensor
[0098] The electrochemical anti-fouling sensor prepared in Example 3 was incubated in a series of tetracycline solutions with concentration gradients (concentration ranging from 0.01 to 100 ng mL -1 ) for 60 min, and the response of the electrochemical anti-fouling sensor to different concentrations of tetracycline was detected. The results are as Figure 10 shown. The linear fitting function of the biosensor is ΔI (μA) = 2.0221 lg(C) + 6.66711 (R 2 = 0.991), where ΔI refers to the current signal before incubation - the current signal after incubation (I0 - I), and C refers to the concentration of the tetracycline solution (ng mL -1 ). The detection limit (LOD) of the sensor for tetracycline was measured to be 0.0065 ng mL -1 (S / N = 3).
[0099] (6) Stability detection
[0100] In 100 ng mL-1 In the tetracycline solution, 7 Apt-Pep / AuNPs / GCEs were prepared by the same method as in Example 3. Under the same conditions, the relative standard deviation (RSD) of 7 measurements was 3.25%. After the sensor was used to determine tetracycline, it was stored in a refrigerator at 4 °C. Every 3 days, 100 ng mL -1 The tetracycline solution was measured. The current change value of the tetracycline solution measured on the 9th day was 81% of the initial current change value of the tetracycline solution measured, indicating that the constructed sensor had good stability.
[0101] (7) Specificity detection
[0102] The electrochemical anti-fouling sensor prepared in Example 3 was used to detect several tetracycline analogs (100 ng mL -1 tetracycline, 100 ng mL -1 chlortetracycline, 100 ng mL -1 doxycycline, 100 ng mL -1 oxytetracycline) to verify the specificity of the sensor. The differential pulse voltammetry (DPV) was used to record the current changes of the sensor detecting tetracycline analogs. The electrical signal before the incubation of the tetracycline analog was recorded as I0, and the electrical signal after the incubation of the tetracycline analog was recorded as I. The signal inhibition rate was calculated to evaluate the specificity of the biosensor. The results are as Figure 11 shown. It can be seen that the electrochemical anti-fouling sensor prepared by the present invention has good specificity.
[0103] Although the present invention has been disclosed above with preferred embodiments, it is not intended to limit the present invention. Anyone familiar with this technology can make various modifications and alterations without departing from the spirit and scope of the present invention. Therefore, the protection scope of the present invention should be defined by the claims.
Claims
1. An amphoteric ion peptide, characterized in that, The sequence is CPPPPKSEKSEKSEE-NH2.
2. An anti-fouling electrode, characterized in that, The anti-fouling electrode is an electrode modified with the zwitterionic peptide described in claim 1.
3. An electrochemical anti-fouling sensor, characterized in that, The electrochemical anti-fouling sensor contains the zwitterionic peptide described in claim 1 or the anti-fouling electrode described in claim 2.
4. An electrochemical anti-fouling sensor for detecting tetracycline, characterized in that, The electrochemical anti-fouling sensor contains a tetracycline aptamer and the zwitterionic peptide described in claim 1 or the anti-fouling electrode described in claim 2.
5. The electrochemical anti-fouling sensor according to claim 4, characterized in that, The sequence of the tetracycline aptamer is 5′-SH-(CH2)6-CGTACGGAATTCGCTAGCCCCCCGGCAGGCCACGGCTTGGGTTGGTCCCACTGCGCGTGGATCCGAGCTCCACGTG-3′.
6. A method for detecting tetracycline, characterized in that, The method is to perform detection using the electrochemical anti-fouling sensor described in claim 4 or 5.
7. The method according to claim 6, characterized in that The specific steps of the method are as follows: (1) Immerse the electrochemical anti-fouling sensor described in claim 4 or 5 in tetracycline standards with different concentrations and incubate for 60 min. Measure by differential pulse voltammetry, record the current response value, and plot a standard curve. (2) Immerse the electrochemical anti-fouling sensor described in claim 4 or 5 in the sample solution and incubate for 60 min. Measure the current response value by differential pulse voltammetry, and calculate the tetracycline concentration in the sample solution according to the standard curve plotted in step (1).
8. A method for preparing the electrochemical anti-fouling sensor according to claim 3, characterized in that, The specific steps of the method are as follows: 1) Pretreat the glassy carbon electrode: Polish the glassy carbon electrode with alumina powder, and ultrasonically clean it with absolute ethanol and ultrapure water. 2) Prepare a nano-gold modified electrode: Immerse the pretreated glassy carbon electrode in chloroauric acid solution and perform electrodeposition to obtain AuNPs / GCE. 3) Prepare an aptamer-zwitterionic peptide solution: Dissolve the aptamer and the zwitterionic peptide described in claim 1 in phosphate buffer solution. 4) Modify AuNPs / GCE with aptamer and zwitterionic peptide: Immerse AuNPs / GCE in the aptamer-zwitterionic peptide solution and soak at 2-6 °C for more than 8 h to obtain an electrochemical anti-fouling sensor.
9. Application of the electrochemical anti-fouling sensor described in claim 3 or the electrochemical anti-fouling sensor for detecting tetracycline described in claim 4 or 5 in the field of biological detection.
10. Application of the electrochemical anti-fouling sensor described in claim 3 in detecting small molecule compounds.
Citation Information
Patent Citations
Anti-pollution electrochemical immunosensor based on DNA-polypeptide conjugate as well as preparation method and application of anti-pollution electrochemical immunosensor
CN114216943A
Biosensor for detecting prostate specific antigen in human serum as well as preparation method and application of biosensor
CN114324526A